Biology of monocyte interactions with the endothelium : the platelet factor - Chapter 3 "P-Selectin Glycoprotein Ligand-1 (PSGL-1) is expressed on endothelial cells and mediates monocyte adhesion to activated endothe

UvA-DARE (Digital Academic Repository)

Biology of monocyte interactions with the endothelium : the platelet factor

da Costa Martins, P.A.

Publication date

2005

Link to publication

Citation for published version (APA):

da Costa Martins, P. A. (2005). Biology of monocyte interactions with the endothelium : the

platelet factor.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

"P-Selectinn Glycoprotein Ligand-1

(PSGL-1)) is expressed on endothelial

cellss and mediates monocyte adhesion

too activated endothelium"

PaulaPaula da Costa Martins

, Juan-Jesus Garcia-Vallejo

, Johannes V. van

ThienenThienen

,, Mar Fernandez-Borja

, Anton J. Horrevoets

, Peter L Hordijk

,

andand Jaap-Jan Zwaginga

'

1

Dept.. of Experimental Immunohematology, Sanquin Research; Location CLB, Amsterdam

2_{Dept.. of Molecular Cell Biology and Immunology, VU Medical Center; Amsterdam} 3

Dept.. of Biochemistry, Academical Medical Center; Amsterdam

4

Dept.. of Hematology, Academical Medical Center; Amsterdam, Thee Netherlands

Abstract t

P-selectinn glycoprotein ligand-1 (PSGL-1) is an extensively characterized selectinn ligand on leukocytes that mediates interactions with activated endothelial cellss (EC). In addition, PSGL-1 plays a crucial role in the formation of platelet-monocytee complexes (PMC). Here we show that PSGL-1 is expressed at the mRNA andd protein levels in umbilical vein and microvascular EC. PSGL-1 expression was nott affected by treating EC with inflammatory stimuli (TNF-a, IL-1 (3, thrombin, or histamine).. However, the binding of the P-selectin/Fc chimera to endothelial PSGL-1 wass significantly increased by TNF-a, indicating that TNF-a modulates the glycosylationn of PSGL-1. This was further demonstrated using siRNA strategy to specificallyy knock-down the genes involved in the glycosylation of PSGL-1. Furthermore,, we could demonstrate the contribution of PSGL-1 and its selectin ligandss in interactions between monocytes or PMC and activated endothelium in a floww model. Importantly, incubation of activated EC with an antibody to PSGL-1 blockedd monocyte adhesion and significantly increased rolling velocity. Similarly, platelett adhesion to activated EC was inhibited when endothelial PSGL-1 or platelet P-selectinn were blocked. In conclusion, our results show that EC express functional PSGL-11 which mediates tethering and firm adhesion of monocytes and platelets to inflamedd endothelium.

Introduction n

P-selectinn glycoprotein ligand-1 (PSGL-1) is one of the best characterized selectinn ligands. PSGL-1 is a homodimer of two 120-kDa subunits that binds all three selectins,, with the highest affinity for P-selectin1. Although PSGL-1 was originally identifiedd in human neutrophils and the promyelocytic cell line HL-602, Frenette et al.3 showedd PSGL-1 expression in mouse and human platelets and demonstrated that it mediatess platelet-endothelium interactions. Similar to L-selectin, PSGL-1 is constitutivelyy expressed on the surface of most types of leukocytes and plays a role inn leukocyte-leukocyte, leukocyte-platelet and leukocyte-endothelium interactions4"6. Leukocytee and platelet rolling over inflamed endothelium are mediated by the selectinn family of adhesion molecules expressed on the endothelium, platelets and leukocytes7"9.. P-selectin is stored in granules of EC and platelets and is rapidly translocatedd to the cell surface after stimulation. Expression of E-selectin on endotheliumm is induced by inflammatory cytokines such as IL-1P and TNF-a 10. In contrast,, L-selectin is constitutively expressed by leukocytes and is involved in the recruitmentt of cells into sites of inflammation11"14. In vivo studies showed that leukocytee 1 mediates rolling of leukocytes over E-selectin on EC while PSGL-11 - L-selectin interactions mediate leukocyte secondary tethering to activated endothelium15. .

PSGL-11 - dependent interactions appear to bridge the hemostatic and the inflammatoryy responses. Leukocyte PSGL-1 allows binding to P-selectin on activated platelets,, localized at the injured vessel wall4. These platelet-leukocyte interactions, mainlyy between platelets and monocytes, give rise to circulating platelet-monocyte complexess (PMC). PMC are currently regarded not just as markers of vessel wall disease16,177 but also as thrombo-atherogenic particles with high adhesive capacity to activatedd endothelium18,19.

Controversiall studies have assessed the presence of PSGL-1 on endothelium. Althoughh Laszik et al.20 have detected sporadic PSGL-1 expression on endothelium fromm small venules and capillaries in some pathological studies, Sperandio et al.15 failedd to show PSGL-1 expression on resting or inflamed endothelium and platelets in mice.. Therefore, the presence of PSGL-1 on EC has not been further investigated andd is currently not considered to be important. We show in this report that PSGL-1 iss expressed at the mRNA and protein levels in human vein and foreskin microvascularr EC (HUVEC and FMVEC, respectively). Importantly, we also show thatt endothelial PSGL-1 plays an important role in mediating the rolling and adhesion off monocytes, platelets and PMC over activated endothelium. These findings reveal aa new mechanism by which selectins and their ligands participate in the onset of inflammationn and/or atherosclerosis.

Materiall and Methods

Reagents.Reagents. Human serum albumin (HSA) was purchased from Sanquin (Amsterdam,, The Netherlands). Recombinant TNFa was from Boehringer Mannheim

(Germany)) and Texas Red-phalloidin was from Molecular Probes {Eugene, OR). IL-1(33 was purchased from R&D Systems (Minneapolis, MN). Thrombin and histamine weree from Sigma Chemical Co (St. Louis, MO). Recombinant human P-selectin/Fc chimeraa was from R&D Systems (Minneapolis, MN). Washing buffer contained phosphate-bufferedd saline (PBS) supplemented with 0.5% human serum albumin andd 13 mM trisodium citrate. Incubation buffer contained 20 mM HEPES, 132 mM NaCI,, 6 mM KCI, 1 mM MgS04, 1.2 mM KH2P04 supplemented with 5 mM glucose,

1.00 mM CaCb and 0.5% (w/v) HSA. Tissue culture supplies (media, antibiotics and trypsin)) were from Gibco, Life Technologies Inc (Paisley, UK).

MonoclonalMonoclonal antibodies. Monoclonal antibodies (MAbs) WASP 12.2 (CD62P, antii P-selectin), DREG 56 (CD62L, anti L-selectin) and W6/32 (anti HLA-A, B and C;

controll antibody) were isolated from the supernatant of hybridomas obtained from the Americann Type Culture Collection (Rockville, MD). Specific MAbs against human PSGL-1,, PL-1 (blocking of PSGL-1 binding) and PL-2 (non-blocking) were kindly providedd by Dr. Kevin L. Moore (University of Oklahoma, Oklahoma). MAb ENA2 (CD62E,, blocking of E-selectin binding) was kindly provided by Dr. W. A. Buurman (Universityy Hospital, Maastricht, The Netherlands). MAb against human VCAM-1 (4B2)) was purchased from R&D Systems (Minneapolis, MN). The following FITC-labeledd MAbs were used: AK-6 anti-CD62P (Sanquin Reagents, Amsterdam, The Netherlands)) and CI26CI0B7 anti CD62E (Bender MedSystems, Vienna, Austria). Thee Alexa-488-labeled goat-anti-mouse-lg antibody was purchased from Molecular Probess (Eugene, OR) and the FITC-conjugated goat-anti-human-IgG was from Jacksonn ImmunoResearch Laboratories (West Grove, PA).

EndothelialEndothelial cells. HUVEC were isolated from human umbilical cord veins as described21,22.. Immortalized HUVEC, EC-RF2423 cells, were kindly provided by Prof.

H.. Pannekoek (Academic Medical Center, Amsterdam, The Netherlands). FMVEC24,255 were kindly provided by Prof. V. W. M. van Hinsbergh (VU Medical Center,, Amsterdam, The Netherlands). Cells were cultured in RPMI 1640 containing 20%% (v/v) human serum, 200 ug/ml penicillin and streptomycin (Life Technologies) andd grown to confluence in 5-7 days. Primary endothelial cells from the first, second orr third passage were used in the experiments. TNF-a (100U/ml), interleukin-1p (10u.g/ml),, thrombin (1U/ml) or histamine (1U/ml) was added directly to the medium att different time points prior to the experiments. For blocking experiments, EC were incubatedd with MAbs for 10 min at C and washed with incubation buffer prior to perfusion. .

RNARNA interference. The mammalian expression vector, pSUPER.retro.puro

26,277

(a kind gift of Dr. R. Agami, Netherlands Cancer Institute, Amsterdam, The Netherlands)) was used for expression of siRNA in HUVEC. The gene-specific insert identifiess a 19-nucleotide sequence corresponding to nucleotides 758-777 (gacatttcgccacctgcac)) of a-4GalT-7 (NM_007255), nucleotides 1037-1056 (atacggcaccgtgcgaaac)) of GST-1 (NM_003654), nucleotides 1535-1554 (cagccctgaggaggtcaaa)) of GST-2 (NM_004267), nucleotides 362-381 (gacgacctacccgatagat)) of FX (NM_003313), nucleotides 510-529 (gcacagaccactcaaccca)) of PSGL-1 (NM_003006), or a sequence with no significant homologyy to any human gene sequence, therefore used as a non-silencing control. Thee gene-specific insert was separated by a 9-nucleotide non-complementary spacer (ttcaagaga)) from the reverse complement of the same 19-nucleotide sequence, and flankedd by restriction sites for the enzymes Bgl II and Hind III, producing a final insert off 60 nucleotides. These sequences were inserted into the pSUPER.retro.puro backbonee and transformed into XL Gold supercompetent cells (Invitrogen, USA), accordingg to the manufacturer's instructions. The different vectors were referred to as pSUPER/a-4GalT-7,, pSUPER/GST-1, pSUPER/GST-2, pSUPER/PSGL-1, pSUPER/FX,, or pSUPER/Scrambled, respectively. Plasmids were transfected into HUVECC using the Basic Nucleofector Kit for Primary Mammalian Endothelial Cells (Amaxa,, Germany) in an Amaxa Nucleofector (Amaxa, Germany), according to manufacturer'ss instructions. Immediately after transfection, cells were seeded in glasss coverslips coated with crosslinked gelatin (1 %) and fibronectin (5 mg/mL). Transfectionn efficiency was higher than 90 % as evaluated by flowcytometry analysis off HUVEC co-transfected pmax/GFP (Amaxa, Köln, Germany) and the different pSUPERR constructs (data not shown). To test the efficiency of RNA interference, cellss were lysed after 48 h, mRNA isolated (mRNA Capture Kit, Roche, Switzerland) andd retrotranscribed into cDNA (Reverse Transcription System, Promega, USA), accordingg to manufacturer's instructions. Gene expression of a-4GalT-7, GST-1, GST-2,, FX, and PSGL-1 was assessed by means of quantitative real-time PCR in an ABII 7900HT platform (Applied Biosystems, USA) using the SYBR Green I chemistry (Appliedd Biosystems, USA), as previously described28. The primers used were: a-4GalT-77 (Fwd: aggtggaccacttcaggttca, Rev: agtccgtgctgttgctgct), GST-1 (Fwd: ccacgtccagaacacgctcatc,, Rev: cggcggcttgatgtagttctcc), GST-2 (Fwd: gctctggctcgtcgttcttc,, Rev: agagaggtcgcagcggtaaag), FX (Fwd: agccatccagaaggtggtagc,, Rev: gacgtgtgtgggttggacc), PSGL-1 (Fwd: tgacaccactcctctgactggg,, Rev: ctccatagctgctgaatccgtg), and GAPDH (Fwd: aggtcatccctgagctgaacgg,, Rev: cgcctgcttcaccaccttcttg) as endogenous reference gene28. .

IsolationIsolation of blood cells. Whole blood, anticoagulated with 0.4% trisodium citratee (pH 7.4) was obtained from healthy volunteers from the Sanquin Blood Bank

(Amsterdam,, The Netherlands). Monocytes were isolated by negative selection from humann peripheral blood by means of a MACS monocyte isolation kit according to the manufacturer'ss instructions (Miltenyi Biotech GMBH, Bergisch Gladbach, Germany). Thiss procedure resulted in more than 90% pure monocyte suspensions (measured ass CD14-positive cells by flowcytometry). To obtain PMC-poor monocyte suspensions,, the monocytes were incubated with a mouse IgG against GPIIIa for 20 minn at . After one washing step, the cells were incubated with goat-anti-mouse-IgGG microbeads (Dynabeads, Dynal A.S., Oslo, Norway), at a ratio of two beads per platelet,, for 20 min at . After magnetic extraction of the beads, the presence of PMCC was less than 5% of the total amount of monocytes. After isolation, the cells weree resuspended in incubation buffer. For blocking experiments, monocyte suspensionss with or without PMC were incubated with MAbs for 10 min at C and washedd in incubation buffer prior to the perfusion experiments.

Forr platelet isolation, whole blood was centrifuged at 150 g for 10 min to obtain platelet-richh plasma, which was diluted in Krebs-Ringer solution (4 mM/L KCI, 107 mM/LL NaCI, 20 mM/L NaHC03l 2 mM/L Na2S04, 19 mM/L trisodium citrate, 0.5%

(wt/vol)) glucose in H20, pH 5.0). The mixture was centrifuged at 500 g for 10 min and

thee pelleted cells were resuspended in 2 mL of Krebs-Ringer solution (pH 6.0) and centrifugedd at 500 g for 10 min. This procedure was repeated two times, the final suspensionn being made up in Krebs-Ringer solution (pH 6.0) to a concentration of

1066 platelets/ml.

ReverseReverse transcriptase and real-time PCR. For the reverse transcriptase PCR,, total RNA was prepared from freshly isolated monocytes and untreated or

IL-1PP (4 h) treated HUVEC or EC-RF24 cells with the Absolutely RNA kit (Stratagene). Totall RNA (2 \xg) was converted to cDNA using 0.5 ^ig of dT12-18 primer (Invitrogen),, Superscript II (Invitrogen) and 20 units of RNAsin (Promega). For the PCRR reaction, 5% of the reaction volume served as template for the PSGL-1 primers: FW:5'GGGATCTTCAGGGAAGGAAC3'' and Rv:5'CTCCAGTGACCAGGAGAAGC3'. Thee reaction mixture was denatured at C for 2 min and amplified in 35 cycles at

CC for 15 s, C for 20 s and C for 45 s. PCR products were resolved on a 1.5%% agarose gel.

WesternWestern blotting. Monocytes and HUVEC were lysed in 15% Triton X-100, 0.1%% SDS, 0.1% NP-40, 100 mM Tris-HCI pH 7.4, 150 mM NaCI, and 1 mM CaCI2

buffer.. Proteins from the cell lysates (1x106 monocytes and 2x106 HUVEC) were

separatedseparated on 7% SDS-PAGE, transferred to a PVDF membrane and blotted with PL-11 antibody. The bound antibody was detected by using HRP-conjugated secondary antibody. .

FlowcytometryFlowcytometry and confocal microscopy. PSGL-1 surface expression on ECC was investigated by flowcytometry (FACS Vantage, Becton Dickinson and

Company,, CA) with cells from different passages, stimulated or not with TNF-a (10 andd 30 min, 2, 6, 12 and 24 h), IL-13 (6 h), thrombin (5 and 10 min) or histamine (5 andd 10 min). After stimulation, EC were resuspended in washing buffer and incubatedd with a control antibody (FITC-labeled goat anti-mouse IgG), or an antibody againstt PSGL-1 (PL-1 or PL-2), P-selectin (AK6) or E-selectin (CI26CI0B7) for 45 minn at . Cells were washed with washing buffer before analysis. For confocal microscopy,, EC seeded on fibronectin-coated glass coverslips were immediately stainedd and analyzed or fixed with 3.7% formaldehyde in PBS containing 1 mM Ca2+ andd 1 mM Mg2+ for 10 min at room temperature. After blocking with PBS containing 0.5%% bovine serum albumin, 1 mM Ca2+ and 1 mM Mg2+, PSGL-1 was detected with PL-11 antibody followed by an Alexa-488-labeled goat-anti-mouse-lg antibody. In a similarr way, specific antibodies were used to detect VCAM-1 and E-selectin on EC. Thee affinity of endothelial PSGL-1 for P-selectin was tested with a P-selectin/Fc chimera.. EC, activated or not with TNF-a, were incubated with P-selectin/Fc chimera forr 20 min at . After washing, the cells were prepared for flowcytometry and confocall microscopy, as described above. P-selectin/Fc protein binding to EC was detectedd with a Alexa Fluor 488-conjugated goat-anti-human-IgG antibody. Fixed cellss were counterstained for F-actin with Texas Red-phalloidin. Images were recordedd with a Zeiss LSM 510 confocal laser scanning microscope.

MonocyteMonocyte perfusion and evaluation of adhesion and rolling velocity. Monocytess in suspension (2 x 106 cells/ml in incubation buffer) were aspirated from a

reservoirr through plastic tubing and perfused through a chamber with a Harvard syringee pump (Harvard Apparatus, South Natic, MA). The flow rate through the chamberr was precisely controlled and the monocytes were perfused over EC at 0.8 dyn/cm2.. During perfusions the flow chamber was mounted on a microscope stage (Axiovertt 25, Zeiss, Germany), equipped with a B/W CCD video camera (Sanyo, Osaka,, Japan), and coupled to a VHS video recorder22,29. Video images were evaluatedd for the number of adherent monocytes and the rolling velocity per cell, with dedicatedd routines made in the image analysis software Optimas 6.1 (Media Cyberneticss Systems, Silverspring, MD, USA). The monocytes that were in contact withh the surface appeared as bright white-centered cells after proper adjustment of thee microscope during recording. The number of surface-adherent monocytes was measuredd after 5 min of perfusion at a minimum of 25 randomized high-power fields. Too automatically determine the velocity of rolling cells, custom-made software was developedd in Optimas 6.1. A sequence of 50 frames representing an adjustable time intervall (8t, with a minimal interval of 80 milliseconds) was digitally captured. The positionn of every cell was detected in each frame, and for all subsequent frames the

distancee traveled by each cell and the number of images in which a cell appears in focuss was measured. The cut-off value to distinguish between rolling and static adherentt cells was set at 1 ^m/s. With this method, static adherent, rolling and free flowingg cells (which were not in focus) could be clearly distinguished.

PlateletPlatelet perfusion and evaluation of adhesion. Platelets in suspension (106 cells/mll in Krebs-Ringer buffer), incubated with a control antibody (W6/32) or with a P-selectinn blocking antibody (WASP 12.2), were stained with green calcein (Molecularr Probes, Eugene, OR) and perfused over EC in the same way as for monocytess (see above) with minor modifications. In short, the flow rate through the chamberr was maintained at 6 dyn/cm2 and the flow chamber was mounted on a Zeisss LSM 510 confocal laser scanning microscope. Images of at least 60 different fieldss were taken. For every image the adhered platelets were manually counted.

TissueTissue specimens and immunohistochemistry. Portions of coronary arteriess were obtained from autopsy specimens at the University Hospital of Utrecht (Thee Netherlands) and were procured according to institutional guidelines. Coronary arteriess undergoing atherosclerosis were snap-frozen and seccioned using conventionall techniques. Slides were kept for 20 minutes at room temperature before staining.. Histochemical staining for PSGL-1 antigen was performed by means of avidinn biotin peroxidase methodology. The slides were incubated with PBS containingg 10% horse serum to inhibit nonspecific antibody binding, followed by primaryy antibody diluted in PBS/1% bovine serum albumin for 45 minutes. The workingg concentration of the PL-1 MoAb was 2.5 ug/ml. An irrelevant mouse monoclonall I g d was used at equivalent concentration (Sanquin Reagents, Amsterdam,, The Netherlands). Slides were then incubated with biotin-conjugated goatt anti-mouse secondary antibody for 30 minutes, followed by a chromogen/substratee reagent solution (diaminobenzidine/H202, Sigma)) for 10

minutes.. Hematoxylin was used for nuclear counterstaining. Between all incubation stepss the slides were washed with PBS. For each antibody, three different specimenss were analysed.

StatisticalStatistical analysis. Data are represented as the mean S.E.M. of at least 3 independentt experiments and were compared with a two-tailed Student's t-test or a

one-wayy ANOVA with Bonferroni correction. P values < 0.05 were considered to be significant. .

Results s

PSGL-1PSGL-1 is expressed in endothelial cells at the mRNA and protein levels. Becausee PSGL-1 is involved in leukocyte-endothelium interactions and PSGL-1 has beenn suggested to be present in the endothelium of small venules and capillaries of somee pathological tissues20, we investigated whether PSGL-1 is also expressed on EC.. We first evaluated with RT-PCR the presence of PSGL-1 mRNA in untreated andd TNF-a or IL-1p - treated primary HUVEC and in EC-RF24 cells. RNA from freshlyy isolated monocytes was used as a positive control. After reverse transcription andd DNA amplification, a predicted 240-bp PCR product was obtained from HUVEC (Figuree 1A) and EC-RF24 cells (data not shown) with no detectable differences betweenn stimulated and unstimulated cells. A similar PCR product was also amplified fromm monocyte RNA. As a positive control for TNF-a or IL-1p stimulation we analyzedd ICAM-1 mRNA (data not shown) which showed a dramatic increase in expressionn in response to these cytokines.

Thee expression of PSGL-1 protein in EC was also analyzed by Western blot analysis (Figuree 1B). Although the level of PSGL-1 protein in EC was much lower than in monocytes,, a protein of similar apparent molecular weight was observed in both cell types.. Flowcytometric analysis further showed that PSGL-1 is expressed on the surfacee of EC (Figure 1C). In contrast to E-selectin, there was no increase in surface levelss of PSGL-1 following activation of the EC with TNF-a (Figure 1C) or IL-1(3 (data nott shown). Different incubation times with TNF-a (10 or 30 min, 2, 6, 12 or 24 h) alsoo did not affect the level of expression of PSGL-1 (not shown). PSGL-1 expressionn levels on FMVEC were similar to the ones obtained for HUVEC (Figure

1D).. Finally, no changes in endothelial PSGL-1 expression were detected when EC fromm the first, second and third passages were compared (data not shown).

Too analyze whether PSGL-1 surface expression could be upregulated by recruitment fromm intracellular stores, as is known for P-selectin10, EC were stimulated with thrombinn or histamine for 5 or 10 min (Figure 1E). In contrast to the increase in P-selectinn expression (positive control), no difference in PSGL-1 expression was detectedd upon treatment with these stimuli. Immunofluorescent analysis of PSGL-1 (Figuree 2) on untreated and TNF-a activated HUVEC further confirmed that PSGL-1 iss expressed on the endothelial cell surface and that its expression is not altered by celll activation. In contrast, expression of VCAM-1 and E-selectin was detected only afterr endothelial activation.

ff

>

/ *> ^

*<*

1 1

M M

G G

M M

A A

A A

Jl l

1 1

Itotypee H&t:iiuhH> Histamine Tltrunlllin Thrombin controll 5 min IQ min 5 rain IS min

Figuree 1. PSGL-1 mRNA and protein are present in endothelial cells. (A) Presence of

PSGL-11 mRNA in HUVEC and monocytes. For reverse transcriptase PCR, total RNA was prepared fromm untreated HUVEC, 6 h-IL-1p-treated HUVEC and human monocytes. Gene-specific primers were usedd to amplify cDNA fragments for PSGL-1. A fragment of the same length was obtained from the differentt cells (arrow, -240 bp). The marker and the product of the reaction without reverse transcriptasee (-RT) are indicated. (B) PSGL-1 protein expression on HUVEC was determined by Westernn blot. Lysates from monocyte, purified from whole blood, or from stimulated HUVEC were analysedd and showed a protein of similar molecular weight (arrow, -120 kD). The effect of cytokine stimulationn on PSGL-1 expression on HUVEC (C) and FMVEC (D) was analysed by flowcytometry. Cellss were left untreated or were incubated with a control mouse lgG1 (control), PL-1 (PSGL-1) or CI26CI0B77 (E-selectin) FITC-labeled antibody for 45 min at 4 . Data shown are representative of 3 orr more experiments. (E) HUVEC were treated with thrombin (1 U/mL) or histamine (1 U/mL) for 5 or 100 min. Cells were incubated with a control mouse lgG1 (control antibody, empty bars), PL-1 (blocking antii PSGL-1 antibody, filled bars) or PL-2 (non-blocking anti PSGL-1 antibody, hatched bars) or with WASP12.22 (blocking anti P-selectin antibody, gray bars) and analyzed by flowcytometry. Data representt the mean SD (n=4).

EndothelialEndothelial PSGL-1 can bind P-selectin and mediate platelet adhesion to endothelium.endothelium. To determine whether PSGL-1 expressed on EC is able to bind P-selectin,, platelets were perfused over EC and adhesion was quantitated. Washed

andd labeled platelets were incubated with a control (W6/32) or a blocking P-selectin antibodyy (WASP 12.2) and perfused at high shear over untreated or TNF-a-treated (6h)) EC. Platelet adhesion was strongly increased (90 %) following activation of EC (Figuree 3). This effect was strongly inhibited when PSGL-1 on activated EC or P-selectinn on platelets was blocked with PL-1 or WASP12.2 antibodies, respectively.

Althoughh similar amounts of PSGL-1 are present on the surface of unstimulated and stimulatedd EC, apparently only stimulated cells are able to support platelet adhesion. Inn order to test whether there is an increase in PSGL-1 affinity for its receptor upon stimulation,, a P-selectin/Fc chimeric protein was allowed to bind to unstimulated and TNF-a-stimulatedd EC. Analysis by flowcytometry and immunofluorescence (Figures 4AA and 4B, respectively) showed that the P-selectin/Fc protein bound significantly moree to stimulated than to unstimulated EC. The binding of the P-selectin/Fc chimera too PSGL-1 was inhibited by a blocking antibody to PSGL-1, which underscored the specificityy of the interaction between the P-selectin/Fc chimera and PSGL-1. These resultss indicate that, despite PSGL-1 being constitutively expressed on EC, the affinityy for its receptor can be increased by cytokine stimulation of the endothelium.

Figuree 2. Immunolocalization of PSGL-1 on endothelial cells. Fixed (A) and unfixed

HUVECC (B) were treated or not with TNF-a for 6 or 18 h and PSGL-1 expression was detected by confocall microscopy. PSGL-1 was detected with PL-1 antibody (blocking antibody directed against PSGL-1)) followed by an Alexa-488-labeled goat-anti-mouse-lg antibody. In a similar way, specific antibodiess were used to detect VCAM-1 and E-selectin on HUVEC. Cells were counterstained for F-actinn with Texas Red-phalloidin, which is shown in red. PSGL-1, VCAM-1 and E-selectin are in displayedd in green, (bar: 20 urn).

EndothelialEndothelial PSGL-1 mediates the initial tethering and firm adhesion of monocytesmonocytes and PMC to endothelial cells. To investigate whether endothelial PSGL-11 is also functional in mediating monocyte and platelet-monocyte complex

(PMC)) interactions with the endothelium under flow, monocytes were perfused over HUVECC (untreated or stimulated with TNF-a for 6 h). Video recordings were analyzedd for the number of adhered monocytes and for rolling velocity (see Material andd Methods). Perfusions of monocytes or PMC over unstimulated EC resulted in veryy little monocyte adhesion (data not shown). Therefore, subsequent experiments onn the role of PSGL-1 in monocyte or PMC recruitment to endothelium were performedd with cytokine-activated EC. In the presence of relatively high levels (10-20 %)) of PMC, blocking PSGL-1 or P-selectin on monocytes or PMC significantly inhibitedd monocyte adhesion by 30 % (from 1124 132 to 790 18 cells/mm2, p < 0.05)) and strongly increased monocyte rolling velocity (Figure 5). Simultaneous inhibitionn of PSGL-1 on EC and on monocytes caused a synergistic reduction of monocytee adhesion (data not shown). To test the role of endothelial PSGL-1 in the adhesionn of monocytes in the absence of platelets, PMC were removed from the cell suspensionn by immunodepletion. As previously reported19, low levels of PMC (< 5 % PMCC in suspension) resulted in reduced monocyte adhesion to the endothelium. By blockingg PSGL-1 on EC, monocyte adhesion was further decreased 30 % (Figure 5A),, while rolling velocity was significantly increased (Figure 5B). As was shown before19,, blocking of P-selectin on the endothelium did not have an effect in cell adhesion. . 120 0 JJ 100 33 so || 60 2"" 40 c c j jj 20 — — < < 0 0

A A

A A

A A

f f

Figuree 3. Figure 3. PSGL-1 mediates platelet adhesion to TNF-a activated HUVEC.

Plateletss in suspension were labeled with calcein, washed and perfused over untreated or 6 h-TNFi-activatedd HUVEC for 5 min at 6 dyn/cm2_{. Video images of at least 60 different fields were taken per}

experiment.. For every image the number of platelets adhered was manually determined. Where indicated,, platelets were treated prior to perfusion with an antibody to P-selectin (WASP12.2). Similary,, endothelial cells were treated or not with a blocking antibody to PSGL-1 prior to perfusion. Dataa represent the mean SD (n = 4, * p < 0.05).

B B M M o o a a z z P-Selectin'Fcc (Alcxa .188) control l P-sel/Ec c P-sel/Fc c

11 '

Figuree 4. PSGL-1 affinity to P-selectin/Fc protein. Untreated or TNF-a (6 h) - stimulated

cellss were incubated with a P-selectin/Fc chimera for 20 min at 37 . Where indicated, the cells were incubatedd with a blocking antibody to PSGL-1 (PL-1). Protein binding to the endothelial cells was detectedd with a FITC-conjugated goat-anti-human-IgG antibody by flowcytometry (A) control (dotted line),, unstimulated EC (regular line) and stimulated EC (thick line)) or by immunofluorescence confocall microscopy (B). Data are shown as the representative of three experiments, (bar: 20 urn).

I60CH H

B B

Control l PL-11 WASP 12.2 Control l PL-11 WASP 12.2

Figuree 5. PSGL-1 functionality on monocyte adhesion to TNF-a activated endothelium.

PMC-richh (10-20 % PMC, filled bars) and -poor (< 5 % PMC, empty bars) monocyte suspensions weree perfused over TNF-a activated (6h) HUVEC for 5 min at 0.8 dyn/cm2. Video images were evaluatedd for the number of adherent monocytes (A) and cell rolling velocity (B). Prior to perfusion, HUVECC were incubated either with W6/32 control antibody, with PL-1 (blocking antibody to PSGL-1), orr WASP12.2 antibody (blocking antibody to P-selectin). Data represent the mean SD (n = 3 * p < 0.01). .

Too investigate whether endothelial PSGL-1 can interact with L-selectin on monocytes,, an L-selectin - blocking antibody was used on a monocyte suspension containingg < 5 % PMC. To rule out a possible contribution of remaining platelets, the monocytess were, where indicated, incubated with an antibody to P-selectin to preventt PMC formation. When the cells were incubated with the DREG 56 antibody too L-selectin, adhesion to the endothelium was inhibited by 35 % (from 683 107 to 4399 61 cells/mm2, p < 0.05), (Figure 6A). This effect was similar to that obtained by blockingg PSGL-1 on EC. Although not statistically significant, when both L-selectin on monocytess and PSGL-1 on EC were blocked, monocyte adhesion was further inhibited.. As a control we used a non-blocking antibody against PSGL-1 (PL-2) which didd not affect monocyte adhesion to the endothelium (data not shown).

T3 3 ea ea 1200 0 1000 0 800 0 600 0 400 0 200 0 0 0

X X

x x

I I

B B

Controll DREG56 PL-1 DREG56 ++ PL-1 1200 0 1000--gg 600 "S3 3 MM 400 -o o == 200 H U U 0 0 ** * * xx

X X

éé

$>

& & £

.$

$

/v:#>vvv v

&'& &'& _{é9 é9}

0* *

eyff?eyff? y

Figuree 6. PSGL-1 functionality on monocyte adhesion to TNF-a activated endothelium. A.. PMC-poor (< 5 % PMC) monocyte suspensions were pretreated with WASP12.2 anti-P-selectin

antibodyy prior to incubation with other antibodies. The monocytes were perfused over TNF-a-activated (66 h) HUVEC for 5 min at 0.8 dyn/cm2_{. Video images were analyzed for the number of adhered cells.}

Priorr to perfusion, cells were incubated with W6/32 control antibody (monocytes and endothelial cells), antii L-selectin DREG 56 antibody (monocytes) or anti PSGL-1 PL-1 antibody (endothelial cells). Data representt the mean SD (n = 3, * p < 0.05). B. PMC-poor (< 5 % PMC) monocyte suspensions were perfusedd over transfected-TNF-a-activated (6 h) HUVEC for 5 min at 0.8 dyn/cm2 _{(see RNA}

interferencee in Material and Methods section). Video images were analyzed for the number of adhered cells.. Prior to perfusion, cells were incubated with anti PSGL-1 PL-1 antibody (endothelial cells). Data representt the mean SD (n = 3, * p < 0.05).

Previouslyy it has been shown that the expression of L-Selectin ligands in endotheliall cells is modulated by sulfation 30, and that TNF-a upregulates the expressionn of two sulfotransferases implicated in the sulfation of L-Selectin ligands31. Too investigate whether the mechanism of increase in monocyte adhesion described heree is dependent on the sulfation of PSGL-1 an RNA interference approach was designed.. The genes targeted were GST-1 and - 2 , implicated in the sulfation of N-andd O-linked glycans, a-4GalT-7, involved in the initiation of the glycosaminoglycan chains,, and FX, which controls the synthesis of GDP-Fucose. Additionally, a knock-downn for PSGL-1 and a sequence without homology in the human genome were usedd as a positive and negative control, respectively. Importantly, the silencing of PSGL-11 results in a decrease in monocyte adhesion (Figure 6B) and an increase in rollingg velocity (data not shown) which are comparable to the effect of blocking with PL-11 (Figure 6B). Furthermore, the silencing of GST-1 was able to mimic the effects off silencing PSGL-1, while any of the other treatments were ineffective (Figure 6B). Together,, these data reveal an important role for endothelial PSGL-1 in monocyte andd PMC adhesion to the vascular endothelium via direct interaction with P- and L-selectinn on platelets and monocytes, respectively.

PSGL-1PSGL-1 expression in atherosclerotic coronary arteries. Sections of coronaryy arteries undergoing acute inflammation such as atherosclerosis were examinedd for PSGL-1 antigen. Expression of VCAM-1 and ICAM-1 was analysed as aa positive control and a strong staining of the vascular endothelium was observed withh the ICAM-1 and VCAM-1 MoAbs. Although to a much lower extent, the sections alsoo exhibited luminal staining with the anti PSGL-1 MoAb indicating clear PSGL-1 expressionn on the vascular endothelium of these arteries. In contrast, staining of the endotheliumm with an irrelevant mouse IgGi MoAb was not detected.

Discussion n

Thee molecular mechanisms by which leukocyte recruitment to inflamed tissues occurss have been extensively studied over the past years. The initial tethering and rollingg of monocytes along the vessel wall is generally accepted to be mediated by selectinss and their ligands that are expressed on EC, platelets and leukocytes. PSGL-1,, one of the primary selectin ligands, is known to be expressed on leukocytes andd platelets. In this study we show that functional PSGL-1 is expressed on EC upon treatmentt with proinflammatory cytokines.

Figuree 7. Immunohistochemical analysis of PSGL-1 antigen in the vascular endothelium off atherosclerotic coronary arteries. Snap-frozen sections of coronary arteries undergoing

atherosclerosiss were incubated with an irrelevant IgGi antibody or antibodies against ICAM-1, VCAM-11 or PSGL-1. Bound antibody was detected using avidin biotin peroxidase methodology (see Material andd Methods section). VCAM-1 and ICAM-1 strongly stained the endothelium of the artery. Although too a less extent, PSGL-1 staining of the endothelium as well as intravascular leukocytes was detected.

AA 240bp product was obtained by reverse transcriptase PCR with PSGL1 -specificc primers on RNA from primary EC or from an endothelial cell line. Protein expressionn was confirmed by western blot analysis of endothelial cell lysates. Flowcytometryy analysis and confocal microscopy further confirmed PSGL-1 protein expressionn on the surface of primary HUVEC and FMVEC. Surprisingly, we found thatt PSGL-1 surface expression on EC is not increased by stimulation with inflammatoryy cytokines such as TNF-a or IL-1(3. This is in marked contrast to the cytokine-inducedd upregulation of the endothelial adhesion molecules ICAM-1, VCAM-11 and E-selectin. In addition, activators such as thrombin or histamine, which inducee elevated surface expression of P-selectin on EC, had no effect on the expressionn levels of either PSGL-1 mRNA or protein. Thus, PSGL-1 is constitutively expressedd in primary EC and in immortalized endothelial cells, and is not stored in P-selectin-containingg vesicles within EC.

Endotheliall PSGL-1, at higher shear stress, was able to interact with platelets and recruitt them to the endothelium. This effect was inhibited by blocking P-selectin on plateletss or PSGL-1 on EC. The increase in affinity of endothelial PSGL-1 to P-selectinn was further demonstrated by the strong binding of a P-selectin/Fc protein to stimulatedd HUVEC, which was abrogated by incubating the cells with a blocking antibodyy to PSGL-1. Although PSGL-1 is expressed on both untreated and

cytokine-treatedd EC, platelet adhesion was only observed upon cell activation. Vachino et al. havee shown that, although most lymphocytes express PSGL-1, only 10-20% of cells aree able to bind P-selectin, which shows that the presence of PSGL-1 on the cell surfacee is not equivalent to functional relevance. PSGL-1 needs to be tyrosine sulfatedd and properly decorated with core 2 - based O-glycans expressing sialyl Lewisx333 to be functional. Differences in the number of core 2 - based O-glycans34 or inn the presence of lactosamine repeats35, as well as sulfation, fucosylation or sialylation8,, affect the recognition of PSGL-1 by the selectins. Here we show that silencingg of the sulfotransferase GST-1, and partially GST-2, mimics the effect of silencingg PSGL-1 or using the blocking antibodies PL-1 or DREG 56. Furthermore, silencingg of a4GalT-7 or FX had no effect on the adhesion of monocytes to activated EC.. Altogether, these data indicate that TNF-a-induced expression of functional PSGL-11 is dependent on the expression of GST-1, and partially GST-2, while fucosylationn or the expression of glycosaminoglycans might not be of importance. Thesee findings are in line with those of Li et al. 31, demonstrating the critical role of GST-11 and -2 in shear-resistant leukocyte rolling via L-selectin. Finally, a cytokine-inducedd increase in affinity of endothelial PSGL-1 for its receptor is also suggested byy the enhanced binding of the P-selectin/Fc chimera to EC after stimulation. This assayy reflects binding to PSGL-1, as this is the only receptor for P-selectin on the EC.. The expression of various other adhesion molecules involved in leukocyte adhesionn to stimulated endothelium might explain the observation that the inhibition off endothelial PSGL-1 never resulted in complete inhibition of monocyte adhesion. Plateletss are known to form plateletmonocyte complexes (PMC) via Pselectin -PSGL-11 interactions18'19,36. Monocyte isolation results in a monocyte suspension containingg 10-20 % PMC. PMC have been reported to support monocyte adhesion to endotheliumm by enhancing secondary tethering19. Therefore, we performed blocking studiess with anti-PSGL-1 antibody to investigate the tethering and adhesive behavior off monocytes/PMC. Our flow system enabled us to show functionality of endothelial PSGL-11 as a ligand for selectins on monocytes and platelets. When 10-20 % PMC weree present in the monocyte suspension, we found a significant reduction (30 %) in monocytee adhesive interactions with the endothelium, accompanied by an increase inn cell rolling velocity when TNF-a - stimulatedd EC were pre-incubated with a PSGL-1 -- blocking antibody.

Underr low shear conditions, platelet interactions with the endothelium are mainlyy characterized by transient tethering and rolling, whereas firm adhesion rarely occurs18,37.. However, it is important to discern whether PSGL-1 on EC interacts mainlyy with L-selectin on monocytes or might also interact with P-selectin on platelets.. To investigate this, we have removed PMCs from the monocyte suspension.. By blocking PSGL-1 on EC or L-selectin on monocytes, we were able to increasee monocyte rolling velocity and inhibit monocyte adhesion to the endothelium byy 30 %, indicating that monocyte L-selectin is a primary receptor for endothelial

PSGL-1.. Although not statistically significant, our results show that simultaneous blockingg of endothelial PSGL-1 and L-selectin on monocytes results in further inhibitionn of monocyte adhesion. This might be explained by the fact that L-selectin is knownn to bind also other ligands on the endothelium, such as CD34 and MAdCAM-11 , 4'3 0 , 3 8.. In addition, by blocking L-selectin on monocytes, cell adhesion might be affectedd not only because the interaction between L-selectin on monocytes and endotheliall PSGL-1 is inhibited but also because primary tethering of monocytes overr the endothelium is inhibited19.

Wee show that primary EC constitutively express functional PSGL-1. Our results are, too a small extent, in agreement with the immunohistochemical analysis of Laszik et al.200 in which, only sporadic PSGL-1 expression on endothelium of small venules and capillariess in some pathological tissues was described. When analyzing EC-surface expressionn of PSGL-1 by confocal microscopy we detected some antigen loss after celll fixation with paraformaldehyde. Therefore, the immunohistochemical discrepanciess observed by us might be due to the fact that we analysed snap-frozen materiall and thus prevented possible antigen loss by paraformaldehyde treatment. Inn conclusion and although expressed at low levels, PSGL-1 on activated EC is able too functionally bind P- and L-selectin on platelets and monocytes, respectively, mediatingg monocyte initial tethering and platelet recruitment to the endothelium. Our resultss strongly suggest that PSGL-1 has a crucial role in monocyte/PMC and platelett recruitment to the vascular endothelium and should be considered as an importantt participant in the onset of inflammation and/or atherosclerosis.

References s

1.. Tedder TF, Steeber DA, Chen A, Engel P. The selectins: vascular adhesion molecules. FASEB J. 1995;9:866-873. .

2.. Moore KL, Stults NL, Diaz S, et al. Identification of a specific glycoprotein ligand for P-selectin (CD62)) on myeloid cells. J Cell Biol. 1992;118:445^56.

3.. Frenette PS, Denis CV, Weiss L, et al. P-Selectin glycoprotein ligand 1 (PSGL-1) is expressed on plateletss and can mediate platelet-endothelial interactions in vivo. J Exp Med. 2000;191:1413-1422. 4.. Walcheck B, Moore KL, McEver RP, Kishimoto TK. Neutrophil-neutrophil interactions under hydrodynamicc shear stress involve L-selectin and PSGL-1. A mechanism that amplifies initial leukocytee accumulation of P-selectin in vitro. J Clin Invest. 1996;98:1081-1087.

5.. Lim YC, Snapp K, Kansas GS, Camphausen R, Ding H, Luscinskas FW. Important contributions off selectin glycoprotein ligand-1-mediated secondary capture to human monocyte adhesion to P-selectin,, E-selectin, and TNF-alpha-activated endothelium under flow in vitro. J Immunol. 1998;161:2501-2508. .

6.. McEver RP, Cummings RD. Role of PSGL-1 binding to selectins in leukocyte recruitment. J Clin Invest.. 1997;100:S97-103.

7.. Kansas GS. Selectins and their ligands: current concepts and controversies. Blood. 1996;88:3259-3287. .

8.. Vestweber D, Blanks JE. Mechanisms that regulate the function of the selectins and their ligands. Physioll Rev. 1999;79:181-213.

9.. Carlos TM, Harlan JM. Leukocyte-endothelial adhesion molecules. Blood. 1994;84:2068-2101. 10.. McEver RP, Moore KL, Cummings RD. Leukocyte trafficking mediated by selectin-carbohydrate interactions.. J Biol Chem. 1995;270:11025-11028.

11.. Lewinsohn DM, Bargatze RF, Butcher EC. Leukocyte-endothelial cell recognition: evidence of a commonn molecular mechanism shared by neutrophils, lymphocytes, and other leukocytes. J Immunol. 1987;138:4313-4321. .

12.. Tedder TF, Steeber DA, Pizcueta P. L-selectin-deficient mice have impaired leukocyte recruitment intointo inflammatory sites. J Exp Med. 1995;181:2259-2264.

13.. Ley K, Bullard DC, Arbones ML, et al. Sequential contribution of L- and P-selectin to leukocyte rollingg in vivo. J Exp Med. 1995;181:669-675.

14.. Jung U, Ramos CL, Bullard DC, Ley K. Gene-targeted mice reveal importance of L-selectin-dependentt rolling for neutrophil adhesion. Am J Physiol. 1998;274:H1785-H1791.

15.. Sperandio M, Smith ML, Forlow SB, et al. P-selectin glycoprotein ligand-1 mediates L-selectin-dependentt leukocyte rolling in venules. J Exp Med. 2003;197:1355-1363.

16.. van Zanten GH, de Graaf S, Slootweg PJ, et al. Increased platelet deposition on atherosclerotic coronaryy arteries. J Clin Invest. 1994;93:615-632.

17.. Furman Ml, Benoit SE, Barnard MR, et al. Increased platelet reactivity and circulating monocyte-platelett aggregates in patients with stable coronary artery disease. J Am Coll Cardiol. 1998;31:352-358. .

18.. Huo Y, Schober A, Follow SB, et al. Circulating activated platelets exacerbate atherosclerosis in micee deficient in apolipoprotein E. Nat Med. 2003;9:61-67.

19.. da Costa Martins P, van den Berk N, Ulfman LH, Koenderman L, Hordijk PL, Zwaginga JJ. Platelet-monocytee complexes support monocyte adhesion to endothelium by enhancing secondary tetheringg and cluster formation. Arterioscler Thromb Vase Biol. 2004;24:193-199.

20.. Laszik Z, Jansen PJ, Cummings RD, Tedder TF, McEver RP, Moore KL. P-selectin glycoprotein ligand-11 is broadly expressed in cells of myeloid, lymphoid, and dendritic lineage and in some nonhematopoieticc cells. Blood. 1996;88:3010-3021.

2 1 .. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilicall veins. Identification by morphologic and immunologic criteria. J Clin Invest. 1973;52:2745-2756. .

22.. Henrita vZ, Saelman EU, Schut-Hese KM, et al. Platelet adhesion to collagen type IV under flow conditions.. Blood. 1996;88:3862-3871.

23.. Fontijn R, Hop C, Brinkman HJ, et al. Maintenance of vascular endothelial cell-specific properties afterr immortalization with an amphotrophic replication-deficient retrovirus containing human papilloma viruss 16 E6/E7 DNA. Exp Cell Res. 1995;216:199-207.

24.. Davidson PM, Bensch K, Karasek MA. Isolation and growth of endothelial cells from the microvesselss of the newborn human foreskin in cell culture. J Invest Dermatol. 1980;75:316-321. 25.. van Hinsbergh VW, Sprengers ED, Kooistra T. Effect of thrombin on the production of plasminogenn activators and PA inhibitor-1 by human foreskin microvascular endothelial cells. Thromb Haemost.. 1987;57:148-153.

26.. Brummelkamp TR, Bernards R, Agami R. Stable suppression of tumorigenicity by virus-mediated RNAA interference. Cancer Cell. 2002.

27.. Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAss in mammalian cells. Science. 2002;296:550-553.

28.. Garcia-Vallejo JJ, het Hof B, Robben J, et al. Approach for defining endogenous reference genes inn gene expression experiments . Anal Biochem. 2004;329 :293-299.

29.. Sakariassen KS, Aarts PA, de Groot PG, Houdijk WP, Sixma JJ. A perfusion chamber developed too investigate platelet interaction in flowing blood with human vessel wall cells, their extracellular matrix,, and purified components. J Lab Clin Med. 1983;102:522-535.

30.. Rosen SD, Bertozzi CR. Two selectins converge on sulphate. Leukocyte adhesion. Curr Biol. 1996;6:261-264. .

31.. Li X, Tu L, Murphy PG, Kadono T, Steeber DA, Tedder TF. CHST1 and CHST2 sulfotransferase expressionn by vascular endothelial cells regulates shear-resistant leukocyte rolling via L-selectin. J Leukocc Biol. 2001;69:565-574.

32.. Vachino G, Chang XJ, Veldman GM, et al. P-selectin glycoprotein ligand-1 is the major counter-receptorr for P-selectin on stimulated T cells and is widely distributed in non-functional form on many lymphocyticc cells. J Biol Chem. 1995;270:21966-21974.

33.. Leppanen A, Mehta P, Ouyang YB, et al. A novel glycosulfopeptide binds to P-selectin and inhibitss leukocyte adhesion to P-selectin. J Biol Chem. 1999;274:24838-24848.

34.. Smith MJ, Smith BR, Lawrence MB, Snapp KR. Functional analysis of the combined role of the O-linkedd branching enzyme core 2 beta1-6-N-glucosaminyltransferase and dimerization of P-selectin glycoproteinn ligand-1 in rolling on P-selectin. J Biol Chem. 2004;279:21984-21991.

35.. Leppanen A, Penttila L, Renkonen O, McEver RP, Cummings RD. Glycosulfopeptides with O-glycanss containing sialylated and polyfucosylated polylactosamine bind with low affinity to P-selectin. JJ Biol Chem. 2002;277:39749-39759.

36.. Pereira A, del Valle OM, Sanz C. DDAVP enhances the ability of blood monocytes to form rosettess with activated platelets by increasing the expression of P-selectin sialylated ligands on the monocytee surface. Br J Haematol. 2003;120:814-820.

37.. Theilmeier G, Lenaerts T, Remade C, Collen D, Vermylen J, Hoylaerts MF. Circulating activated plateletss assist THP-1 monocytoid/endothelial cell interaction under shear stress. Blood. 1999;94:2725-2734. .

38.. Lasky LA. Selectin-carbohydrate interactions and the initiation of the inflammatory response. Annu RevBiochem.. 1995;64:113-139.