• No results found

Functional status and quality of life after treatment of peripheral arterial disease - Table of contents

N/A
N/A
Protected

Academic year: 2021

Share "Functional status and quality of life after treatment of peripheral arterial disease - Table of contents"

Copied!
2
0
0

Bezig met laden.... (Bekijk nu de volledige tekst)

Hele tekst

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Functional status and quality of life after treatment of peripheral arterial disease

Frans, F.A.

Publication date

2013

Link to publication

Citation for published version (APA):

Frans, F. A. (2013). Functional status and quality of life after treatment of peripheral arterial

disease.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)

and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open

content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please

let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material

inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter

to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You

will be contacted as soon as possible.

(2)

Introduction and outline of the thesis

Validation of the Dutch version of the VascuQol questionnaire and the Amsterdam Linear Disability Score in patients with intermittent claudication.

Quality of Life Research. 2012;21(8):1487-1493

The relationship of walking distances estimated by the patient, on the corridor and on a treadmill, and the Walking Impairment Questionnaire in intermittent claudication.

Journal of Vascular Surgery. 2013;57(3):720-727

Systematic review of exercise training or percutaneous transluminal angioplasty for intermittent claudication.

British Journal of Surgery. 2012;99(1):16-28.

SUPERvised exercise therapy or immediate PTA for intermittent claudication in patients with an iliac artery obstruction--a multicentre randomised controlled trial; SUPER study design and rationale.

European Journal of Vascular and Endovascular Surgery. 2012;43(4):466-471.

Changes in functional status after treatment of critical limb ischemia.

Journal of Vascular Surgery. 2013;58(4):957-965

Statistical or clinical improvement? Determining the minimally important difference for the Vascular Quality of Life questionnaire in patients with critical limb ischemia.

Accepted for publication in the European Journal of Vascular and Endovascular Surgery

Summary and general discussion Samenvatting en algemene discussie List of publications

PhD portfolio Dankwoord Curriculum Vitae

Figures belonging to chapters 3-7.

Table of contents

Chapter 1. Chapter 2. Chapter 3. Chapter 4. Chapter 5. Chapter 6. Chapter 7. Chapter 8. Chapter 9. 113 129 159 173 95 81 53 37 23 11

Referenties

GERELATEERDE DOCUMENTEN

At present, we do not have sufficient data to define a Xenopus L5-5S RNA interaction site and the nature of the interaction, However, the combination o f observations

C-terminus of RelA contains the domain responsible for the ribosome-binding 73 Relaxation of the stringent response by overexpression of ‘RelA 75 Displacement of ribosome-bound

These results suggest that L11 mutants relaxed the stringent response; the overexpressed L11 mutants also inhibited RelA activity during the amino acid

  GGATCCAGTGGCGATGAGTTCTCGTTGGATCATGTAAACGCATTCTGTGAGCTGACGAAGCAGT

In the present study, recombinant TFllIA proteins containing a series of scanning sequence substitution mutations within the N-terminal first three zinc fingers

Finally I show how in the Eclogues Virgil engages with a third poetic genre, (cosmological) didactic, and how this engagement reflects both an Epicurean interest in the

UvA-DARE is a service provided by the library of the University of Amsterdam (http s ://dare.uva.nl) UvA-DARE (Digital Academic Repository).. There are children not receiving a