Ecology of a novel defensive symbiont of Drosophila: Spiroplasma-mediated protection against parasitic nematodes
by Sarah Cockburn
B.Sc, University of Victoria, 2006 A Thesis Submitted in Partial Fulfillment
of the Requirements for the Degree of MASTER OF SCIENCE in the Department of Biology
Sarah Cockburn, 2010 University of Victoria
All rights reserved. This thesis may not be reproduced in whole or in part, by photocopy or other means, without the permission of the author.
Supervisory Committee
Ecology of a novel defensive symbiont of Drosophila: Spiroplasma-mediated protection against parasitic nematodes
by Sarah Cockburn
B.Sc, University of Victoria, 2006
Supervisory Committee
Dr. Steve Perlman, (Department of Biology)
Supervisor
Dr. Louise Page, (Department of Biology)
Departmental Member
Dr. Caroline Cameron, (Department of Biochemistry/Microbiology)
Abstract
Supervisory Committee
Dr. Steve Perlman, (Department of Biology)
Supervisor
Dr. Louise Page, (Department of Biology)
Departmental Member
Dr. Caroline Cameron, (Department of Biochemistry/Microbiology)
Outside Member
Recently, there has been growing awareness that many animals and plants harbour bacterial symbionts that help protect them against natural enemies. The mushroom-breeding fly Drosophila neotestacea is commonly infected with a virulent parasitic nematode, Howardula aoronymphium. Infections are severe, reducing adult survival and mating success, and until recently virtually all females were rendered sterile. We have discovered that D. neotestacea harbours a strain of the bacterial symbiont Spiroplasma that restores fertility to nematode-parasitized female flies. Spiroplasma appears to be both increasing in frequency and spreading westward across N. America. My thesis examines associations between flies, nematodes and Spiroplasma in British Columbia, which appears to lie at the edge of the range of advancing Spiroplasma infections. I identified Spiroplasma-infected flies in British Columbia for the first time. Sequencing a number of Spiroplasma genes, as well as fly mitochondrial DNA, strongly suggests that the defensive symbiont is spreading westward. Furthermore, high nematode infection rates in BC, as well as laboratory experiments demonstrating the ability of Spiroplasma to restore fertility to nematode-parasitized BC flies, suggest that there is a strong selective pressure for Spiroplasma to continue to spread in BC. I also examined the generality of
Spiroplasma-mediated defense by exposing flies to a gram-negative bacterial pathogen, Pectobacterium carotovorum. Exposure dramatically reduced survival regardless of Spiroplasma infection, suggesting that Spiroplasma does not defend against gram-negative bacteria.
Table of Contents
Supervisory Committee ... ii
Abstract ... iii
Table of Contents ... v
List of Tables ... vi
List of Figures ... vii
Acknowledgments... viii
Chapter I: Introduction to defensive symbionts of arthropod ... 1
Chapter II: Distribution and dynamics of a Drosophila defensive symbiont ... 19
Chapter III: Testing the generality of a defensive symbiont: does Spiroplasma enhance the survival of Drosophila exposed to a gram negative bacterial pathogen ... 46
List of Tables
Table 1.1: Summary of known arthropod defensive symbionts ... Error! Bookmark not defined.
Table 2.1: Drosophila neotestacea field collection sites in British Columbia. ... 40 Table 2.2: Drosophila species and infection status of laboratory reared flies. ... 40 Table 2.3: Howardula aoronymphium prevalence in 2008 and 2009 wild caught British Columbia D. neotestacea. ... 41 Table 2.4: Prevalence of Spiroplasma infection in 2008 and 2009 wild caught British Columbia D. neotestacea. ... 41 Table 2.5: Mitochondrial haplotype diversity in a sample of British Columbia D.
List of Figures
Figure 2.1: Maximum likelihood phylogeny of Spiroplasma using the parE
(topoisomerase IV subunit B) gene. Numbers indicate bootstrap percentage at each node (out of 100 bootstraps). Location of samples collected in this study or GenBank
accession numbers are labelled in brackets. ... 43 Figure 2.2: Egg number per ovary in seven day old British Columbia D. neotestacea females as a function of Spiroplasma infection (mean ±SE). In H. aoronymphium infected treatments Spiroplasma increased fertility of flies (ANOVA randomization; Spiroplasma x H. aoronymphium interaction as a function of motherworm number and vial effect; F1,145 = 10.09, P = 0.001). Fertility was measured as the number of eggs at
stage 10B or later per ovary in seven day old laboratory reared flies. Numbers above the bars represent the total number of D. neotestacea examined. ... 44 Figure 2.3: Motherworm size of seven day old Spiroplasma infected (S+) and uninfected (S-) western D. neotestacea experimentally infected with H. aoronymphium.
Motherworm size (mean within individual flies) was significantly reduced by treatments (ANOVA; F1,127 = 48.97, P < 0.0001). Numbers above the bars represent the total
number of D. neotestacea examined. ... 45 Figure 3.1: Survival of female (a) and male (b) Spiroplasma infected (S+) and uninfected (S-) flies challenged with Pectobacterium carotovorum subsp. carotovorum (P+), a pathogenic gram negative bacterium or a sterile needle (P-) (N = 237 and 246
respectively). Three to seven day old female flies were pricked in the thorax with P. carotovorum or a sterile needle (to control for early death due to septic wound).
Spiroplasma infection does not detectably increase fly resistance to P. carotovorum (Cox proportional hazards; P = 0.9837 and P=0.9717 respectively). S+ and S- infected with P. carotovorum died significantly earlier than control flies (Cox proportional hazards; female: ² = 41.3351, df = 23, P = 0.0001, male: ² = 22.4762, df = 23, P = 0.0047). Data shown are the pooled results of two independent assays. ... 62
Acknowledgments
First and foremost, I would like to thank Dr. Steve Perlman. Steve has
contributed to this research and to my development as a researcher in so many ways; he is an amazing supervisor. I‟d like to also acknowledge and thank my committee members, Dr. Louise Page and Dr. Caroline Cameron, for their time and advice during this project. Thanks to all the members of the Perlman lab, particularly Graeme Taylor and Joyce Carneiro, for their friendship, assistance and for preserving my sanity.
I can‟t thank my family enough for always encouraging and continuously
supporting me. Finally, I would like to thank Finn Hamilton for teaching me the meaning of lucky.
Chapter I: Introduction to defensive symbionts of arthropod
Symbiotic associations between microbes and multicellular organisms are
ubiquitous, and microbial symbionts often play critical roles in the ecology and evolution of their hosts. Perhaps the most profound examples of symbiosis shaping eukaryotic evolution are the ancient symbiotic relationships that have led to the evolution of
mitochondria and chloroplasts in eukaryotic cells. Nonetheless, the diversity, distribution and ecological roles of microbial symbionts remain largely unknown. This is in large part because many microbial symbionts are unable to live independently of their hosts, making them difficult to culture and study. However, recent advances in molecular biology have greatly increased our understanding and appreciation of the diversity and importance of these associations.
Arthropods harbour an extraordinary diversity of microbial symbionts that are primarily maternally transmitted (referred to as vertical transmission) (Moran et al. 2008). Traditionally, these symbionts have been classified into two categories: primary symbionts and secondary symbionts. Primary symbionts have ancient and obligate associations with their hosts. These associations are essential for the survival and reproduction of their hosts, with the symbiont often providing its host with necessary nutrients. The best studied primary symbiont may be Buchnera aphidicola, a
Gammaproteobacteria that provides aphids with essential amino acids that are lacking from the aphid‟s diet (Buchner 1965). Secondary symbionts, alternatively, are typically facultative for the host, and their associations with their hosts are evolutionarily more recent than those of primary endosymbionts (Moran et al. 2008). Secondary symbionts
are predominantly vertically transmitted over ecological time scales, although there are rare instances when secondary symbionts undergo transmission within and between species (referred to as horizontal transmission).
Facultative inherited symbionts have evolved several strategies to enhance their successful transmission to the next generation (Moran et al. 2008). Some symbionts, known as reproductive manipulators, enhance their transmission by manipulating their host‟s reproduction to increase their own fitness. Because these symbionts are
principally transmitted from mothers to offspring, they can spread through a population if infected females produce more daughters than uninfected females. For instance,
Cardinium, a bacterial symbiont found in a parasitoid wasp (Encarsia) converts genetic males into genetic females (referred to as parthenogenesis); this increases the prevalence of infected female hosts in the subsequent generation (Zchori-Fein et al. 2001). In the isopod Armadillidium vulgar, Wolbachia, a well known α Proteobacterium reproductive manipulator, increases the number of females in a population by converting genetic males into phenotypic females (referred to as feminization) (Legrand et al. 1987; Stouthamer et al. 1999).
An alternate means by which symbionts spread through populations is by
providing a benefit to infected individuals, for example, by conferring protection to their host from natural enemies, including predators, parasites, and pathogens (Haine 2008). Clearly, insults to a host will have negative impacts on both the host and its
endosymbiont. If a symbiont protects its host from an enemy, then in the presence of the enemy it will confer a selective advantage to its host relative to other individuals in the
host population that do not harbour the symbiont. Thus, a symbiont that provides protection to its host is likely to increase in frequency.
Defensive Symbionts in Arthropods
Uncovering the defensive effects of symbionts has been an important advancement in arthropod symbiosis research (Haine 2008). Unlike symbionts that manipulate reproduction or provide their host with nutrition, a defensive phenotype is difficult to test for, as it is only apparent when the host is challenged by the natural enemy. Nonetheless, an increasing number of symbionts have been shown to protect their arthropod hosts from various attacks, suggesting symbionts with a defensive phenotype may be widespread (see Table 1.1).
In freshwater and marine environments plants and animals are constantly exposed to different pathogenic microorganisms, and it has been suggested that associations with bacterial symbionts may be an essential component of host viability (Gil-Turnes et al. 1989). For example, symbionts of the shrimp Palaemon macrodactylus, and the
American lobster Homarus americanus produce antifungal compounds that protect host embryos from pathogenic fungi (Gil-Turnes et al. 1989; Gil-Turnes and Fenical 1992). Defensive symbionts are also widely distributed in terrestrial environments. For instance, the pea aphid (Acyrthosiphon pisum) remarkably harbours three different
Gammaproteobacteria defensive symbionts: Hamiltonella defensa and Serratia symbiotica provide protection from parasitoid attack, and Regiella insecticola protects aphids from fungal infection (Oliver et al. 2003; Scarborough et al. 2005).
A number of defensive symbionts fall in the class Gammaproteobacteria; however defensive symbionts have also been discovered in several other classes of bacteria. For example, Wolbachia, a widespread Alphaproteobacteria, protects Drosophila from RNA viruses (Hedges et al. 2008; Teixeira et al. 2008; Osborne et al. 2009), while strains of Spiroplasma, class Mollicutes, have been shown to offer protection to flies from parasitic wasps and nematodes (Xie et al. 2010; Jaenike et al. 2010).
Mechanisms of Defense
In general, the mechanisms by which symbionts mediate protection are largely unknown. Many possibilities are currently being investigated, including producing specific toxins or antimicrobial compounds, altering host behaviour to reduce predation, directly competing with enemies for resources, or up-regulating the host‟s immune system.
Microbes are known to have the capacity to secrete an array of toxic and antimicrobial compounds, potentially providing their host with a novel defense in response to challenges from enemies. For example, an antifungal molecule
(mycangimycin) produced by the Streptomyces symbiont of the Southern Pine beetle (Dendroctonus frontalis) actively suppresses the growth of antagonistic fungus (Scott et al. 2008). In the Paederus beetle, protection from predation is mediated by pederin toxin secreted by a Pseudomonas sp. symbiont (Kellner 2002). Interestingly, a similar
pederin-like toxin that deters predation is also secreted by a symbiont in marine sponges (Piel et al. 2004; Piel 2002). Sequence analysis has revealed that the pederin toxin encoding genes are located on a mobile island, clearly indicating that these genes have
been acquired by horizontal transfer (Piel 2002), perhaps explaining the occurrence of pederin-type metabolites in diverse organisms. In addition to toxin encoding genes, symbionts may deter predators via toxins produced by symbiont-associated
bacteriophages. For instance, the aphid defensive symbiont, H. defensa, is often infected with a bacteriophage called A. pisum secondary endo-symbiont (APSE) phage (Moran et al. 2005). This toxin-encoding phage is required in order for H. defensa to protect its host from parasitic wasps (Oliver et al. 2009). In addition, genome sequencing of H. defensa has revealed several type III secretion systems (a protein secretion system that helps bacteria invade eukaryotic organisms, TTSSs) (Moran et al. 2005). It has been hypothesized that TTSSs function in delivering toxins that target parasitoid enemies, although this remains unconfirmed.
Bacterial symbionts may also defend their hosts by modifying the behaviour of their host to avoid predation. For example, a maternally transmitted microsporidia symbiont (Dictyocoela sp) of a freshwater amphipod (Gammarus roeseli) disrupts behavioural manipulations induced by a parasitic helminth (Acanthocephala) (Tain et al. 2006). In this system, the parasitic helminth alters the activity of serotonergic neural transmission of its host, changing its swimming behaviour. This behavioural
modification increases the chance of predation by the helminth‟s definitive host (fish or birds). However, the bacterial symbiont Dictyocoela appears to somehow sabotage the behavioural changes induced by the helmith, perhaps by disrupting the helminth‟s effect on serotonergic neural circuits, decreasing their host‟s risk of predation (Haine et al. 2005).
Symbionts also provide protection to their host by augmenting or interacting with their host‟s immune system. For example, the introduction of the α Proteobacterium, Wolbachia, into Aedes aegypti mosquitoes, causes a constitutive up-regulation of immune genes (Moreira et al. 2009; Kambris et al. 2009) . The activated immune system in turn provides protection from fundamentally different enemies, including filarial nematodes, gram-negative bacteria, dengue and Chikungunya viruses, as well as a strain of avian malaria (Plasmodium gallinaceum). The protective mechanism of Wolbachia is unclear; however, it has been suggested that immune effector genes that are upregulated in the mosquito in the presence of Wolbachia likely play a role (Moreira et al. 2009).
Symbionts may also provide protection to their host by competing with enemies for host resources. For instance, it has been suggested the Wolbachia strains that induce resistance to viral infection in Drosophila utilize host amino acids necessary for the translation of viral proteins, although it is also possible that Wolbachia directly interferes with viral replication (Teixeira et al. 2008). Additionally, it has also been proposed that the defensive strain of Wolbachia in Aedes mosquitoes outcompetes other infectious agents for critical cell components such as cholesterol (Moreira et al. 2009).
Symbiosis vs. Host Immune System
Arthropods possess an innate immune system that effectively clears invading parasites and pathogens (Loker et al. 2004). Nonetheless, arthropods harbour an extraordinary diversity of microbial symbionts. Symbionts must therefore be under selection to evolve strategies to avoid their host‟s immune system, while a host may be
under selection to evolve strategies to maintain beneficial symbionts while still protecting itself from natural enemies.
One strategy for bacterial symbionts to avoid being recognized by their host‟s immune system is to hide from the host‟s immune system by locating themselves in host cells (intracellularly). For instance, Buchnera in aphids and Wolbachia in the bedbug Cimex lectularius, are housed in specialized host cells called bacteriocytes (Shigenobu et al. 2000; Goto et al. 2006; Hosokawa et al. 2010) . However, some arthropod secondary symbionts are found extracellularly, and thus must either be resistant to their host‟s immune system, or must not induce a host response (Fukatsu et al. 2000; Goto et al. 2006). To avoid immune recognition, some symbionts may change their surface receptors. Microbial cell walls consist of β1-3 glucan, lipopolysaccharide and
peptidoglycan molecules, known elicitors of an arthropod‟s immune system (Loker et al. 2004). Some symbionts, such as Spiroplasma, may avoid being recognized by their host‟s immune system by completely lacking a cell wall. Perhaps the lack of a cell wall explains how Spiroplasma has successfully colonized a diversity of arthropods, and why it appears to escape notice by its host‟s immune system despite living freely within the haemolymph (Hurst et al. 2003). Other symbionts may suppress their host‟s immune system (e.g. Anbutsu and Fukatsu 2010). However, downregulating a host`s immune system may inadvertently increase its susceptibility to invaders.
Bacterial symbionts may also establish themselves in a host by altering their host‟s immune system, perhaps even selecting for a less sophisticated immune system. For example, it has been suggested that aphids have a reduced humoral immune system to account for the plethora of vertically transmitted symbionts they harbour (Gerardo et
al. 2010). It is, however, unclear if heritable symbionts are the cause or consequence of the reduced immune system of aphids.
Symbiont vs. Host Defense
Although the goal of symbiont-encoded defense and host-encoded defense are both to protect their host, the dynamics of the two forms of resistance are expected to differ (Hurst and Darby 2009). Both nuclear and symbiont-encoded defense ultimately rely on the selection pressure of natural enemies. However, the prevalence of symbiont-mediated defense is more likely to decrease in the absence of selection. This is in part because symbionts are not transmitted from mother to offspring with 100% efficiency, and thus without natural enemies selecting for their presence they are likely to be lost. Furthermore, symbionts continuously utilize host resources whether the natural enemy is present or not. Therefore, if the threat of the natural enemy is removed, defensive symbionts may be too costly for a host to maintain. For example, when aphids with and without defensive symbionts (H. defensa and S. symbiotica) were introduced into a population cage without natural enemies, both defensive symbionts rapidly decreased in frequency (Oliver et al. 2008). On the other hand, in the absence of enemies a host can avoid some of the cost associated with nuclear-encoded genes by not expressing them. Therefore, nuclear-encoded genes are not expected to decrease as rapidly as defensive symbionts in the absence of selection.
It is clear that many natural enemies are involved in evolutionary arms races with their hosts, where evolution of resistance by a host is often answered by a counter-adaption by the enemy (Hurst and Darby 2009). Natural enemies are expected to evolve
strategies to overcome symbiont mediated resistance, although this remains to be tested. However, because symbiont-encoded defense is expected to be more readily lost from a population than host-encoded defense, there may be less co-evolution in these systems (Hurst and Darby 2009). It should also be noted that if a host can acquire microbial symbionts as a novel method of defense from enemies, it is also likely that enemies can also acquire symbionts to overcome symbiont-based defense. For example, some parasitic wasps use symbiotic viruses called polydnaviruses that aid in overcoming host immunity (Kroemer and Webb 2004). Additionally, some entomopathogenic nematodes (Heterorhabditidae and Steinernematidae) harbour bacterial symbionts (Xenorhabdus and Photorhabdus) that produce toxins that rapidly kill their insect prey (Bowen et al. 1998; Forst and Nealson 1996). Future research needs to be conducted to determine the role of offensive symbionts in host-parasite interactions and to understand the trajectory of coevolution between natural enemies and symbiont-mediated defense.
Fertility Restoring Symbiont of Drosophila
My research examines the ecology of a newly discovered Spiroplasma defensive symbiont that protects its fly host from the negative effects of a virulent parasitic
nematode. The infection appears to have greatly increased in less than 20 years and to be currently spreading westwards across North America, although it has not been reported in British Columbia. This is the first reported defensive strain of Spiroplasma, and the dynamic association provides a unique opportunity to explore the spread and dynamics of Spiroplasma as a defensive symbiont.
The players: host, parasite, symbiont
Mushrooms serve as sites for feeding and mating for many species of Drosophila (Perlman and Jaenike 2003). These flies are frequently infected with parasitic
nematodes, including Howardula aoronymphium (Tylenchida: Allantonematidae), that have major effects on the fitness of the hosts (Jaenike and Perlman 2002). Inside mushrooms, mated female Howardula pierce the fly larval cuticle and grow within the haemocoel of the fly. Once the fly has reached the adult stage, nematodes grow into a characteristic motherworm stage, producing juvenile nematodes that are shed from the gut and ovipositor of the fly onto fresh mushrooms. The nematodes mate inside the mushroom, renewing the cycle of infection.
In N. America, D. neotestacea is the species that is most frequently and severely affected by H. aoronymphium(Jaenike and Perlman 2002). Parasitism reduces adult survival and male mating success, and until recently, almost all female flies were rendered almost completely sterile. Field collections in eastern N. America have shown that nematode infection frequencies in D. neotestacea are consistently high (23% long-term average) (Jaenike and Perlman 2002). High infection rates, coupled with the dramatic reduction in fertility, are expected to significantly affect host population dynamics and place a strong selective pressure on flies to evolve defence against parasitism.
We have recently discovered that some nematode-parasitized female D.
neotestacea have partially restored fertility (Jaenike et al. 2010). Resistance, however, is not associated with host-encoded genes, but with a maternally-transmitted symbiont, Spiroplasma. Drosophila neotestacea harbours both Wolbachia and Spiroplasma and by
experimentally testing fertility in flies with differing infection status, we established that Spiroplasma and not Wolbachia restore D. neotestacea fertility, with parasitized flies having 10x greater fertility when they were also infected with Spiroplasma. The mechanism of defense is not clear, but worms are significantly smaller in flies that harbour Spiroplasma. The effect of Wolbachia in this system remains unknown, but it does not protect flies from nematodes.
Spiroplasma are gram-positive, wall-less, helical bacteria associated with a diverse host range (Regassa and Gasparich 2006). Some strains of Spiroplasma cause economically important plant diseases, such as Corn Stunt Disease and Citric Stubborn Disease, while others are endosymbionts of arthropods, including ladybird beetles, butterflies, mosquitoes, ticks and spiders. Within insects, some strains of Spiroplasma are reproductive manipulators, with a male-killing phenotype, in which male offspring are killed, resulting in all female broods (Hurst and Jiggins 2000). Other strains of Spiroplasma have no obvious fitness effects, indicating the male-killing phenotype is not the sole explanation for the widespread distribution of Spiroplasma in insects (Watts et al. 2009).
In Drosophila, besides Wolbachia, Spiroplasma is the only known heritable symbiont (Mateos et al. 2006). While Wolbachia has been extensively studied, the effects and dynamics of Spiroplasma infections in Drosophila are much less clear. Screening has revealed at least sixteen Drosophila species that are infected with
Spiroplasma, and phylogenetic analyses suggest that at least five separate introductions of four distinct clades of Spiroplasma have occurred in Drosophila (Haselkorn et al. 2009). This suggests that, although Spiroplasma is primarly vertically transmitted,
horizontal transmission over evolutionary timescales is in part responsible for its distribution in natural populations.
The Spiroplasma defensive symbiont in D. neotestacea was first identified in eastern N. America, and has now been shown to infect between 50-80% of D.
neotestacea in eastern N. America (Jaenike et al. 2010). The prevalence of Spiroplasma however, appears to decrease in an east to west cline across the continent, and the symbiont has yet to be reported in BC. This and several other lines of evidence indicate Spiroplasma is currently spreading across North America, suggesting that a rapid and profound symbiont-based change is currently underway.
Current Study
This thesis has two main objectives i) To explore various explanations for why D. neotestacea that harbour Spiroplasma have not been reported in BC, including
monitoring for its potential spread into BC. Over a two year period, I collected adult flies from various locations in BC. I screened flies for Spiroplasma and dissected them to determine the prevalence of nematodes in BC. The mitochondrial haplotypes of field collected flies were determined and compared to flies east of the Rocky Mountains to assess the abililty of D. neotestacea to cross the mountains and serve as vectors for the spread of Spiroplasma to the west. Finally, I examined if Spiroplasma is advantageous to BC flies by determining if the defensive symbiont will restore fertility to flies with a BC genetic background. ii) To begin to explore the generality of Spiroplasma-mediated defense, I tested the ability of Spiroplasma to protect D. neotestacea flies from a gram-negative bacterial pathogen. The survival of Spiroplasma infected and uninfected flies
was monitored and compared following challenge with a pathogenic bacterium Pectobacterium carotovorum subs. carotovorum.
Broader Impact
Symbionts are increasingly being recognized as major players in natural communities, with the discovery of defensive symbionts being a major recent
development in symbiont research. These symbionts likely have profound and dynamic effects in ecological communities, and potentially provide a mechanism explaining the ubiquity of symbionts in nature. For example, a healthy human gut remarkably contains trillions of microorganisms (Gill et al. 2006). We are only beginning to understand the diverse roles of the gut microbiome, including regulating metabolism and defending against pathogens.
Furthermore, classical biological control programs have focused on the use of natural enemies to control agricultural and forest insect pests, as well as vectors for diseases of both plants and animals. Symbionts can clearly affect the success of biological control programs, making it increasingly important to understand the
ecological role of defensive symbionts. Spiroplasma is the first natural symbiont-based defense against nematodes, suggesting a novel method for nematode control (Jaenike et al. 2010). This is of particular importance as nematodes are extremely abundant and destructive parasites of plants and animals, as well as the causal agents of various human diseases, including filariasis and river blindness (Allen et al. 2008). Because of
Spiroplasma‟s negative effects on nematodes, and because it provides infected flies with a fitness benefit, Spiroplasma is predicted to spread rapidly through novel
nematode-parasitized fly populations, making it an ideal candidate for the biological control of insect-vectored nematode diseases. Additionally, Spiroplasma infections have also been reported in many plants that are infected with tylenchid nematodes (the same group that includes Howardula) (Regassa and Gasparich 2006). Perhaps this strain of Spiroplasma may also provide resistance to host plants from these nematodes. Interestingly,
Spiroplasma has recently been reported to provide D. hydei protection from a parasitic wasp (Leptopilina heterotoma) (Xie et al. 2010), suggesting that the defensive phenotype may be a general feature of Spiroplasma.
Literature Cited
Allen JE, Adjei O, Bain O, Hoerauf A, Hoffmann WH, Makepeace BL, Schulz-Key H, Tanya VN, Trees AJ, Wanji S, Taylor DW (2008) Of mice, cattle, and humans: the immunology and treatment of river blindness. PLoS Negl. Trop. Dis. 2:e217.
Anbutsu H, Fukatsu T (2010) Evasion, suppression and tolerance of Drosophila innate immunity by a male-killing Spiroplasma endosymbiont. Insect Mol. Biol. 19:481-488.
Bowen D, Rocheleau TA, Blackburn M, Andreev O, Golubeva E, Bhartia R, Ffrench-Constant RH (1998) Insecticidal toxins from the bacterium Photorhabdus luminescens. Science 280:2129-32.
Buchner P (1965) Endosymbiosis of animals with plant microorganisms. Interscience Publishers, John Wiley, New York.
Currie CR, Scott JA (1999) Fungus-growing ants use antibiotic-producing bacteria to control garden parasites. Nature 398:701-705.
Forst S, Nealson K (1996) Molecular biology of the symbiotic-pathogenic bacteria Xenorhabdus spp. and Photorhabdus spp. Microbiol Rev. 60:21-43.
Fukatsu T, Nikoh N, Kawai R, Koga R (2000) The secondary endosymbiotic bacterium of the pea aphid Acyrthosiphon pisum (Insecta: homoptera). Appl. Environ. Microbiol. 66:2748-58.
Gerardo NM, Altincicek B, Anselme C, Atamian H, Barribeau SM, de Vos M, Duncan EJ, Evans JD, Gabaldón T, Ghanim M, Heddi A, Kaloshian I, Latorre A, Moya A, Nakabachi A, Parker BJ, Pérez-Brocal V, Pignatelli M, Rahbé Y, Ramsey JS, Spragg CJ, Tamames J, Tamarit D, Tamborindeguy C, Vincent-Monegat C, Vilcinskas A (2010) Immunity and other defenses in pea aphids, Acyrthosiphon pisum. Genome Biol. 11:R21. Gil-Turnes MS, Fenical W (1992) Embryos of Homarus americanus are protected by epibiotic bacteria. Biol. Bull. 182:105-108.
Gil-Turnes MS, Hay ME, Fenical W (1989) Symbiotic marine bacteria chemically defend crustacean embryos from a pathogenic fungus. Science 246:116-8.
Gill SR, Pop M, Deboy RT, Eckburg PB, Turnbaugh PJ, Samuel BS, Gordon JI, Relman DA, Fraser-Liggett CM, Nelson KE (2006) Metagenomic analysis of the human distal gut microbiome. Science 312:1355-9.
Goto S, Anbutsu H, Fukatsu T (2006) Asymmetrical interactions between Wolbachia and Spiroplasma endosymbionts coexisting in the same insect host. Appl. Environ. Microbiol. 72:4805-10.
Haine ER, Boucansaud K, Rigaud T (2005) Conflict between parasites with different transmission strategies infecting an amphipod host. Proc. R. Soc. B 272:2505-10.
Haine ER (2008) Symbiont-mediated protection. Proc. R. Soc. B 275:353-61. Haselkorn TS, Markow TA, Moran NA (2009) Multiple introductions of the Spiroplasma bacterial endosymbiont into Drosophila. Mol. Ecol. 18:1294-305.
Hedges LM, Brownlie JC, O'Neill SL, Johnson KN (2008) Wolbachia and virus protection in insects. Science 322:702.
Hosokawa T, Koga R, Kikuchi Y, Meng X, Fukatsu T (2010) Wolbachia as a bacteriocyte-associated nutritional mutualist. PNAS 107:769-74.
Hurst G, Darby A (2009) The inherited microbiota of arthropods, and their importance in understanding resistance and immunity. In: Insect Infection and Immunity (R Jens and SE Reynolds). Oxford University Press Inc., New York.
Hurst GD, Jiggins FM (2000) Male-killing bacteria in insects: mechanisms, incidence, and implications. Emerg. Infect. Dis. 6:329-36.
Hurst GD, Anbutsu H, Kutsukake M, Fukatsu T (2003) Hidden from the host: Spiroplasma bacteria infecting Drosophila do not cause an immune response, but are suppressed by ectopic immune activation. Insect Mol. Biol. 12:93-7.
Jaenike J, Perlman SJ (2002) Ecology and evolution of host-parasite associations: mycophagous Drosophila and their parasitic nematodes. Am. Nat. 160:S23-S39.
Jaenike J, Unckless R, Cockburn SN, Boelio LM, Perlman SJ (2010) Adaptation via symbiosis: recent spread of a Drosophila defensive symbiont. Science 329:212-215.
Kaltenpoth M, Go W, Herzner G, Strohm E (2005) Symbiotic bacteria protect wasp larvae from fungal infestation. Curr Biol. 15:475-479.
Kambris Z, Cook PE, Phuc HK, Sinkins SP (2009) Immune activation by life-shortening Wolbachia and reduced filarial competence in mosquitoes. Science 326:134-6.
Kellner RL, Dettner K (1996) Differential efficacy of toxic pederin in deterring potential arthropod predators of Paederus (Coleoptera: Staphylinidae) offspring. Oecologia 107:293-300.
Kellner RL (2002) Molecular identification of an endosymbiotic bacterium associated with pederin biosynthesis in Paederus sabaeus (Coleoptera: Staphylinidae). Insect Biochem. Mol. Biol. 32:389-95.
Kroemer JA, Webb BA (2004) Polydnavirus genes and genomes: emerging gene families and new insights into polydnavirus replication. Annu. Rev. Entomol. 49:431-56.
Legrand JJ, Legrand-Hamelin E, Juchault P (1987) Sex determination in Crustacea. Biol. Rev. 62:439-470.
Loker ES, Adema CM, Zhang S, Kepler TB (2004) Invertebrate immune systems - not homogeneous, not simple, not well understood. Immunol. Rev. 198:10-24.
Mateos M, Castrezana SJ, Nankivell BJ, Estes AM, Markow TA, Moran NA (2006) Heritable endosymbionts of Drosophila. Genetics 174:363-76.
Moran NA, Degnan PH, Santos SR, Dunbar HE, Ochman H (2005) The players in a mutualistic symbiosis: insects, bacteria, viruses, and virulence genes. PNAS 102:16919-26.
Moran NA, McCutcheon JP, Nakabachi A (2008) Genomics and evolution of heritable bacterial symbionts. Annu. Rev. Genet. 42:165-90.
Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, Rocha BC, Hall-Mendelin S, Day A, Riegler M, Hugo LE, Johnson KN, Kay BH, McGraw EA, van Den Hurk AF, Ryan PA, O'Neill SL (2009) A Wolbachia symbiont in Aedes aegypti limits infection with dengue, Chikungunya, and Plasmodium. Cell 139:1268-78.
Oliver KM, Campos J, Moran NA, Hunter MS (2008) Population dynamics of defensive symbionts in aphids. Proc. R. Soc. B 275:293-9.
Oliver KM, Degnan PH, Hunter MS, Moran NA (2009) Bacteriophages encode factors required for protection in a symbiotic mutualism. Science 325:992-4.
Oliver KM, Russell JA, Moran NA, Hunter MS (2003) Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. PNAS 100:1803-7.
Osborne SE, Leong YS, O'Neill SL, Johnson KN (2009) Variation in antiviral protection mediated by different Wolbachia strains in Drosophila simulans. PLoS Pathog. 5:e1000656.
Perlman SJ, Jaenike J (2003) Infection success in novel hosts: an experimental and phylogenetic study of Drosophila-parasitic nematodes. Evolution 57:544-57.
Piel J, Hofer I, Hui D (2004) Evidence for a symbiosis island involved in horizontal acquisition of pederin biosynthetic capabilities by the bacterial symbiont of Paederus fuscipes beetles. J. Bacteriol. 186:1280-1286.
Piel J (2002) A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles. PNAS 99:14002-7.
Regassa L, Gasparich G (2006) Spiroplasmas: evolutionary relationships and biodiversity. Front. Biosci. 11:2983-3002.
Scarborough CL, Ferrari J, Godfray HC (2005) Aphid protected from pathogen by endosymbiont. Science 310:1781.
Scott JJ, Oh D, Yuceer MC, Klepzig KD, Clardy J, Currie CR (2008) Bacterial protection of beetle-fungus mutualism. Science 322:63.
Shigenobu S, Watanabe H, Hattori M, Sakaki Y, Ishikawa H (2000) Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS. Nature 407:81-6.
Stouthamer R, Breeuwer JA, Hurst GD (1999) Wolbachia pipientis: microbial manipulator of arthropod reproduction. Annu. Rev. Microbiol. 53:71-102.
Tain L, Perrot-Minnot M, Cézilly F (2006) Altered host behaviour and brain serotonergic activity caused by acanthocephalans: evidence for specificity. Proc. R. Soc. B 273:3039-45.
Teixeira L, Ferreira A, Ashburner M (2008) The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol. 6:e2.
Watts T, Haselkorn TS, Moran NA, Markow TA (2009) Variable incidence of Spiroplasma infections in natural populations of Drosophila species. PloS One 4:e5703.
Xie J, Vilchez I, Mateos M (2010) Spiroplasma bacteria enhance survival of Drosophila hydei attacked by the parasitic wasp Leptopilina heterotoma. PloS One 5:e12149.
Zchori-Fein E, Gottlieb Y, Kelly SE, Brown JK, Wilson JM, Karr TL, Hunter MS (2001) A newly discovered bacterium associated with parthenogenesis and a change in host selection behavior in parasitoid wasps. PNAS 98:12555-60.
Table 1.1: Summary of known arthropod defensive symbionts
Symbiont Class Host Natural Enemy Protective
mechanism References Hamiltonella defensa Gammaproteobacteria Acyrthosiphon pisum(aphid)
Parasitic wasp toxin produced by bacteriophage (Oliver et al. 2003; Oliver et al. 2009) Serratia symbiotica Gammaproteobacteria Acyrthosiphon pisum(aphid)
Parasitic wasp ? (Oliver et al. 2003)
Regiella insecticola
Gammaproteobacteria Acyrthosiphon pisum(aphid)
Fungus ? (Scarborough et al.
2005) Alteromonas sp. Gammaproteobacteria Palaemon
macrodactylus (shrimp)
Fungus isatin (antifungal compound) (Gil-Turnes et al. 1989) Dictyocoela sp. Microsporidia (phylum) Gammarus roeseli (amphipod) Parasitic helminth ? (Haine et al. 2005)
Pseudomonas sp. Gammaproteobacteria Paederus spp. (beetle)
Predatory spider Pederin (toxin) (Kellner & Dettner 1996; Piel 2002) Wolbachia spp. Alphaproteobacteria Drosophila spp.
(fly)
RNA viruses ? (Hedges et al. 2008;
Teixeira et al. 2008; Osborne et al. 2009) Spiroplasma sp. Mollicutes Drosophila
hydei(fly)
Parasitic wasp ? (Xie et al. 2010)
Spiroplasma sp. Mollicutes Drosophila neotestacea(fly)
Parasitic nematode
? (Jaenike et al. 2010) Streptomyces sp. Actinobacteria Dendroctonus
frontalis(beetle)
Fungus mycangimycin
(antifungal compound)
(Scott et al. 2008)
Streptomyces sp. Actinobacteria Philanthus triangulum(wasp)
Fungus Antifungal
compounds?
(Kaltenpoth et al. 2005)
Chapter II: Distribution and dynamics of a Drosophila defensive
symbiont
Insects harbour an extraordinary diversity of maternally transmitted bacterial symbionts, and many of these symbionts play important roles in the ecology and evolution of their hosts (Moran et al. 2008). Under strict maternal transmission the fitness of an inherited symbiont is intimately linked to the survival and reproduction of its host. Inherited symbionts may therefore increase their own fitness by manipulating their host‟s reproduction to increase their own frequency (termed „reproductive manipulation‟) (Dale and Moran 2006). For example, Cardinium, a symbiont found in a parasitoid wasp (Encarsia) converts genetic males into genetic females (referred to as parthenogenesis), increasing the prevalence of infected female hosts in the subsequent generation (Zchori-Fein et al. 2001). Alternatively, symbionts may spread through insect populations by conditional mutualism, e.g. conferring protection to their hosts from various natural enemies (Haine 2008). For example, Wolbachia, a symbiont found in 66% of all insect species (Hilgenboecker et al. 2008), has recently been found to protect Drosophila from RNA viruses (Hedges et al. 2008; Osborne et al. 2009). The defensive phenotype of Wolbachia may be a widespread phenomenon, possibly explaining its ubiquity in insects.
Defensive symbionts have been documented to protect insects from many natural enemies, including parasites, predators, and pathogens. However, unlike reproductive manipulators, the defensive phenotype is difficult to test for, as the phenotype is only realized in the presence of the natural enemy. Still, there are many examples that
strongly suggest that defensive symbionts may be a widespread phenomena in insects. The pea aphid (Acyrthosiphon pisum), for instance, harbours three defensive symbionts: Hamiltonella defensa and Serratia symbiotica provide protection from parasitoid attack (Oliver et al. 2005), and Regiella insecticola protects against fungal infection
(Scarborough et al. 2005).
Here, I investigate a newly discovered defensive symbiont of Drosophila neotestacea that appears to be spreading across North America. D. neotestacea is a fungus feeding fly found across the northern United States and Canada that is frequently infected with the parasitic nematode Howardula aoronymphium (Jaenike and Perlman 2002). This virulent nematode has a direct life cycle (i.e. no intermediate hosts) and infects various Drosophila species. Mated female nematodes, referred to as
motherworms, infect Drosophila larvae and grow within the haemocoel of the fly. Juvenile nematodes are then shed from the gut and ovipositor of adult flies onto mushrooms, where they mate and renew the cycle of infection. In D. neotestacea, the species most commonly parasitized by H. aoronymphium, adult survival and male mating success are reduced by parasitism, and until recently, virtually all female flies were rendered almost completely sterile by parasitism. Field collections showed that over a 14 year period, ~23% of D. neotestacea in eastern N. America were infected with H.
aoronymphium (Jaenike and Perlman 2002). These high infection rates, coupled with the dramatic effect these nematodes have on their hosts suggests there is a strong selective force on flies to develop resistance to H. aoronymphium.
Recently, female flies have been found to have partially restored fertility when infected with nematodes. Resistance was not found to be mediated by the host fly, but by
a Spiroplasma bacterial symbiont (Jaenike et al. 2010b). Spiroplasma belongs to the class Mollicutes, an ancient bacterium that lacks a cell wall and is found in a variety of hosts from plants to arthropods (Regassa and Gasparich 2006). Both field and laboratory studies have confirmed that Spiroplasma confers tolerance to nematode infections in female flies, with females infected with Spiroplasma having more than 10x greater fertility than those not infected with the symbiont (Jaenike et al. 2010b). It is not clear how fertility is restored, but Spiroplasma appears to somehow reduce the growth of motherworms.
There is a dramatic continental-wide cline in the prevalence of Spiroplasma-infected D. neotestacea in N. America (Jaenike et al. 2010b). Field collections show that Spiroplasma infects between 50-80% of D. neotestacea in eastern N. America, which based on both its fertility restoring properties and maternal transmission efficiency, appears to be near Spiroplasma‟s equilibrium prevalence. Spiroplasma infection, however, decreases in an east to west cline across the continent, and has not yet been reported in British Columbia.
There are various explanations as to why Spiroplasma appears absent from BC D. neotestacea populations. As symbionts exploit their hosts for resources, they are
inherently costly, and therefore, heritable symbionts must either provide their host with a benefit, or manipulate the reproduction of their host to ensure transmission to the next generation (Dale and Moran 2006). Spiroplasma is known to confer a benefit to flies infected with nematodes in eastern N. America. However, Spiroplasma may not provide the same benefit to flies in BC. If nematode prevalence is low in BC, or if Spiroplasma
does not restore fertility to parasitized D. neotestacea lineages found in BC, Spiroplasma may have been lost, or at low frequency in BC fly populations.
Alternatively, Spiroplasma may be absent because it and has not yet reached BC. There are several lines of evidence that strongly suggest that the Spiroplasma infection is dynamic and spreading across N. America (Jaenike et al. 2010b), including: D.
neotestacea collected in the 1980‟s were not infected with Spiroplasma and were virtually all sterile when parasitized by Howardula; the Spiroplasma infection status of flies carrying different mitochondrial haplotypes of D. neotestacea in N. America suggests Spiroplasma is not at species-level equilibrium; and the prevalence of Wolbachia in D. neotestacea appears to have much less geographic variation than Spiroplasma suggesting it is close to equilibrium across N. America. Howardula aoronymphium is thought to have only recently colonized N. America (Perlman et al. 2003). Consequently, the selective advantage of Spiroplasma on flies may be recent.
This study examines the ecology of the associations between D. neotestacea, H. aoronymphium and Spiroplasma in BC. Over a two year period, D. neotestacea were collected from various locations within BC. Wild flies were screened for Spiroplasma in order to monitor for the potential spread. Field collected D. neotestacea were also
dissected to determine the prevalence of nematodes in BC. The mitochondrial haplotypes of field collected flies were determined and compared to flies east of the Rocky
Mountains to assess the abililty of D. neotestacea to cross the Rocky Mountains and serve as vectors for the putative spread of Spiroplasma to the west. Finally, to determine if Spiroplasma protects western D. neotestacea from the sterilizing effects of H.
parasitized flies was compared in Spiroplasma infected (S+) and Spiroplasma-free (S-) flies.
Material and Methods
Field Collections
Adult D. neotestacea were collected in 2008 and 2009 from various locations across southern BC (See Table 2.1). Flies were aspirated from bait traps made of
Agaricus bisporus mushrooms soaked in water. Collected flies were stored at -20 C and later dissected and scored for nematode parasitism and screened for Spiroplasma.
DNA Extractions
DNA was extracted using the PrepMan Ultra DNA extraction method (Applied Biosystems). Briefly, flies were place in a 1.5 ml cryogenic tube with 50μl of Prepman Ultra solution and several .5 mm zironium/silica beads. The solution was then
homogenized in a Biospec MiniBeadbeater 8 and heated at 100 C for 10 mins. DNA was removed from the cryogenic tube and stored at -20°C.
Diagnostic PCR
All flies were screened for Spiroplasma using diagnostic PCR. Spiroplasma specific primers, p58-f (5‟-GTT GGT TGA ATA ATA TCT GTT G-3‟) and p58-r (5-GAT GGT GCT AAA TTA TAT TGA C-3‟) were used to amply a 1000bp region of the putative adhesin p58 gene (Montenegro et al. 2005). PCR conditions for p58 consisted of an initial denaturation cycle of 3 min at 95°C, followed by 34 cycles of 1 min at 94°C, 1
min at 54 °C and 1.5 min at 72°C, followed by a final extension for 10 min at 72°C. All samples were run with a positive control for Spiroplasma (a laboratory reared S+ D. neotestacea from Connecticut) and a negative no-DNA control. Samples that appeared to be negative were screened three times.
Samples negative for Spiroplasma were screened for a D. neotestacea nuclear gene (triose phosphate isomerase) as a positive control for DNA extraction. A 381-bp coding region of tpi was amplified with tpiF- (5‟-CAA CTG GAA GAT GAA YGG IGA CC-3) and tpiR (5‟-TTC TTG GCA TAG GCG CAC ATY TG-3‟) (Shoemaker et al. 2004). PCR protocol was the same as the protocol for the p58 primers (see above). Samples that could not be amplified with the tpi primer set after three screens were excluded from the data set.
Sequencing Spiroplasma
Spiroplasma in BC flies was compared to the fertility restoring Spiroplasma strain using PCR and sequencing. S+ DNA samples were PCR amplified using p58 primers (see above) as well as the following Spiroplasma specific primers: a 500 bp coding region for the guanosine-3',5'-bis(diphosphate)3'-pyrophosphohydrolase spoT gene amplified with spoTF CAAACAAAAGGACAAATTGAAG-3‟) and spoTR (5‟-CACTGAAGCGTTTAAATGAC-3‟) (Montenegro et al. 2005), and a 1000bp coding region for the parE gene (DNA topoisomerase IV subunit B) was amplified with parEF2 GGAAAATTTGGTGGTGATGG-3‟) and parER2
(5‟-GGCATTAATCATTACATTAATTTCT-3‟) (Watts et al. 2009). PCR conditions for spoT and parE were an initial denaturation cycle of 2 min at 94°C, followed by 10 cycles
of .5 min at 94°C, .5min at 58°C (decreasing the temperature by 1 degree every cycle until 48°C was reached) and .75 min at 65°C, followed by 30 cycles of .5 min at 94°C, .5 min at 48°C and .75 min at 65°C followed by a final extension for 7 min at 65°C.
PCR products from p58, spoT, and parE were sequenced in both directions by Macrogen USA. Sequences were visualized and compared using Geneious (Biomatters). All sequences were compared to a control sample (a laboratory reared S+ D. neotestacea from Connecticut) in addition to sequences previously deposited in GenBank (August 2010).
Phylogenetic Analysis
Phylogenetic analysis was conducted on the parE gene (the only Spiroplasma gene sequenced that differed from the control strain). Additional Spiroplasma parE sequences were downloaded from GenBank (August 2010), including the highest blast hits and other related Spiroplasma species (Haselkorn et al. 2009). All parE sequences were aligned using MacClade 4.0.1 (Maddison and Maddison 2005) and output as a Newick file. The best fit model was found using jModelTest 0.1.1 (Posada 2008). Maximum likelihood phylogenies were constructed with PAUP*4.0b6 (Swofford 2003) using optimum parameters specified by jModelTest. 100 bootstrap replicates were used to determine node support.
Mitochondrial Haplotype
A portion of the mitochondrial gene COI (cytochrome oxidase subunit I gene) was sequenced in all BC S+ flies (to confirm that they carry one of the three mtDNA
haplotypes infected with Spiroplasma), and a sample of BC S- flies (to determine what mtDNA haplotypes are in BC) (Victoria n=67, Vernon n=9, Fernie n=23). The COI barcoding primers, LCO 1490 (5‟- GGTCAACAAATCATAAAGATATTGG -3‟) and HCO 2198 (5‟-TAAACTTCAGGGTGACCAAAAAATCA-3‟) (Folmer et al. 1994) were used following the same PCR protocol for the p58 primers (see above). All samples were sequenced by Macrogen USA as previously outlined. Sequences were compared to D. neotestacea sequences deposited in GenBank (August 2010) and to the geographical distribution of D. neotestacea COI mtDNA haplotypes previously reported (Jaenike et al. 2010b).
Laboratory Cultures
All fly stocks (see Table 2.2) were reared at the University of Victoria.
Drosophila species were maintained at 22°C on Instant Drosophila Medium (Carolina Biological Supply) with a cotton dental roll and a small section of mushroom (Agaricus bisporus). The H. aoronymphium culture was obtained in 2006 from infected D. falleni and D. neotestacea adults in W. Hartford, Connecticut. Laboratory cultures of H. aoronymphium were maintained on D. falleni and D. putrida.
Symbiont Curing and Introgressions
In addition to infection by Spiroplasma, D. neotestacea harbour the bacterial symboint Wolbachia (Jaenike et al. 2010a). The effects of Wolbachia on D. neotestacea are not known but the bacterium does not defend against nematodes and may have the potential to confound the effects of Spiroplasma in this study (Jaenike et al. 2010a). To
ensure that D. neotestacea originally collected from BC were not infected with
Wolbachia, flies were cured of Wolbachia by housing them in a vial with a mushroom soaked in .25 mg/ml rifampicin for two successive generations. Cured flies were screened for Wolbachia using the Wolbachia specific primers Wsp81F
GGGTCCAATAAGTGATGAAGAAAC-3') and Wsp691R
(5'-TTAAAACGCTACTCCAGCTTCTGC-3') (Zhou et al. 1998) to amplify a 600bp region of the Wolbachia surface protein (wsp) gene. PCR protocol was the same as the protocol for the p58 primers (see above).
Once lines were cured for Wolbachia, S+ BC lines were created by introgressing Spiroplasma into cured BC D. neotestacea lines. In 2010, S+ female D. neotestacea from Connecticut were crossed with cured S- males D. neotestacea from Victoria, BC. When adult offspring emerged, virgin females were placed in a fresh vial with cured S- males D. neotestacea from BC. Introgressions were conducted for six generations. This is expected to result in ~98% genome replacement (Zabalou et al. 2008), ensuring S+ BC flies have a similar genetic background to D. neotestacea found in BC. Flies were screened each generation to confirm successful transmission of Spiroplasma using DNA extraction methods and PCR methodology previously outlined.
Symbiont Effect on Fly Fertility and Nematode Size in a BC Genetic Background
Nematode infections were obtained following the methods described in Perlman and Jaenike (2003). One to two week old H. aoronymphium infected D. putrida were ground with a mortar and pestle in a saline solution. Approximately 200 nematodes from the saline solution were placed on a small piece of mushroom (Agaricus bisporus) in a
vial with moistened cheesecloth. To collect eggs, S+ or S- D. neotestacea from BC were placed in petri dishes with a food plug made of mushroom, agar, sugar and water. The following day, twenty D. neotestacea eggs were collected and transferred to the mushroom and nematode slurry. Upon emergence, flies were transferred into a vial containing Instant Drosophila medium (Caroline Biological Supply) and a fresh mushroom for seven days and then placed at -20°C.
Female fecundity (number of mature eggs stage 10 or later), and the number and size of motherworms (as a proxy for nematode fitness) were measured in S+ and S- flies with or without nematode infections (H+ and H- respectively). Nematode size (surface area) was determined by dissecting flies under an Olympus SZX16 microscope, using ImagePro Express 6, and taking an average of three separate measurements.
Statistical Analysis
As fecundity data were not normally distributed (many parasitized females had no offspring), data were analyzed using a randomization test of an Analysis of Variance (ANOVA) (Manly 1998). Observed F-ratios were compared to a distribution of F-ratios obtained from 10 000 reshuffled datasets among the four groups of flies (S+H-, S-H-, S+H+, S-H+) to obtain p-values for treatment effects. Motherworm size (the mean motherworm size within each individual fly was used to avoid pseudoreplication) was analyzed using ANOVA. Size of H. aoronymphium was analyzed as a function of infection status, host fly sex and number of motherworms per fly. Analyses were done using Jmp 7 (JMP®, Version 7. SAS Institute Inc., Cary, NC, 1989-2007)and R version 2.11.1 (R Development Core Team 2010).
Results
Nematode infection
Wild flies from various locations in BC(n=858) were scored for H.
aoronymphium (see Table 2.3). Nematode infection ranged from 7% to 36% with an average prevalence 21% and 26% in 2008 and 2009 respectively.
Spiroplasma infection
All wild collected flies (n=785) were screened for Spiroplasma using p58
primers. In 2009, four D. neotestacea from Fernie (two males and two females) and four D. neotestacea from Vernon (one male and three females) were positive for Spiroplasma (see Table 2.4). No S+ flies from either location were infected with H. aoronymphium and no flies collected from Nelson, Salmo and Victoria were infected with Spiroplasma (see Table 2.4).
S+ flies were additionally screened and sequenced using the spoT and parE genes. Sequences were compared to S+ D. neotestacea from Connecticut and sequences from the fertility restoring Spiroplasma strain deposited in the GenBank (August 2010). All wild collected S+ flies had the same p58 and spoT sequences as S+ D. neotestacea from Connecticut, as well as the fertility restoring Spiroplasma sequence deposited in the GenBank (accession nos GU552303.1 and GU552304.1 respectively). Two flies from Vernon had the same parE sequences as the fertility restoring Spiroplasma (GenBank accession no GU059270.1). However, five flies (one Vernon and four Fernie flies) had
one or two nucleotide differences, and one DNA sample from Vernon did not amplify using the parE primer set. A maximum likelihood phylogenetic tree based on wild collected S+ sequences indicated that all parE sequences were most closely aligned with the defensive Spiroplasma strain (92% bootstrap support), shown in Figure 2.1.
Mitochondrial haplotype
The majority of BC D. neotestacea (n=65/99) were found to have „western‟ mtDNA haplotypes (mtDNA haplotype only reported in western N. America) (mtDNA isolate number 16, 17, 22 and 23, GenBank accession nos HM126650.1, HM126648.1, HM126651.1, and HM126653.1, respectively). Spiroplasma has never been reported in any of these haplotypes (Jaenike et al. 2010b).
The remaining flies consisted of three haplotypes that are found across N. America (mtDNA haplotype isolate number 1, 5 and 8, GenBank accession nos
HM126659.1, HM126667.1, HM126663.1 respectively) (Jaenike et al. 2010b). All three of these mtDNA haplotypes have been previously reported to be infected with
Spiroplasma (Table 2.5). However, all S+ BC flies consisted of just one of these three mtDNA haplotypes (isolate number 1).
Fertility in Spiroplasma infected and uninfected D. neotestacea
The number of mature eggs in S+ and S- BC D. neotestacea was determined and compared as a function of H. aoronymphium parasitism (see Figure 2.2). Female fertility was significantly affected by nematode parasitism and Spiroplasma infection (F1,145 =
H+ had a mean of 1.00 eggs per ovary. There was no significant difference between the number of eggs per ovary in seven day old S+ H- flies (mean=16.40) and S- H-flies (mean=16.40).
Motherworm size in Spiroplasma infected and uninfected D. neotestacea Howardula aoronymphium motherworm size was negatively affected by Spiroplasma infection (see Figure 2.3). Motherworm size was significantly reduced in S+ compared to S- D. neotestacea (mean=.1716 mm2 and .2584 mm2 respectively; F1,127
= 48.97, P < 0.0001).
Discussion
This study investigates the effects and distribution of a newly discovered
defensive symbiont in D. neotestacea. I report Spiroplasma for the first time in BC and present several lines of evidence suggesting that the fertility restoring strain of
Spiroplasma is advantageous to BC D. neotestacea. These results suggest that the defensive symbiont has entered and will continue to spread though BC.
Spiroplasma was not detected in any BC flies collected during 2008, but was present in eight BC flies from two locations in 2009 (Vernon and Fernie, BC). The sequences of two genes (p58 and spoT) in all eight S+ flies were identical to the defensive strain of Spiroplasma. Two flies contained identical parE sequences to the fertility restoring strain, but there were some variation in the sequences of this gene in five flies. Nonetheless, all parE sequences were the most closely related to the fertility
restoring strain of Spiroplasma, strongly suggesting that the Spiroplasma found in BC flies has the same fertility restoring phenotype (See Figure 2.1). These differences may indicate this defensive symbiont has several parE haplotypes, as has been reported for the spoT gene of the defensive Spiroplasma (Jaenike et al. 2010a). Further work should be conducted to confirm that the Spiroplasma isolates from BC flies also restore fertility.
The mitochondrial haplotype of all eight S+ flies further suggests that
Spiroplasma in BC is the same as the fertility restoring strain. All S+ BC flies had the same mtDNA haplotype as the major mtDNA continental haplotype reported to be infected with Spiroplasma (see Table 2.5) (Jaenike et al. 2010b). Furthermore, this is the only mtDNA haplotype that has been reported to be infected with Spiroplasma in western N. America (having been reported in Alberta). In addition, these results suggest that while the Rocky Mountains may have slowed the spread of Spiroplasma into BC, they are not a complete barrier. Two other continental mtDNA haplotypes (5 and 8) were also found in BC; both have been reported to be infected with Spiroplasma in eastern N. America. However, S+ flies carrying these mtDNA haplotypes have not yet been reported further west than North Dakota and Manitoba (Jaenike et al. 2010b).
Altogether, the distribution and diversity of mtDNA haplotypes associated with Spiroplasma best support a model where the infection is not new, but that the frequency of Spiroplasma has recently increased in eastern N. America fly populations and is spreading westward. First, the occurrence of Spiroplasma in three different mtDNA haplotypes suggests that Spiroplasma has not recently colonized D. neotestacea. Infection polymorphisms in these three haplotypes are best explained by imperfect transmission. Additionally, two slightly different Spiroplasma variants have been
reported, indicating sufficient time has elapsed for mutation to occur (Jaenike et al. 2010b). Furthermore, the much greater mtDNA diversity in populations where Spiroplasma is absent (western N. America) than where it is present (eastern N. America), suggests that it has not been present in western populations in the recent evolutionary past. It would be interesting to continue to monitor the COI mtDNA haplotypes in BC; if Spiroplasma continues to spread in BC we may predict major changes in the frequency distribution of mtDNA haplotypes.
Two lines of evidence suggest that the defensive strain of Spiroplasma will be advantageous to BC D. neotestacea. First, wild D. neotestacea collections confirm H. aoronymphium infection rates in BC are high, imposing a severe fitness cost to BC D. neotestacea. Nearly one quarter of BC D. neotestacea were infected with H.
aoronymphium, similar to infection rates found in eastern N. America (~24% and ~23% infection rate respectively) (Jaenike et al. 2010b). Second, laboratory experiments demonstrate that the defensive strain of Spiroplasma reduces H. aoronymphium motherworm size and restores fertility to nematode parasitized BC D. neotestacea. Motherworm size in S+ flies was reduced by one third, similar to the reduction in motherworm size reported in parasitized eastern D. neotestacea (Jaenike et al. 2010b). BC parasitized flies also had over 10x as many eggs when they were infected with Spiroplasma. These results suggest, as in eastern N. America, that there is a strong selective pressure for Spiroplasma to continue to spread in BC. It should be noted that H. aoronymphium used for laboratory experiments were collected from Connecticut and these experiments should be repeated with nematodes collected in BC. However, because H. aoronymphium are thought to have recently colonized N. America and
virtually no DNA sequence variation has been found within N. American or European H. aoronymphium (Perlman and Jaenike 2003), results are expected to be similar.
Recently, a different strain of Spiroplasma in D. hydei has been shown to protect hosts from wasp parasitism (Xie et al. 2010). These findings suggest that defense may be a general feature of Spiroplasma. Because Spiroplasma has no cell wall (an important elicitor of the insect immune system), the bacterium potentially avoids detection from the host. Two studies have shown that Spiroplasma that infects D. melanogaster does not induce a host immune response but appears to suppress the expression of some
antimicrobial peptides (Hurst et al. 2003; Anbutsu and Fukatsu 2010). However, if the defensive strain of Spiroplasma was actively suppressing the immune response of D. neotestacea, one would expect that flies harbouring Spiroplasma might be more susceptible to nematode infection. Alternatively, because Spiroplasma and H.
aoronymphium are found to occupy the same cellular niche in the fly, the reduction in motherworm size could be explained if they are competing for the same resources. However, it is perhaps more probable that Spiroplasma is directly affecting H.
aoronymphium and not competing for host resources, as there seems to be little cost to female fertility in S+ flies (See Figure 2.2).
To summarize, it appears Spiroplasma has now spread into BC and I have demonstrated that Spiroplasma will restore fertility to BC flies in the laboratory.
Furthermore, nematodes were found to infect nearly one quarter of all flies in BC, placing a strong selective pressure for Spiroplasma to continue to spread. Further tests should be conducted to confirm that Spiroplasma isolated from BC will protect flies from BC nematodes. Spiroplasma infection rates in BC should continue to be monitored to
determine the dynamics of the fertility restoring symbiont as it spreads throughout BC. It remains to be investigated whether the defensive effect of Spiroplasma is general to many natural enemies of Drosophila or if it is specific to the D. neotestacea -H. aoronymphium host parasite system. If the defensive phenotype of Spiroplasma is general it will have broad implications, not only for biological control strategies but also for explaining the widespread distribution of Spiroplasma in arthropods.
Literature cited
Anbutsu H, Fukatsu T (2010) Evasion, suppression and tolerance of Drosophila innate immunity by a male-killing Spiroplasma endosymbiont. Insect Mol. Biol. 19:481-488.
Dale C, Moran NA (2006) Molecular interactions between bacterial symbionts and their hosts. Cell 126:453-65.
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3:294-9.
Haine ER (2008) Symbiont-mediated protection. Proc. R. Soc. B 275:353-61. Haselkorn TS, Markow TA, Moran NA (2009) Multiple introductions of the Spiroplasma bacterial endosymbiont into Drosophila. Mol. Ecol. 18:1294-305.
Hedges LM, Brownlie JC, O'Neill SL, Johnson KN (2008) Wolbachia and virus protection in insects. Science 322:702.
Hilgenboecker K, Hammerstein P, Schlattmann P, Telschow A, Werren JH (2008) How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiol. Lett 281:215-20.
Hurst GD, Anbutsu H, Kutsukake M, Fukatsu T (2003) Hidden from the host: Spiroplasma bacteria infecting Drosophila do not cause an immune response, but are suppressed by ectopic immune activation. Insect Mol. Biol. 12:93-7.
Jaenike J, Perlman SJ (2002) Ecology and evolution of host-parasite associations: mycophagous Drosophila and their parasitic nematodes. Am. Nat. 160:S23-S39.
Jaenike J, Stahlhut JK, Boelio LM, Unckless RL (2010a) Association between Wolbachia and Spiroplasma within Drosophila neotestacea: an emerging symbiotic mutualism? Mol. Ecol. 19:414-25.
Jaenike J, Unckless R, Cockburn SN, Boelio LM, Perlman SJ (2010b) Adaptation via symbiosis: recent spread of a Drosophila defensive symbiont. Science 329:212-215.
Maddison DR, Maddison WP (2005) MacClade 4: Analysis of phylogeny and character evolution. Version 4.08. :Sinauer Associates, Sunderland, Massachusetts.
Manly B (1998) Randomization, bootstrap and Monte Carlo methods in biology. Chapman and Hall, London.
