• No results found

Functional status and quality of life after treatment of peripheral arterial disease - Stellingen

N/A
N/A
Protected

Academic year: 2021

Share "Functional status and quality of life after treatment of peripheral arterial disease - Stellingen"

Copied!
2
0
0

Bezig met laden.... (Bekijk nu de volledige tekst)

Hele tekst

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Functional status and quality of life after treatment of peripheral arterial disease

Frans, F.A.

Publication date

2013

Link to publication

Citation for published version (APA):

Frans, F. A. (2013). Functional status and quality of life after treatment of peripheral arterial

disease.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)

and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open

content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please

let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material

inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter

to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You

will be contacted as soon as possible.

(2)

1. De AMC Linear Disability Score is een valide en reproduceerbaar instrument om het niveau van functioneren te meten van patiënten met perifeer arterieel vaatlijden en is zeer geschikt om het effect van interventies te evalueren. (dit proefschrift)

2. Vooralsnog lopen we niet te hard van stapel als we dotteren bij patiënten met claudicatio intermittens. (dit proefschrift)

3. Beslissingen over de behandeling van patiënten met claudicatio intermittens kunnen beter gebaseerd worden op de door de patiënt ervaren belemmering in loopafstand dan op de loopafstand gemeten op een loopband. (dit proefschrift)

4. Kennis van een minimaal belangrijk verschil (MID), na behandeling van patiënten met kritieke ischemie, kan behandelaars een beter inzicht geven in klinisch relevante veranderingen dan de traditionele significante verschillen in scores.

(dit proefschrift)

5. Zowel interventies gericht op verbetering van de perfusie van het been, als amputaties hebben een positieve invloed op de kwaliteit van leven van patiënten met kritieke ischemie. (dit proefschrift)

6. De meest optimale behandeling voor patiënten met claudicatio intermittens als gevolg van een iliacale obstructie is op dit moment nog niet bekend. (dit proefschrift) 7. Wie dikwijls in de spiegel kijkt en zich met schoonheid vleit, die kent de ware schoonheid niet maar jaagt naar ijdelheid. (F. van der Laan-Hartzema)

8. Als iets twee keer niet gelukt is, lukt het de derde keer wel.

9. “Three things in human life are important: the first is to be kind; the second is to be kind; and the third is to be kind.” (Henry James)

10. Wie over elke stap nadenkt, staat zijn hele leven op één been.

Franceline A. Frans 2013

Functional Status and Quality of Life

after Treatment of Peripheral Arterial Disease

Referenties

GERELATEERDE DOCUMENTEN

36 (a) Department of Modern Physics and State Key Laboratory of Particle Detection and Electronics, University of Science and Technology of China, Anhui; (b) School of Physics,

In Sensitivity Heuristic and Dynamic Selection, individual and group behavior of neural networks are regularized to improve the performance of the model.... In Sensitivity Heuristic,

At present, we do not have sufficient data to define a Xenopus L5-5S RNA interaction site and the nature of the interaction, However, the combination o f observations

C-terminus of RelA contains the domain responsible for the ribosome-binding 73 Relaxation of the stringent response by overexpression of ‘RelA 75 Displacement of ribosome-bound

These results suggest that L11 mutants relaxed the stringent response; the overexpressed L11 mutants also inhibited RelA activity during the amino acid

  GGATCCAGTGGCGATGAGTTCTCGTTGGATCATGTAAACGCATTCTGTGAGCTGACGAAGCAGT

In the present study, recombinant TFllIA proteins containing a series of scanning sequence substitution mutations within the N-terminal first three zinc fingers