Microscopic study to the influence
of MORC6 and NFC2 on meiotic
recombination in Arabidopsis
thaliana
Student: Linda Hes
Student number: 10627545
Supervisor: Esther de Boer
Date: June 2016
Number of words: 4723
ABSTRACT – Meiotic recombination, occurring during meiosis I, can result in crossovers that are essential for proper separation of homologous chromosomes. The crossovers occur in specific regions of the genome that are in general associated with low DNA methylation levels. The DNA methylation landscape of the genome is part of the organization of the chromatin, which has been demonstrated to influence meiotic recombination. This study in Arabidopsis thaliana examines crossover formation in mutants of morc6 and nfc2. These genes are reported to be involved in chromatin remodeling. In addition, MORC6 is predicted to play a role in the regulation of meiotic recombination. Using fluorescence microscopy, meiocytes of both mutants were analyzed and the frequencies of crossovers were compared with the crossover rate in wildtype meiocytes. No significant differences between frequencies were found, suggesting that MORC6 and NFC2 do not play a major role in meiotic recombination.
INTRODUCTION
The development of gametes is an essential process for sexual reproduction and occurs through meiosis, a specialized form of nuclear cell division, in which homologous chromosomes are separated to produce haploid daughter cells. In almost all sexually reproducing organisms, meiosis consists of two divisions: meiosis I and II. In meiosis I the DNA is replicated, after which each chromosome consists of two sister-chromatids that are attached in the centromere. The homologous chromosomes are then paired, followed by their segregation, resulting in daughter cells with only one of each chromosome. In meiosis II, the sister-chromatids are separated and distributed into daughter cells, producing eight haploid gametes in total. During meiosis I, meiotic recombination occurs, which is the recombination of genetic material during meiosis, and this can result in crossovers. A crossover is the exchange of genetic material between non-sister chromatids of homologous chromosomes and this provides four distinct daughter cells at the end of meiosis (Mercier, Mézard, Jenczewski, Macaisne, & Grelon, 2015).
Meiosis I is divided in several stages, starting with prophase I. This is when synapsis occurs, i.e. the connecting of homologous chromosomes. After synapsis, the homologs are segregated. Prophase I is divided in substages, namely: leptotene, zygotene, pachytene, diplotene, and diakinesis. These are based on their degree of synapsis (Ross, Fransz, & Jones 1996). During leptotene, meiotic axes begin to develop and in zygotene, the replicated chromosomes connect to their homologue. The synapsis of homologous chromosomes is completed in pachytene. When the homologs are synapsed, crossover formation can occur. Afterwards, desynapsis along the whole lengths of the chromosomes begins in diplotene. In diakinesis, crossovers get visible as chiasmata, which are by then the only connections between the homologs (Hunter, 2007; Mézard, Vignard, Drouad, & Mercier, 2007; Ross et al.,1996).
Meiotic recombination contributes to more genetic variation in the offspring and the formation of crossovers is essential for an accurate separation of homologs. There is need for a at least one
connection between homologs for appropriate disjunction of homologous chromosomes in anaphase I. Therefore, crossover formation is very important for proper continuation of meiosis and should be tightly regulated (Mercier et al., 2015). The formation of crossovers is initiated by the creation of double strand breaks (DSBs). DSBs that occur during meiosis are repaired by DSB repair mechanisms. Most of these repairs result in non-crossovers, while a small part of the repairs by homologous recombination lead to the formation of crossovers. In Arabidopsis Thaliana approximately 200-300 DSBs are formed during meiosis. Yet the 5 chromosomes of the Arabidopsis genome yield only a maximum of 10
crossovers, so on average 2 crossovers per chromosome (Serrentino & Borde, 2012; Yelina et al., 2015). These crossovers and their precursory DSBs are not randomly distributed along the chromosomes. Instead, they tend to occur in so-called hotspots. These are regions with a high frequency of DSBs and therefore most crossovers are also found in these regions. Hotspots are mostly intergenic and found in euchromatin along the arms of the chromosomes, in chromatin loops. Regions that are low in the frequency of meiotic DSBs are mostly found in centromeric and pericentromeric heterochromatin regions and telomere domains (Serrentino & Borde, 2012; Blat, Protacio, Hunter, & Kleckner, 2002; Mézard, 2006).
Meiotic recombination is strictly regulated by several proteins, some of which are highly conserved between species, such as Spo11 - a DNA cleaving enzyme that initiates the formation of meiotic DSBs. Next to regulatory proteins, crossover distribution and frequency is influenced by the structure of the chromatin, as DSB hotspots are in areas with an open chromatin structure and crossovers are less likely
to occur in more condensed chromatin regions. Epigenetic mechanisms influence the frequency of meiotic DSB formation through histone modification such as methylation, acetylation, and ubiquitination (Hunter, 2007). In general, crossover hotspots are associated with low levels of DNA methylation. It has been demonstrated that stimulation of DNA methylation via the RNA-directed DNA methylation (RdDM) pathway can effectively suppress meiotic recombination in hotspots in the euchromatin of the
Arabidopsis genome (Yelina et al., 2015).The RdDM gene silencing is established by the generation of small interfering RNAs (siRNAs), followed by the recruitment of DNA methyltransferases and thereafter the reinforcement of DNA methylation (Brabbs et al., 2013). This results not only in transcriptional silencing, but it also affects the chromatin structure and may therefore influence the distribution and frequency of crossovers during meiosis. In this study the morc6 gene - one of the components of the RdDM pathway - and its effect on the frequency of meiotic recombination has been examined, together with another gene, nfc2, which encodes a chromatin remodeling factor. Both genes are expressed during flower stage 9, which is when male meiosis takes place, and might have an effect on meiotic
recombination through chromatin structure regulation (http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi). Morc6 is a member of the Microrchidia (MORC) ATPase family, a protein family that is conserved among species and plays a role in the RdDM pathway. In Arabidopsis thaliana seven related MORC genes are known. For the condensation of heterochromatin and silencing of transposable elements it has been suggested that the gene products of two members of this family, MORC1 and MORC6, are required (Moissiard et al. 2012; Brabbs, 2013). The morc6 gene is found exclusively in flowering in plants (Lorković, Naumann, Matzke, & Matzke, 2012). The MORC6 protein forms dimers with the MORC2 protein in a complex involving other RdDM pathway related proteins. MORC6 also cooperates with DMS3, another RdDM protein, and together they presumably suppress transcription (Moissiard et al., 2014). It has also been suggested that MORC6-mediated transcriptional gene silencing involves deacetylation of histones, as an increase in histone H3 acetylation was found in mutant MORC6
Arabidopsis plants (Lorković et al., 2012). These chromatin regulatory properties of MORC6 could affect meiotic recombination. Earlier computational analysis indicated that MORC6 is possibly involved in the regulation of meiosis and that it might interact with regulators of meiotic recombination Rad50, Rad52 and Arp5 (http://bar.utoronto.ca/ntools/cgi-bin/ntools_expression_angler.cgi). It is also co-expressed with MLH1, MLH3 and TOP2, which also play an important role in meiosis (Hunter, 2007). Moreover, it has been found that the absence of a morc6 homolog in mice results in a meiotic defect (Inoue et al., 1999). The other investigated gene, nfc2, encodes an RNA binding protein that also contains a histone binding domain and has been found to plays a role in chromatin remodeling for DNA replication and repair (http://www.arabidopsis.org/servlets/TairObject?id=34537&type=locus;
http://www.uniprot.org/uniprot/O22468). Nfc2, also called Msi2, is a member of the Musashi (Msi) family, a group of genes that has been identified as an essential regulator of testis germ cell
development and meiosis in Drosophila (Siddall, McLaughlin, Marriner, & Hime, 2006). It also appears to be critical for sperm development and reproductive functioning in mice (Sutherland et al., 2015). Computational analysis of NFC2 showed that its chromatin remodeling properties might play a role in meiotic recombination, especially synapsis. Earlier examination of nfc2 mutants showed reduced pollen viability, suggesting the mutation might cause a meiotic defect.
To further evaluate whether NFC2 and MORC6 are involved in meiotic recombination, this study
examined the crossover frequency in nfc2 and morc6 mutants of Arabidopsis thaliana. Seeds of the two tDNA insertion mutants were sowed and the buds of homozygous mutants were examined using
fluorescence microscopy. The amount of crossovers per diakinesis nucleus was estimated and compared 3
to the estimated crossover frequency in wildtype meiocytes. This comparison showed no significant difference between groups, suggesting that NFC2 and MORC6 do not play a major role in meiotic recombination. In the original design of this study, the effect of the mutations on distribution would also be examined, using fluorescence in situ hybridization (FISH). FISH was performed on a selection of slides, but due to a limited amount of time not enough data could be collected for further analysis of the effect of MORC6 and NFC2 on the distribution of meiotic recombination.
At first, the intention of this study was to perform two experiments. One to study the influence of MORC6 and NFC2 on meiotic recombination and another to test dmc1 and syn1 as meiosis specific promoters in Arabidopsis. It has been shown that DMC1 is a recombinase that is required for meiotic recombination and is meiosis specific in yeast (Bishop, Park, Xu, & Kleckner, 1992; Da Ines et al., 2013) In Arabidopsis it is expressed in pollen mother cells in anthers and in megaspore mother cells in ovules (Klimyuk & Jones, 1997). Earlier research showed that the dmc1 gene promoter region possibly could be used as a meiotic specific promoter in Arabidopsis (Li et al., 2012). Syn1 is the Arabidopsis homolog of Rec8, a meiosis specific cohesion subunit (Klein, 1999). It is a member of the Synapsin gene family and is involved in synapsis and segregation of homologous chromosomes in meiosis I in Arabidopsis (Bai, Peirson, Dong, Xue, & Makaroff, 1999; http://www.genecards.org/cgi-bin/carddisp.pl?gene=SYN1; https://www.arabidopsis.org/servlets/TairObject?id=134031&type=locus). If one of these promoter genes is indeed meiosis specific, it can be used in a future study to examine the effect of overexpression of nfc2 or morc6 on meiosis and meiotic recombination. Due to a limited amount of time, the second experiment was aborted before any results were obtained. However, the methods used in this experiment are still described in this paper.
MATERIALS AND METHODS
Plant materials & growing conditions
In this study Arabidopsis Thaliana seeds of wildtype COL-1 and mutants morc6 and nfc2 were used. Seeds were sown in soil treated with water containing entonem and grown at 20°C with a humidity of 70% and 16 light hours a day. After 8 days, 20 young seedlings of each mutant were transferred to individual pots. Three weeks after sowing, leaves were collected from the morc6 and nfc2 mutants and used for genomic DNA extraction according to the protocol for Arabidopsis leaves (BIO-PROTOCOL) to determine which plants were homozygous for the mutations.
Selection of homozygotes for further examination of the effect of the mutations
PCRs were done with the genomic material samples of morc6 mutants with MORC6 26lx and MORC6 Reverse primers, MORC26lx and 8409 primers, and as a positive control SDG15 forward and reverse primers. For the nfc2 mutants NFC2 forward and reverse primers, SALK LB1a and NFC2 reverse primers, and as a positive control also SDG15 forward and reverse primers were used. The sequences of the primers are shown in table 1.
For the morc6 samples the PCR program started with a first round of 3 minutes at 95°C, then 35 cycles of 95°C for 30 seconds, 58°C for 30 seconds and 72°C for 2 minutes, followed by one round of 30 seconds at 95°C, 30 seconds at 58°C and 5 minutes at 72°C. The program for the nfc2 samples was the same apart from the annealing temperature, which was 54°C instead of 58°C.
The PCR products were analyzed with 0.8% agarose gel-electrophoresis in 1x TAE. The results of the gels showed that 17 of 20 morc6 mutant plants were homozygous for the mutation and 18 of 20 nfc2 mutant plants. These were allowed to grow
further and 5 weeks after the initial seeding buds were collected.
Crossover analysis using fluorescence microscopy
Buds were collected for both mutants and wildtype, fixed, and slides were prepared according to the protocol for immunolocalization (Chelysheva, Grandont, & Grelon, 2013). DNA on the slides was stained with 2 µg/ml DAPI in vectashield. For each slide 10 µl DAPI in vectashield was used and then covered with a coverslip. The slides were analyzed using a fluorescence microscope at 100x magnification. Images of diakinesis stadia in prophase I of meiosis I were taken for the estimation of crossover frequency. This method only provides an estimation of the true number of crossovers,
because distinction between 1 or 2
crossovers on a chromosome arm cannot be made due to a high level of condensation between the homologous chromosomes. Distinction was made between chromosome pairs that appeared in rings, indicating at least two crossovers between homologs, and in rods, indicating at least one crossover. In total there were 38 morc6 mutant, 55 nfc2 mutant and 40 wildtype meiocytes used in the analysis of crossover frequency.
E. coli 5S and 45S cultivation and midiprep for DNA isolation
To perform FISH, E. coli cells containing 5S and 45S DNA repeats from wheat were grown on 2xYT plates. The 45S repeats are found in the Arabidopsis genome on chromosome 2 and 4, while the 5S repeats are found on chromosome 3, 4 and 5. From both strains a single colony was taken and cultured in 2xYT medium with 2 µl/ml ampicillin. Midipreps were performed to isolate the plasmid DNA, using the ‘GENEJET plasmid midiprep kit’ (Thermo Scientific). DNA concentrations were determined with nanodrop.
FISH (Fluorescence In Situ Hybridization) probe preparation
Using 1000 ng of the 5S plasmid DNA, FISH probes were made with biotin dye by Nick translation. For the 45S DNA probes 1000 ng 45S plasmid DNA was used and probes were made with Nick translation mix and CY3 dye. The other probes, PAL, BAC1, BAC2 and another 45S probe, were provided by Jihed Chouaref. These were also made by Nick translation. The PAL probe is a centromere specific probe. BAC1 and BAC2 label sequences that are found in pericentromeric heterochromatin regions on chromosome 1 and 5.
5
Table 1: Primer sequences of the primers used for genotyping for the selection of homozygous morc6 and nfc2 mutants. The EGFP1 and EGFP2 primers were also used for the colony PCRs of the with pK7AtDmc1NF, pK7AtSyn1B2NF and pK7AtSyn1B5NF transformed E. coli cells in the experiment of meiosis specific promoters.
Primer name Primer sequence
MORC6 26lx GGAAAGCTGGAAGCTATAAT GATG
MORC6 reverse TCCAATGGCTGAATCCGACT TTT pAC161 8409 ATATTGACCATCATACTCATT GC SGD15 forward TTTGTTGCTTACGGATTGTG ATTG SDG15 reverse AGAAAGGTGGGATGCAGGT AATAA NFC2 forward ATGTGCTGTGGATGCTGGTT T NFC2 reverse TTGGAAGGTAATGCAGAGG TGAT
SALK LB1a TGGTTCACGTAGTGGGCCAT CG
EGFP1 GCAACATCCTGGGGCACAA
GC
FISH
According to the protocol for Whole-mount FISH in seedlings of Arabidopsis thaliana by Bauwens (1996) with adjustments for optimization of Maria Koini and Till Bey (2015) and adaptations in the protocol to make it useable for FISH on a slide, FISH was performed on 6 slides that were earlier analyzed with DAPI staining and showed meiotic cells in diakinesis and metaphase I. Different probe combinations were used. The first slide (L1) contained wildtype cells, the 45S DNA probe with CY3 label, and 5S probe with biotin label. The second slide (L2) contained morc6 mutant meiocytes, the 45S probe in combination with a PAL probe with Alexa488 dye. For the third slide (L3) with wildtype cells, the same combination was used as on L2. The fourth slide (L4) contained wildtype cells and a BAC1 and BAC2 probe. On the fifth slide (L5) with wildtype cells, another 45S probe was used and on the sixth slide (L6) with morc6 mutant cells, another BAC probe was used.
The slides were analyzed under a fluorescence microscope but, due to a limited amount of time, very little data could be collected from these slides.
Transformation to study meiotic specific promoters
Three different transformations were performed with a pK7m24GW.3 vector containing a DNA construct. Three different DNA constructs were used for transformation, pK7AtDmc1NF, pK7AtSyn1B2NF, and pK7AtSyn1B5NF, each containing a promoter sequence (Dmc1, Syn1B2, or Syn1B5) and a EGFP sequence. For the transformation of competent cells, DH5-α E. coli cells were used. The transformed cells were grown on LB 1.2% agar plates with 10 µg/ml spectomycin during two days at room temperature and one day at 37°C. Colony PCRs were performed using primers for EGFP to see whether the DNA constructs were taken up by the competent cells. The sequences of these primers, EGFP1 and EGFP2, are shown in table 1. For each transformant, 15
colony PCRs were conducted. One PCR without colony and one PCR with a Dmc1 construct without EGFP sequence served as negative controls. A PCR with only EGFP DNA served as positive control. The PCR program started with a first round for 3 minutes at 95°C, then 35 cycles of 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, followed by one round of 30
seconds at 95°C, 30 seconds at 58°C and 4 minutes at 72°C. The PCR products were analyzed with 0.8% agarose gel-electrophoresis in 1xTAE. Two positive colonies for each transformant were inoculated in LB medium with 100 µg/ml spectomycin and grown overnight in a shaking incubator at 37°C. The next day, the cultures were
6
Table 2: Primer sequences that were designed and used for the sequencing of plasmid DNA samples in the experiment to study meiosis specific promoters.
Primer name Primer sequence
AtDmc1F01 CGTTTCTCCCTTTCTCCTTCC TG AtDmc1F02 CGGCGTTTGTTATTGGTGAT GTCC AtDmc1F03 GCATTATCGCAGCCATCA AtDmc1R01 CCATGGAAAGAAATCACAA ACCTG AtDmc1R02 GCAGAGACCTCCACCTTCA AAA AtDmc1R03 GATTTGCTTCGAGGGTTCA AtSyn1F01 CAACGATGGTGCGGGAATA ACAG AtSyn1F02 TTAGCGTCCACAAGCCAGTA TGAT AtSyn1F03 AAAGGAGGTCTGTTGATGG TGTTG AtSyn1F04 GCAAATTAGCGTCCACAAG CCAG AtSyn1F05 CGGCGCCGTTTTGATTTTC AtSyn1R01 CGGATCGTGGAGGTGACTT CTGA AtSyn1R02 GTGCATACCGGGAAGTTTTT GTTA AtSyn1R03 CGAGCTCGGATAATCAAAA ACACA AtSyn1R04 CTGACGAGTGTTGGACGGA ATTTG AtSyn1R05 CTCTCCTCTCCCGCTACGAT CACT
centrifuged at 4500 rpm for 20 minutes before draining the supernatant. Then the bacteria were kept at -20°C until further use.
Miniprep transformed bacteria
A miniprep was performed with the bacteria to isolate the plasmid DNA using the ‘GENEJET plasmid miniprep kit’ (Thermo Scientific). DNA concentrations were measured using a nanodrop and samples were stored at -20°C.
Sequencing plasmid DNA samples
For the sequencing of the plasmid DNA samples, primers were designed for the constructs. Three forward and three reverse primers for the dmc1 samples (AtDmc1F01, AtDmc1F02, AtDmc1F03, AtDmc1R01, AtDmc1R02, AtDmc1R03) were used. Five forward and five reverse primers for the syn1 samples (AtSyn1F01, AtSyn1F02, AtSyn1F03, AtSyn1F04, AtSyn1F05, AtSyn1R01, AtSyn1R02, AtSyn1R03, AtSyn1R04, AtSyn1R05) were used. The sequences of the primers are shown in table 2. For each of the two DNA samples of pK7AtDmc1NF, six sequencing reactions were performed with the Dmc1 primers plus two sequencing reactions using an EGFP primers, EGFP1 and EGFP2 (table 1). For each of the two DNA samples of pK7AtSyn1B2NF and of pK7AtSyn1B5NF, ten sequencing reactions were performed using the Syn1 primers plus two sequencing reactions with the EGFP primers, EGFP1 and EGFP2 (table 1). The sequencing results were analyzed using SeqMan to select one colony culture of each construct for the transformation of Agrobacterium tumefaciens.
Transformation Agrobacterium tumefaciens with DNA samples
Bacteria were transformed using electroporation and cultured on LB 1.2% agar plates with 100 µg/ml rifampicin and 10 µg/ml spectomycin overnight at 4°C in the dark. Cultures were made of 10 colonies of each transformant culture. These cultures were supposed to be used for colony PCRs and infection of wildtype plants of Arabidopsis Thaliana, but due to a limited amount of time and too far grown plants the experiment was on this point aborted.
RESULTS
The data collected from the estimations of crossover events in morc6 and nfc2 mutant and wildtype Arabidopsis meiocytes showed that there were on average more rings in wildtype cells, suggesting a higher frequency of crossovers. Figure 1 shows an example picture of a meiocyte in diakinesis for each of the three groups. The percentages that were found with the estimations of the amount of crossovers are shown in figure 2. Only small differences between the groups were found.
Statistical analysis
To check whether the variances between groups were equal, three Brown-Forsythe Levene-type tests based on the absolute
deviations from the median were performed and they showed that variances were equal (WT-MORC6: p=6.913e-07, WT-NFC2: p=4.825e-11, MORC6-NFC2: p=4.825e-11). In addition, a Shapiro-Wilk test was performed which proved that the data was distributed normally (p=9.764e-07). Since these requirements were met, the data
7
Figure 2: The percentages of the estimations of rings (yellow), rods (blue), and an unclear amount of crossovers (green) in wildtype (n=40), morc6 mutant (n=38) and nfc2 mutant (n=55) meiocytes. Pictures were taken of cells on slides using a fluorescence microscope. Examples of pictures are shown in figure 1.
WT MORC6NFC2 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%
percentage of crossover frequency per group
? Rods (1) Rings (2)
could be tested with a one-way ANOVA to determine whether the differences in crossover frequency between groups were significant. The one-way ANOVA test showed that this difference was not significant (p=0.471). Comparison between the means of groups separately using Tukey's ‘Honest Significant Difference’ method showed that there was no significant difference between the means of groups (MORC6-NFC2: p=0.1545455, adjusted p=0.7748052, WT-MORC6: p=0.3000000, adjusted p=0.4368300, WT-NFC2: p=0.1454545, adjusted p=0.7921885).
Figure 1: Left: a picture of a wildtype meiocyte in diakinesis. Middle: a morc6 mutant meiocyte. Right: a nfc2 mutant meiocyte. Indicated with an O is a ring, where at least two crossovers seem to occur. Indicated with an l is a rod, where at least one crossover seems to occur. A ? indicates that it was unsure whether one or two crossovers occurred. Pictures were taken with fluorescence microscope, using DAPI staining under UV-light filter and 1000x zoom.
FISH microscopy
Although no results were obtained with the prepared FISH slides, examples of pictures taken of these slides are shown in image 2.
Figure 3: Pictures taken of FISH slide L1. A1) meiocyte in diakinesis made visible with DAPI staining. A2) the fluorescence of the 45S probe is visible, indicating chromosomes 2 and 4. The 5S probe is not shown, because it did not give a signal. A3) A1 and A2 merged, showing on which chromosomes the 45S probes are attached. B1) tetrad visible by DAPI staining. B2) the fluorescence of the 45S probe in the tetrad. It is striking that there are three fluorescent dots in two nuclei, but in both other two nuclei only one red dot. This indicates an uneven distribution of the chromosomes 2 and/or 4 over the four daughter cells. B3) B1 and B2 merged together to show where the 45S probes are located in the tetrad.
DISCUSSION
In this study, two experiments were conducted. One experiment was to investigate the meiosis specificity of the dmc1 and syn1 promoters in Arabidopsis. After the transformation of Agrobacterium with plasmid DNA containing the GFP-constructs, there was not enough time left to finish this
experiment together with the other one. Therefore, no results were obtained to determine whether dmc1 and syn1 are meiosis specific promoters in Arabidopsis. This has to be further investigated in another study.
The other experiment was performed to investigate the influence of genes morc6 and nfc2 on the frequency of crossovers during meiosis. With previous computational analysis it was found that MORC6 might play a role in the regulation of meiosis and probably interacts with other proteins that are essential for meiosis and meiotic recombination. Computational analysis of NFC2 had indicated that NFC2 could play a role as a chromatin remodeling factor in meiotic recombination, especially synapsis. Previous examination of nfc2 mutants showed reduced pollen viability, indicating a possible meiotic defect. Both genes are expressed during flower stage 9, when male meiosis takes place. Their
involvement in chromatin structure regulation suggests that they might have an effect on the regulation of meiotic recombination (Moissiard et al. 2012; Brabbs, 2013; Moissiard et al., 2014;
http://www.arabidopsis.org/servlets/TairObject?id=34537&type=locus;
http://www.uniprot.org/uniprot/O22468). Diakinesis stage from homozygous mutant plants was analyzed to estimate crossover frequency and the results were compared with wildtype crossover rates. A small difference was found in the amount of crossovers, but this difference was not statistically significant. The data of this study therefore indicate that there is no significant influence of the morc6 and nfc2 mutations on crossover frequency in Arabidopsis Thaliana. However, in this study only a limited amount of cells were analyzed. Increasing the sample size could possibly give a result with a significant difference in the number of crossover events between the wildtype meiocytes and the mutant groups, but if anything, the difference is expected to be very subtle.
The absence of an effect of MORC6 on the frequency of meiotic recombination in this study could be explained by the fact that the MORC gene family is highly conserved, but morc6 is only present in flowering plants (Lorković et al., 2012). Therefore, one could assume that this gene is not as important for the RdDM pathway as other MORC genes and could be considered as redundant. Moreover, a recent study suggested that the MORC family proteins only contribute to DNA methylation at a small subset of RdDM target loci (Liu, 2016). It could be argued that MORC6 is only an activity enhancing enzyme that is by itself not of great importance for the RdDM pathway and the regulation of condensation of the DNA, as it is part of a protein complex in the RdDM pathway and it cooperates with other proteins in the regulation of condensation of the DNA (Moissiard et al., 2014; Brabbs et al., 2013). Furthermore, earlier studies showed that MORC6 only has an effect on the methylation status of certain regions of the genome in the heterochromatin, while crossover hotspots are mostly found in the euchromatin (Serrentino et al., 2012; Blat et al., 2002; Mézard, 2006; Liu et al., 2016 ; Yelina et al., 2015). An
explanation could be that the chromatin remodeling properties of the MORC6 protein do not affect the chromatin status in the hotspot regions and therefore it does not have an effect on the crossover frequency during meiosis. The absence of MORC6 could have decreased DNA methylation on
heterochromatin, leading to decondensation, but this is presumably not of influence on the occurrence of crossovers during meiosis. This suggestion is in line with an earlier study. In this study a defect in ddm1 - leading to fewer DNA methylation in centromeric and pericentromeric heterochromatin - did not increase the number of crossovers, indicating that crossovers in heterochromatin do not seem to be suppressed by DNA methylation alone (Melamed-Bessudo & Levy, 2012). Altogether, this could indicate that the influence of MORC6 on the frequency of crossovers during meiosis in Arabidopsis is non-existent or negligible. The chromatin remodeling properties of NFC2 might also be restricted to regions that are free of crossover hotspots and therefore could not be of influence on the frequency of meiotic
recombination.
As effects of the mutations were only measured on the level of overall frequency of meiotic
recombination, but not on local distribution, the distribution of crossovers could still be affected by local changes in the chromatin structure. These local alterations would then cause shifts in regions that contain crossover hotspots. This effect was found by a previous study that examined the effect of the absence of DNA methyltransferase 1 (DNMT1) on the distribution of meiotic recombination in
Arabidopsis (Mirouze et al., 2012). Hypomethylation caused by a defect in the DNMT1 gene resulted in a redistribution of meiotic crossovers without affecting the amount of crossovers. A possible explanation
would be that the mutations in nfc2 and especially morc6 have a similar effect on distribution, due to changes in the chromatin structure, but not on crossover frequency.
Another explanation can be found in the fact that meiotic recombination is a very important process, as it is essential for the ability of an organism to sexually reproduce itself. This suggests that this process is tightly regulated. Defects in the regulation of the chromatin structure could be countered to not affect the crossover frequency and the proper segregation of homologous chromosomes in meiosis I. Several studies showed that alterations in the DNA methylation patterns of the Arabidopsis genome do not have significant effects on the occurrence of crossovers (Colomé-Tatché et al., 2012; Melamed-Bessudo & Levy, 2012; Mirouze et al., 2012; Yelina et al., 2012). It was suggested that these results could be
explained by possible compensatory mechanisms that maintain global crossover distribution even if DSB intensity is affected by changes in DNA methylation (Mézard, Jahns, & Grelon, 2015). But if the
mutations do indeed not affect the frequency of crossovers, the question arises how a defect in nfc2 could cause reduced pollen viability. The earlier observed reduced pollen viability in nfc2 mutants could be found by coincidence. Alternatively, NFC2 could play another role in meiosis during later stadia, and affects pollen viability in another manner.
In conclusion, given the results of this study, NFC2 and MORC6 do not seem to play a major role in the regulation of the frequency of meiotic recombination. In a similar experiment with a bigger sample size, the results of this study should be confirmed to see whether these genes truly do not have an effect on crossover frequency or do have a subtle effect. Moreover, it could still be that these genes have an effect on the distribution of crossovers during meiosis. This has to be further examined, for instance with FISH, as was initially planned to do in this study. The earlier observed effect of NFC2 on pollen viability has to be further examined in future research to find the true cause of this effect and whether it could be caused by an effect of NFC2 on the occurrence of crossovers.
References
1. Bai, X., Peirson, B. N., Dong, F., Xue, C., & Makaroff, C. A. (1999). Isolation and characterization of SYN1, a RAD21-like gene essential for meiosis in arabidopsis. The Plant Cell, 11(3), 417-430.
2. Blat, Y., Protacio, R. U., Hunter, N., & Kleckner, N. (2002). Physical and functional interactions among basic chromosome organizational features govern early steps of meiotic chiasma formation. Cell, 111, 791-802. 3. Bishop, D. K., Park, D., Xu, L., & Kleckner, N. (1992). DMC1: A meiosis-specific yeast homolog of E. coli recA
required for recombination, synaptonemal complex formation, and cell cycle progression. Cell, 69(3), 439-456.
4. Brabbs, T. R., He, Z., Hogg, K., Kamenski, A., Li, Y., Paszkiewicz, K. H., Moore, K. A., O'Toole, P., Graham, I. A. and Jones, L. (2013), The stochastic silencing phenotype of Arabidopsis morc6 mutants reveals a role in efficient RNA-directed DNA methylation. Plant J, 75: 836–846.
5. Chelysheva, L. A., Grandont, L., & Grelon, M. (2010). An easy protocol for immunolabelling arabidopsis meiotic proteins on robustly spread chromosomes. Cytogenetic and Genome Research, 129(1-3), 143-53.- method 1, page 95: 3 Methods – 3.1 Chromosome preparation, step 1 to 10.
6. Colomé-Tatché, M., Cortijo, S., Wardenaar, R., Morgado, L., Lahouze, B., Sarazin, A., et al. (2012). Features of the arabidopsis recombination landscape resulting from the combined loss of sequence variation and DNA methylation. Proceedings of the National Academy of Sciences, 109(40), 16240-16245.
7. Da Ines, O., Degroote, F., Goubely, C., Amiard, S., Gallego, M. E., & White, C. I. (2013). Meiotic
Recombination in Arabidopsis Is Catalysed by DMC1, with RAD51 Playing a Supporting Role. PLoS Genetics, 9(9), e1003787.
8. Hunter, N. (2007). Meiotic recombination. Molecular Genetics of Recombination, Topics in Current
Genetics, 17, 381-442.
9. Inoue, N., Hess, K. D., Moreadith, R. W., Richardson, L. L., Handel, M. A., Watson, M., et al. (1999). New gene family defined by MORC, a nuclear protein required for mouse spermatogenesis. Human Molecular
Genetics, 8(7), 1201-1207.
10. Klein, F., Mahr, P., Galova, M., Buonomo, S. B. C., Michaelis, C., Nairz, K., et al. A central role for cohesins in sister chromatid cohesion, formation of axial elements, and recombination during yeast
meiosis. Cell, 98(1), 91-103.
11. Klimyuk, V. I. and Jones, J. D.G. (1997), AtDMC1, the Arabidopsis homologue of the yeast DMC1 gene: characterization, transposon-induced allelic variation and meiosis-associated expression. The Plant Journal, 11: 1–14.
12. Li, J., Farmer, A. D., Lindquist, I. E., Dukowic-Schulze, S., Mudge, J., Li, T., et al. (2012). Characterization of a set of novel meiotically-active promoters in arabidopsis. BMC Plant Biology, 12(1), 1-13.
13. Liu, Z., Zhou, J., Huang, H., Li, Y., Shao, C., Li, L., et al. (2016). Two components of the RNA-directed DNA methylation pathway associate with MORC6 and silence loci targeted by MORC6 in arabidopsis. PLoS
Genetics, 12(5), e1006026.
14. Lorković, Z., Naumann, U., Matzke, A. M., & Matzke, M. (2012). Involvement of a GHKL ATPase in RNA-directed DNA methylation in arabidopsis thaliana. Current Biology, 22(10), 933-938.
15. Melamed-Bessudo, C. & Levy, A. A. (2012). Deficiency in DNA methylation increases meiotic crossover rates in euchromatic but not in heterochromatic regions in Arabidopsis. Proceedings of the National
Academy of Sciences of the United States of America, 109(16), E981–E988.
16. Mercier, R., Mézard, C., Jenczewski, E., Macaisne, N., & Grelon, M. (2015). The molecular biology of meiosis in plants. Annual Review of Plant Biology, 66, 297-327.
17. Mézard, C. (2006). Meiotic recombination hotspots in plants. Biochemical Society Transactions, 34(4), 531-534.
18. Mézard, C., Tagliaro Jahns, M., & Grelon, M. (2015). Where to cross? new insights into the location of meiotic crossovers. Trends in Genetics, 31(7), 393-401.
19. Mézard, C., Vignard, J., Drouaud, J., & Mercier, R. (2007). The road to crossovers: Plants have their say. Trends in Genetics, 23(2), 91-99.
20. Mirouze, M., Lieberman-Lazarovich, M., Aversano, R., Bucher, E., Nicolet, J., Reinders, J., & Paszkowski, J. (2012). Loss of DNA methylation affects the recombination landscape in Arabidopsis. Proceedings of the
National Academy of Sciences of the United States of America, 109(15), 5880–5885.
21. Moissiard, G., Bischof, S., Husmann, D., Pastor, W. A., Hale, C. J., Yen, L., et al. (2014). Transcriptional gene silencing by arabidopsis microrchidia homologues involves the formation of heteromers. Proceedings of the
National Academy of Sciences, 111(20), 7474-7479.
22. Moissiard, G., Cokus, S. J., Cary, J., Feng, S., Billi, A. C., Stroud, H., et al. (2012). MORC family ATPases required for heterochromatin condensation and gene silencing. Science, 336(6087), 1448-1451. 23. Ross, K. J., Fransz, P., & Jones, G. H. (1996). A light microscopic atlas of meiosis in arabidopsis
thaliana. Chromosome Research, 4(7), 507-516.
24. Serrentino, M., & Borde, V. (2012). The spatial regulation of meiotic recombination hotspots: Are all DSB hotspots crossover hotspots? Experimental Cell Research, 318(12), 1347-1352.
25. Siddall, N. A., McLaughlin, E. A., Marriner, N. L., & Hime, G. R. (2006). The RNA-binding protein Musashi is required intrinsically to maintain stem cell identity. Proceedings of the National Academy of Sciences of the
United States of America, 103(22), 8402–8407.
26. Sutherland, J. M., Sobinoff, A. P., Fraser, B. A., Redgrove, K. A., Davidson, T. L., Siddall, N. A., et al. (2015). RNA binding protein musashi-1 directly targets Msi2 and erh during early testis germ cell development and interacts with IPO5 upon translocation to the nucleus.. The FASEB Journal, 29(7), 2759-2768.
27. Yelina, N. E., Choi, K., Chelysheva, L., Macaulay, M., de Snoo, B., Wijnker, E., et al. (2012). Epigenetic remodeling of meiotic crossover frequency in arabidopsis thaliana DNA methyltransferase mutants. PLoS
Genetics, 8(8), e1002844.
28. Yelina, N. E., Lambing, C., Hardcastle, T. J., Zhao, X., Santos, B., & Henderson, I. R. (2015). DNA methylation epigenetically silences crossover hot spots and controls chromosomal domains of meiotic recombination in arabidopsis. Genes & Development, 29(20), 2183-2202.
