Supplementary information
Bactericidal activity of alpha-helical cationic antimicrobial peptides
involves altering the membrane fluidity upon insertion into the
phospholipid bilayer
Soraya Omardien, Jan W. Drijfhout, Frédéric M. Vaz, Michaela Wenzel, Leendert W. Hamoen, Sebastian A. J. Zaat and Stanley Brul
Supplementary methods
Supplementary Fig S1 Minimal inhibitory concentration (MIC) of Alexa488-TC84 against B. subtilis.
Supplementary Fig S2 Heatmap depicting the difference in phospholipid composition of B. subtilis wild type strains and the B. subtilis mutants with an altered phospholipid composition membrane
Supplementary Table S1 Strains used in the study and additional information
Supplementary methods
Determination of the minimal inhibitory concentration (MIC))
To determine whether Alexa488-TC84 are active against B. subtilis (strain 168), the MIC was determined. The MIC was determined by measuring the OD600 for 24 hrs in a microtiter plate
reader (Multiskan FC, Thermo Scientific). B. subtilis cells at an OD600 of 0.02 (1 x 107
CFU/ml) or 0.002 (1 x 105 CFU/ml) were treated in CMM containing the AMP. A two-fold
serial dilution from 56 µM to 0.11 µM of the AMP was prepared in a final reaction volume of 150 µl in each well. The control consisted of CMM without AMP. The MIC was considered to be the lowest AMP concentration where no outgrowth was observed, meaning no change in OD600 for B. subtilis cells.
Lipidomics of mutants with altered membranes phospholipid composition
The phospholipid composition of the B. subtilis wild type and mutant strains was assessed using lipidomics. Samples were prepared by culturing the strains in 600 ml CMM with the required supplements. When an OD600 of 0.4 to 0.5 was reached, the cultures were split into
10 x 50 ml fractions for lipid analysis. The 50 ml fractions were pelleted for 10 min at 4 500 rpm and 25°C. Residual supernatant was removed by further pelleting the cells in a 2 ml Eppendorf tube for 2 min at 14 000 rpm at room temperature (21°C). The pellet was subsequently quick-frozen using liquid nitrogen and lyophilized overnight. Phospholipid extraction was performed as described in Herzog et al. (2016) [1], but the internal standards used were CL (14:0)4 (1000 pmol/ml), PG (18:0)2 (2000 pmol/ml), PE (18:0)2 (1000 pmol/ml), lysyl-PG (18:1)2 (500 pmol/ml) and CDP-DAG (18:1)2 (500 pmol/ml).
Construction of strain TNVS205 and EKB40
B. subtilis TNVS205 (aprE::cat Pspac-mcherry-mreB) was constructed using a three fragment Gibson assembly reaction. The ftsW gene was amplified using primers TerS397 and TerS400. The pAPNC-cat-mCherry vector3 was amplified in two fragments using the primer pairs TerS398 and TerS337, and TerS338 and TerS135. B. subtilis 168 was transformed with the resulting plasmid pTNV86. Refer to the Table below for information about the primers. B. subtilis EKB154 (pbpB::pbpB cat Pxyl-mCherry-pbpB) was constructed using a two fragment Gibson assembly reaction. Initially the pSG1164 backbone was amplified with primers EKP19 and EKP20 and the mCherry insert was amplified from pAPNCcatmCherry with EKP17 and EKP18, resulting in plasmid pEKC5. EKB154 was constructed by amplifying the pEKC5 backbone with primer EKP20 and TZP11 and the pbpB gene with primers TZP10 and TZP12. B. subtilis 168 was transformed with the resulting plasmid EKB154. Refer to the Table below for information about the primers.
Table Primers used during the cloning procedure Primer Sequence TerS135 5'GGGCGTTAGCCCAAGCGCATCA3' TerS398 5'GGATCCTGAGCCGCTTCCTGAGCCTTTGTATAATTCGTCCATTCCACCT3' TerS337 5'CATGTCTGTGCAGGCTGCCGGA3' TerS338 5'CGGCAGCCTGCACAGACATGTT3' TerS397 5'GGCTCAGGAAGCGGCTCAGGATCCATGTTTGGAATTGGTGCTAGAGACCT3' TerS400 5'ATGCGCTTGGGCTAACGCCCCCCGATTATCTAGTTTTCCCTTTGA3' TZP10 5’GTGGATCTGAAGTCTGGACATTTAttaATCAGGATTTTTAAACT3’ TZP11 5’TTTTTTGGCATTTGAATcatGGATCCTGAGCCGCTTCCTG3’ TZP12 5’CAGGAAGCGGCTCAGGATCCatgATTCAAATGCCAAAAAA3’ EKP17 5’TTGATATCGAATTCCTGCAGATGGTCAGCAAGGGAGAGGA3’ EKP18 5’ATCTGAAGTCTGGACATTTAGGATCCTGAGCCGCTTCCTG3’ EKP19 5’CTGCAGGAATTCGATATCAAGC3’ EKP20 5’TAAATGTCCAGACTTCAGATCCAC3’
Supplementary Figure
Fig S1. Minimal inhibitory concentration (MIC) of Alexa488-TC84 against B. subtilis. The Alexa488-TC84 had a reduced inhibitory effect on B. subtilis by having a MIC more than 56 µM. However, an extended lag time of about 3.5 hrs was observed with a culture of 1 x 107 cell/ml and about 9.6 hrs for 1 x 105 cells/ml was observed. An extended lag time was
Fig S2. Heatmap with the phospholipid composition of the B. subtilis wild types and the
B. subtilis mutants with an altered phospholipid composition. The wild type strains B.
subtilis 1A700 was compared with that of a B. subtilis pgsA conditional mutant (1A700-PgsA) cultured at 1 mM and 0.1 mM IPTG. B. subtilis mprF deletion mutant lacking lysyl-phosphatidylglycerol (CU1065-MprF) and B. subtilis ywnE deletion mutant lacking cardiolipin (CU1065-YwnE) was compared with wild type B. subtilis CU1065. Wild type strain 168 was compared with the triple cardiolipin synthase deletion mutant (168-CL). The
heatmap shows that the 1A700-PgsA cultured in 1 mM IPTG had higher levels of PE, PG (31:1) and PG (32:1) compared to wild type strain 1A700. 1A700-PgsA cultured in 0.1 mM IPTG had CDPDG increased, most CL species decreased, but CL2(61:1) and CL2(66:0) were increased compared to strain 1A700. About 39 % lysyl-PG of the total lysyl-PG was increased, but the rest were lower. About 46 % PE of the total PE was decreased, 33 % PG of the total PG was decreased, but PG (31:1) and PG (32:1) was increased compared to the strain 1A700. CU1065-MprF had lower levels of lysyl-PG, PE (33:1), but PG (33:1) was increased compared to strain CU1065. CU1065-YwnE had lower levels of CL and PE compared to strain CU1065, but PG (32:0), PG (33:0), PG (33:1) and PG (34:0) were increased. 168-CL had CL and PE decreased, but PG (32:0), PG (32:0), PG (34:0) and PG (35:0) increased compared to strain 168.
Supplementary table
Table S1 Strains used in this study and additional information
Strains Abbreviation Genetype or description Medium supplement Reference
168 168 trpC2; wild type None BGSCa
1A700 1A700 trpC2; 168 wild type None BGSCa
CU1065 CU1065 trpC2 attSPβ, 168 wild type None [2] MHB001 1A700-PgsA pgsA::Pspac-pgsA; EmR (1A700) 0.5 µg/ml erythromycin [3]
HB5337 CU1065-MprF mprF::kan (CU1065) 10 µg/ml kanamycin [2] HB5362 CU1065-YwnE ywnE::cat (CU1065) 1 µg/ml erythromycin [2] SDB206 168-CL ywiE2::neo ywjE::spc clsA::pMUTIN4 (168) 50 µg/ml spectinomycin [4] TNVS205 MreB-mCherry aprE::cat Pspac-mcherry-mreB 0.2 % xylose this study EKB154 PBP2b-mCherry pbpB::pbpB cat Pxyl-mCherry-pbpB 0.2 % xylose this study bSS421 PrpsD-GFP trp 2C amyE::spc PrpsD-sfgfp (168) None [5]
References
[1] K. Herzog, M.L. Pras-Raves, M.A.T. Vervaart, A.C.M.L. Luyf, A.H.C. van Kampen, R.J.A. Wanders, H.R. Waterham, F.M. Vaz, Lipidomic analysis of fibroblasts from Zellweger Spectrum Disorder patients identifies disease-specific phospholipid ratios, J. Lipid Res. 57 (2016) 1448–1454. doi:10.1194/jlr.M067470.
[2] L.I. Salzberg, J.D. Helmann, Phenotypic and transcriptomic characterization of
Bacillus subtilis mutants with grossly altered membrane composition, J. Bacteriol. 190 (2008) 7797–7807. doi:10.1128/JB.00720-08.
[3] M. Hashimoto, H. Takahashi, Y. Hara, H. Hara, K. Asai, Y. Sadaie, K. Matsumoto, Induction of extracytoplasmic function sigma factors in Bacillus subtilis cells with membranes of reduced phosphatidylglycerol content, Genes Genet. Syst. 84 (2009) 191–198. doi:10.1266/ggs.84.191.
[4] F. Kawai, M. Shoda, R. Harashima, Y. Sadaie, H. Hara, K. Matsumoto, Cardiolipin domains in Bacillus subtilis marburg membranes, J. Bact. 186 (2004) 1475–1483. doi:10.1128/JB.186.5.1475.
[5] N. Jahn, S. Brantl, H. Strahl, Against the mainstream: the membrane-associated type I toxin BsrG from Bacillus subtilis interferes with cell envelope biosynthesis without increasing membrane permeability, Mol. Microbiol. 98 (2015) 651–666.
