UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)
UvA-DARE (Digital Academic Repository)
TRPM7: Ca2+ signaling, actomyosin remodeling and metastasis
Visser, J.P.D.
Publication date
2014
Link to publication
Citation for published version (APA):
Visser, J. P. D. (2014). TRPM7: Ca 2+ signaling, actomyosin remodeling and metastasis.
Boxpress.
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.
Chapter 4
Manuscript in preparation*Contributed equally Michiel Langeslag*, Daan Visser*, Agathe Bacquin, Jeffrey Klarenbeek, Frank N. van Leeuwen and Kees Jalink
Orchestrated PLC activation controls PIP
2levels
and Ca
2+-dependent TRPM7 opening
Abstract
TRPM7 (Transient Receptor Potential subfamily Melastatin, member 7) is a non-selective divalent cation channel fused to a C-terminal alpha-kinase domain which has been implicated in various cellular processes, ranging from Mg2+ homeostasis and proliferation to cytoskeletal remodeling, migration and metastasis. TRPM7 is under control of Gαq-coupled receptors and has been demonstrated to mediate localized Ca2+ signaling. The molecular mechanisms that govern TRPM7 opening under physiological conditions and the downstream signaling pathways, however, are poorly understood and the role of phospholipase C - phosphatidylinositol(4,5)bisphosphate (PLC-PIP2) signaling has been debated. We show that activation of TRPM7 in intact cells proceeds by a novel and unique mechanism that involves sequential activation of two PLC isoforms. PLCβ3 mediates initial activation of TRPM7 through IP3-mediated release of Ca2+ from ER stores and activation of the Ca2+-sensitive isoform PLCδ
1. Channel opening then leads to Ca2+ influx which serves to prolong PLCδ1 activation and PIP2 hydrolysis and thereby keeps the channel open. Thus, TRPM7 and PLCδ1 function together to form a feedforward regulatory loop whereby sustained Ca2+ influx causes the PIP
2 hydrolysis necessary to keep TRPM7 open.
Keywords Ca2+; FRET imaging; PIP
Introduction
The recent discovery of the large and diverse family of Transient Receptor Potential (TRP) cation channels has revolutionized our understanding of Ca2+ signaling pathways in the cell. Numerous members of the TRP channel family have been implicated in all of the major sensory transduction processes (Clapham, 2003) as well as in pathological conditions ranging from cancer and hypertension to hypomagnesemia, kidney disease and mucolipidosis (Middelbeek et al., 2012; Schlingmann et al., 2002; Sun et al., 2000; Vennekens, 2011; Woudenberg-Vrenken et al., 2009; Yogi et al., 2011). Although TRP channels are activated by a diverse array of mechanisms, the phospholipase C (PLC) - phosphatidylinositol(4,5) bisphosphate (PtdIns(4,5)P2 or PIP2)signaling axis appears to be a common regulator of TRP channel gating.
Ca2+ and PIP
2 are intimately linked in cells and on TRP-family channels, these signals appear to converge. Cleavage of PIP2 by receptor-operated PLC isoforms produces the soluble messengers inositoltrisphosphate (IP3) and diacylglycerol (DAG). Whereas IP3 rapidly signals to IP3-receptors in the ER Ca2+ store to mediate Ca2+-release into the cytosol, DAG may influence ion channels either directly (Hardie, 2007) or through protein kinase C (PKC) (Soboloff et al., 2007). The concomitant drop in PIP2 levels also regulates a number of Ca2+ -permeable channels in the plasma membrane and, thereby, Ca2+ influx into the cytosol (Lukacs et al., 2013; Rohacs, 2009; Rohacs and Nilius, 2007; Suh and Hille, 2005; Yudin et al., 2011). Vice versa, Ca2+ stimulates phosphoinositide turnover via Ca2+-sensitive PLCs (Rhee, 2001) and for example also affects type II PI4-kinases (Wei et al., 2002).
TRPM7 is a member of the Melastatin subfamily of TRP channels, which conducts Ca2+ and Mg2+, associates with PLC isoforms and is regulated by PIP
2 (Langeslag et al., 2007; Runnels et al., 2002; Xie et al., 2011). The sequence of TRPM7 reveals six transmembrane domains and long cytosolic C- and N-termini that contain sites for regulation and cofactor binding. TRPM7 also houses an alpha-kinase within its C-terminus capable of phosphorylating annexin-1 (Dorovkov and Ryazanov, 2004) and myosin II isoforms (Clark et al., 2006; Clark et al., 2008a; Clark et al., 2008b). TRPM7 is ubiquitously expressed and both its overexpression and ablation can cause rapid cell death (Jin et al., 2008; Nadler et al., 2001; Penner and Fleig, 2007; Ryazanova et al., 2010; Schmitz et al., 2003). TRPM7 has been implicated in numerous physiological cell processes, including Mg2+ homeostasis (Schmitz et al., 2003), proliferation (Abed and Moreau, 2007), embryonic development (Jin et al., 2008; Jin et al., 2012; Liu et al., 2011; Ryazanova et al., 2010), mechanotransduction (Numata et al., 2007; Oancea et al., 2006; Wei et al., 2009), cytoskeletal remodeling and in migration (Chen et al., 2010; Clark et al., 2006; Middelbeek et al., 2012; Su et al., 2006; Su et al., 2011; Wei et al., 2009). It is also associated with pathological disorders such as neuronal cell death (Aarts et al., 2003; Sun et al., 2009), hypertension (Touyz, 2008), and cancer (Dhennin-Duthille et al.,
4
2011; Middelbeek et al., 2012; Rybarczyk et al., 2012). Nevertheless, much of the details ofthe underlying signaling remain unclear and the mode of gating of TRPM7 continues to be debated. While emerging evidence shows that TRPM7 is the focal point of several signaling cascades, including phosphoinositides, cAMP, reactive oxygen species and pH (Aarts et al., 2003; Chen et al., 2012; Chokshi et al., 2012; Gwanyanya et al., 2006; Kozak et al., 2005; Runnels et al., 2002; Takezawa et al., 2004; Yogi et al., 2013), we here focus on the PLC-PIP2 signaling axis.
Consistent with many other ion channels in the plasma membrane, TRPM7 requires at least a minimal level of PIP2 for it to function (Gwanyanya et al., 2006; Kim et al., 2005; Kozak et al., 2005; Langeslag et al., 2007; Macianskiene et al., 2008; Oh et al., 2012; Takezawa et al., 2004; Xie et al., 2011). However, depending on the experimental conditions, activation of PLC appears to be either inhibitory or stimulatory for TRPM7. In whole-cell patch clamp studies, Mg2+ is typically omitted from the intracellular solution to evoke large outward rectifying currents (Nadler et al., 2001) that are blocked by activation of PLCs or when PIP2 levels are lowered in other manners (Runnels et al., 2001; Runnels et al., 2002). In contrast, in intact cells at physiological [Mg2+]
i, TRPM7 currents were augmented by agonists to PLC-coupled GPCRs such as bradykinin (BK), as demonstrated by perforated-patch and Ca2+ -fluorometry experiments (Langeslag et al., 2007). Indeed, biological effects downstream of TRPM7 appear to be enhanced, rather than inhibited, by PLC-activating stimuli (Callera et al., 2009; Clark et al., 2006; Kim et al., 2005; Langeslag et al., 2007; Wei et al., 2009; Yogi et al., 2009). The activation mechanism of TRPM7 and the contribution of PLC(s) and PIP2 herein, however, has remained largely elusive. Furthermore, the effect of Ca2+ influx through the channel domain on PIP2 levels has not been determined to date.
We, therefore, set out to further study TRPM7-mediated Ca2+ signaling with a focus on regulation by the PLC-PIP2 signaling axis. Our results show that activation of PLCβ3 and the ensuing release of Ca2+ from ER stores are essential to initiate TRPM7 activation. Subsequently, Ca2+ influx through TRPM7 activates the Ca2+-sensitive isoform PLCδ
1 which is required for a sustained phase of TRPM7 opening. PLCδ1-induced PIP2 breakdown appears essential to keep the channel in the conductive state. Collectively, our experiments suggest that a feedforward loop involving Ca2+ influx, PLCδ
1 activation and PIP2 hydrolysis controls sustained TRPM7 opening.
Results
TRPM7 activation through PLCβ3.
In empty-vector control N1E-115 neuroblastoma cells (N1E-115/EV), PLC activating agonists evoke a transient Ca2+ peak that originates from intracellular stores [Fig. 1A], sometimes followed by a minor phase of Ca2+ influx that is barely resolved from the baseline. We
established stable N1E-115/TRPM7 cell lines that overexpress TRPM7 just ~3-fold over
endogenous levels (Clark et al., 2006; Langeslag et al., 2007). In these cells, the initial Ca2+ peak is followed by a marked sustained phase of elevated Ca2+ levels that lasts for a few to many minutes before returning to baseline [Fig. 1B]. This sustained phase results from Ca2+ influx through TRPM7 channels as we have extensively documented before (see Langeslag et al., 2007 in particular the appendix); for example, it is absent after knockdown of TRPM7
E PLCβ1 PLCβ3 Actin PLCβ2 PLCβ4 EV M7 A 60 s 0.2 Ca 2+ (a.u) 1.0 BK B 60 s 0.2 Ca 2+ (a.u) 1.0 BK D 60 s 0.2 Ca 2+ (a.u) 1.0 BK 2-apb C 60 s 0.2 Ca 2+ (a.u) 1.0 BK EV TRPM7 TRPM7 RNAi TRPM7 F PLCβ3 Tubulin Control PLC β3 shRNAi 60 s 20 Ca 2+ ( ∆FRET %) 0 BK PLCβ3 RNAi control RNAi
Figure 1 | PLCβ3 activation causes sustained Ca2+ influx through TRPM7. (A) In N1E-115 empty-vector
control cells, stimulation with BK evokes a single, transient increase in [Ca2+]
i, as detected by Ca2+
ratiometry (N > 500). (B) In contrast to N1E-115/EV cells (gray trace; for reference), the initial Ca2+
peak is followed by a sustained phase of Ca2+ elevation in N1E-115/TRPM7 cells (black trace) (N >
500); for detailed quantification, see (Langeslag et al., 2007). See text for further details. (C) RNAi against TRPM7 abolishes sustained Ca2+ signaling in N1E-115/TRPM7 cells (black trace). N1E-115/
TRPM7 cells, control (N=9; gray trace; for reference), peak 79.2 ± 3.4%, sustained 30.0 ± 4.2%; TRPM7 RNAi (N=6; black trace), peak 75.0 ± 3.0%, sustained 10.4 ± 6.4%. (D) 2-APB rapidly blocks TRPM7-mediated Ca2+ influx to levels below basal [Ca2+]
i (N=32). (E) Expression of GPCR-operated PLC isoforms
in N1E-115 cells. (F) Knockdown of PLCβ3 (lower panel) attenuates BK-induced Ca2+ transients and
blocks sustained Ca2+ influx in N1E-115/TRPM7 cells (gray trace). Control (N=16; black trace), peak 55.8
± 3.8%, sustained 16.5 ± 2.5%; PLCβ3 RNAi (N=9; gray trace), peak 21.6 ± 6.7%, sustained 2.3 ± 0.9%. Shown are typical examples.
4
by shRNA [Fig. 1C] or in nominally Ca2+ free medium (not shown) and it is rapidly blocked bythe TRPM7 blocker 2-aminoethyl diphenylborinate (2-APB) [Fig. 1D].
To elucidate the responsible signaling mechanism we initially focused on Gαq-coupled PLC isoforms, i.e. the PLCβ forms (Rhee, 2001). RT-PCR revealed that N1E-115 cells express PLCβ1 and predominantly PLCβ3 [Fig. 1E]. Indeed, knockdown of PLCβ3 by shRNA [Fig. 1F,
lower panel] suppressed the sustained influx of Ca2+ through TRPM7, but it also blocked the initial Ca2+ mobilization from internal stores in many experiments [Fig. 1F]. In contrast, knockdown of PLCγ1, which couples to tyrosine-kinase receptors, was without effect, in good agreement with the lack of TRPM7 activation by these receptors in N1E-115 cells (data not shown). These experiments therefore identify PLCβ3 as a critical link between Gαq and sustained Ca2+ influx via TRPM7.
PIP2 controls TRPM7 opening downstream PLCβ3.
Each of the three intracellular signals generated by PLC, namely (i) the drop in membrane PIP2 levels, and concomitant formation of (ii) membrane-delimited DAG and (iii) water-soluble IP3, is known to affect ion channel gating. PIP2 controls a variety of channels, including many TRP-family members, in a positive and negative manner (Rohacs and Nilius, 2007; Suh and Hille, 2005). DAG may influence channels either through PKC or directly (Rohacs and Nilius, 2007), whereas IP3 can gate channels directly (Dellis et al., 2006) as well as through the ensuing Ca2+ increase (Dellis et al., 2006; Rohacs and Nilius, 2007). We therefore set out to investigate the involvement of each of these branches.
Activating PKC by pretreatment with either the water-soluble DAG analog OAG or phorbol esters did neither affect basal Ca2+ levels nor influence agonist-induced TRPM7 activation, ruling out a role for DAG/PKC [Fig. 2A]. In contrast, raising intracellular IP3 by UV-induced release of an inactive precursor (“caged IP3”; Li et al., 1998) consistently evoked both an initial peak and the sustained phase in N1E-115/TRPM7 cells [Fig. 2B, left panel]. Again, administration of Ca2+ chelators such as BAPTA or the channel blocker 2-APB terminated the sustained phase (data not shown). In control N1E-115 cells, uncaging of IP3 caused transient Ca2+ release from internal stores, with no sign of sustained influx [Fig. 2B, right panel]. When the Ca2+ stores in N1E-115/TRPM7 cells were emptied by pretreatment with thapsigargin, subsequent stimulation with BK [Fig. 2C] failed to activate Ca2+ influx. Thus, IP
3 does not directly affect TRPM7 gating, butIP3-mediated Ca2+ signals suffice to trigger TRPM7 under these conditions.
To investigate to what extend an agonist-induced drop in PIP2 levels is involved, we clamped PIP2 levels by overexpressing PI(4)P 5-kinase 1α (PIPkin 1α), the major PIP2 -synthesising enzyme in these cells. This abolishes or severely blunts the agonist-induced drop in membrane PIP2 without affecting the initial Ca2+ peak (van Zeijl et al., 2007) or
Figure 2 | The contribution of second messengers downstream PLCβ3 to TRPM7-mediated Ca2+ influx. (A) Administration of the water-soluble DAG
analog OAG (left panel) or the phorbol ester PMA (right panel) neither mimic BK in activating TRPM7, nor affect the response to BK (N > 10). (B) Photorelease of caged IP3 causes sustained Ca2+ influx in N1E-115/TRPM7 cells; (N=58)
peak 2.25 ± 0.06 and sustained 1.24 ± 0.01. In contrast, in N1E-115/EV cells, very little sustained Ca2+ influx was evoked by uncaging IP
3; (N=31; trace not
shown) peak 2.21 ± 0.10, sustained 1.03 ± 0.02. *, p << 0.00001. Quantification is shown in the right panel. (C) Thapsigargin pretreatment blocks both the initial Ca2+ peak and sustained Ca2+ influx through TRPM7. Cells
were pretreated with 1 µM thapsigargin and Ca2+ signals were assayed by ratiometric imaging (N=11). (D)
PIPkin 1α overexpression does not affect BK-induced generation of IP3. IP3 generation in N1E-115/TRPM7 control cells (black trace) and PIPkin 1α overexpressing cells (gray trace) were detected using an IP3 FRET sensor. (E) Clamping PIP2 levels prevents TRPM7 activation. Overexpression of PIPkin 1α blocks the BK-induced drop in PIP2 levels (see lower panel photomicrographs). Under these conditions, BK fails to activate TRPM7 (gray trace). Cells were cotransfected with untagged PIPkin 1α and Yellow Cameleon 2.1, which served both as transfection marker and as read-out for Ca2+. N1E-115/TRPM7 control cells (N=13; black trace), peak 81 ± 5%,
sustained 36 ± 5%; PIPkin 1α overexpressing cells (N=10; gray trace), peak 72 ± 7%, sustained 11 ± 5%. Typical experiments are shown. ‘b’, basal; ‘p’, peak; ‘s’, sustained phase.
A 120 s 0.5 Ca 2+ (a.u) 1.0 BK OAG BK PMA D E C 60 s 0.5 Ca 2+ (a.u) 1.0 BK B UV (cIP3) 120 s 0.5 Ca 2+ (a.u) 1.0 TRPM7 N115 EV 1.5 2.0 2.5 1.0 Ca 2+ (a.u.) * [sustained] [peak] p s p s + PIPkin1α control 100 s 0.01 IP 3 (∆ FRET %) 1.0 BK 100 s 20 Ca 2+ (∆ FRET %) 0 + PIPkin1α control BK b s
4
BK-induced formation of IP3 [Fig. 2D]. In all cases, overexpression of PIPkin 1α completelyblocked TRPM7-mediated Ca2+ influx in N1E-115/TRPM7 cells [Fig. 2E]; n = 10. These data demonstrate first, that a drop in PIP2 levels is prerequisite for the activation of TRPM7, and second, that the production of IP3, per se, is not sufficient to cause its sustained opening. In view of the well-documented dependency of whole-cell TRPM7 currents on the presence of (at least) a low level of PIP2 at the membrane, the data also indicate that TRPM7 channel opening displays a biphasic dependency on PIP2 levels. We refer to the supplemental material for additional experiments underpinning this dual regulation.
Positive feedback controls sustained TRPM7 opening.
As TRPM7 conductance thus critically depends on PIP2 levels, we next used FRET (Fluorescence Resonance Energy Transfer) assays to study PIP2 levels in N1E-115/TRPM7 and N1E-115/EV control cells under various conditions (Langeslag et al., 2007; van der Wal et al., 2001). In the latter, agonists such as BK evoke transient PIP2 breakdown which recovers to baseline within 1-2 minutes [Fig. 3A, gray trace]. In N1E-115/TRPM7 cells, onset and peak of PIP2 hydrolysis were very similar, but a distinct prolonged recovery phase was observed [Fig.
3A, black trace; for quantification see Fig. 3C and the legend]. Thus, PIP2 hydrolysis mirrors agonist-induced Ca2+ changes.
To test whether the prolonged phase of PIP2 hydrolysis is dependent on Ca2+ influx, we repeated these experiments in nominally Ca2+-free medium. Strikingly, under these conditions the kinetics of PIP2 hydrolysis in N1E-115/TRPM7 cells reverted to control [Fig.
3B, black trace]. A similar effect was observed when TRPM7 was blocked using for example
2-APB in normal Ca2+-containing medium (data not shown). These data indicate that the sustained, but not the initial, phase of PIP2 hydrolysis is significantly influenced by Ca2+ influx. They also suggest that a remarkable feedforward regulatory loop is in place whereby Ca2+ influx through TRPM7 controls sustained PIP2 degradation, which in turn further augments TRPM7-mediated Ca2+ influx.
A characteristic feature of feedforward mechanisms is that abrogating one of the components in the chain subsequently shuts off all events in the chain. If true, then briefly interrupting Ca2+ influx should suffice to break the loop and shut down TRPM7. To test this, following recording of a baseline, TRPM7 was activated with BK and onset of the sustained Ca2+ phase was monitored [Fig. 3D, left panel]. Using a perfusion pipette the cell was next briefly pulsed with nominally Ca2+-free buffer (containing ~150 nM free Ca2+ and 1 µM BK). This resulted in an immediate drop of cytosolic Ca2+ levels [Fig. 3D, middle panel] that proceeded to values below (81 ± 1.7 %) baseline. This is in agreement with the notion
that TRPM7 contributes to the setpoint of basal Ca2+ levels in unstimulated cells (Aarts et al., 2003; Langeslag et al., 2007). As predicted, switching back to normal, Ca2+-containing medium invariably caused intracellular Ca2+ levels to return to base line, rather than to the original open channel level (n = 23). Often, pulsing cells with nominally Ca2+-free solution for just a few seconds sufficed to break the activation loop. This observation indicates that sustained Ca2+ influx is essential to keep TRPM7 in its open state.
Figure 3 | TRPM7-mediated Ca2+ influx affects kinetics of PIP
2 hydrolysis. (A) Average BK-induced transient
decrease in PIP2 levels in N1E-115/EV and N1E-115/TRPM7 cells, as detected by the FRET assay (see Materials and Methods). In N1E-115/EV cells (gray trace) FRET dropped by 79.9 ± 6.0%, peaking at 20.4 ± 1.4 s (N = 10). Recovery to within 87.5 % (t7/8) of the peak response was in 92.1 ± 11.3 s. In contrast, N1E-115/TRPM7 cells (black trace) display a distinctly prolonged phase of PIP2 hydrolysis. FRET loss was 76.3 ± 6.7% peaking at 22.4 ± 1.4 s; t7/8 was 225.8 ± 22.9 s (N = 15). (B) When assayed in nominally Ca2+ free saline (gray trace), the PIP
2 response in
N1E-115/TRPM7 cells reverts to that of maternal control cells. FRET loss is maximally 76.5 ± 9.1% at 20.7 ±1.4 s; t7/8 was 112.0 ± 11.6 s (N = 7). Black trace, response of N1E-115/TRPM7 cells in Ca2+ containing medium (as in A)
for reference. Traces shown are average responses. (C) Comparison of data shown in A and B. *, p < 0.001 (D) Ca2+ levels recorded from N1E-115/TRPM7 cells during perfusion with various solutions as indicated. Left panel,
switching to BK-containing solution evokes sustained Ca2+ elevation. Right panel, briefly switching to nominally
Ca2+-free solution aborts the sustained phase. See text for further details. Shown is a typical example of N = 23
experiments. (E) Quantification of experiments in D. *, p < 0.001 versus basal. A 30 s 20 PIP 2 (∆ FRET %) EV TRPM7 BK 0 B 30 s 20 PIP 2 (∆ FRET %) 0 TRPM7 [150 nM Ca2+] TRPM7 [1 mM Ca2+] BK C * Time (s) 0 100 200 Time-to-peak t7/8 Recovery EV TRPM7 [1 mM Ca2+] TRPM7 [150 nM Ca2+] D 60 s 0.4 Ca 2+ (a.u) 1.0 1 mM 1 mM [Ca2+] e = BK BK [Ca2+] e = 1 mM 150 nM 1.0 E * * * Ca 2+ (a.u.) 1.0 1.5 2.0 0.5 Basal Peak Sustained Recovery 150 nM Ca 2+
4
PLCδ1 couples Ca2+ influx to TRPM7 opening.
One component of the regulatory loop is still missing: an enzyme that couples Ca2+ entry to sustained PIP2 degradation. Within the PLC superfamily, several PLC subfamilies are activated by Ca2+, namely PLCδ, PLCη and PLCζ. A RT-PCR revealed that N1E-115/EV (not shown) and N1E-115/TRPM7 cells express PLCδ1, PLCδ3 and PLCη1 [Fig. 4A, upper panel]. We designed specific short-hairpin RNAs against these PLC isoforms and knockdown was verified by
semi-Figure 4 | PLCδ1 couples Ca2+ influx to sustained TRPM7 opening. (A) Endogenous expression of PLC isoforms
in N1E-115 cells. Upper panel, RT-PCR shows expression of GPCR effector PLCβ3 and Ca2+-sensitive PLCδ 1, PLCδ3
and PLCη1. Lower panels, efficacy of shRNAi vectors for PLCδ1 and PLCη1. (B) RNAi against PLCδ1 abolishes sustained Ca2+ influx in N1E-115/TRPM7 cells. Knock-down of PLCδ
1 attenuates sustained Ca2+ influx in
N1E-115 TRPM7 cells (red trace) whereas PLCη1 knockdown has no effect (gray trace) compared to untransfected controls (black trace). Lower panel shows a blow-up of the sustained phase. Right panel shows quantification at the peak and sustained phase for untransfected N1E-115/TRPM7 cells (N = 24) and for cells transfected with shRNA against PLCδ1 (N = 22) or against PLCη1 (N = 10); *, p < 0.001. Ca2+ was read out using Yellow Cameleon
which also served as transfection marker. (C) Overexpression of PLCδ1 augments BK-induced sustained Ca2+
influx through TRPM7 (green trace). N1E-115/TRPM7 cells were transiently transfected with GFP-PLCδ1 and assayed for Ca2+ by Fura-Red recording (lower panel photomicrographs). Final calibration was by ionomycin
and excess Ca2+. *, untransfected cells. Typical experiment of N = 14. (D) PLCδ
1 is enriched in invadosomes.
GFP-PLCδ1 (green) colocalizes with the actin-dense core (red) of invadosomes visualized with Alexa-568-phalloidin (see also line profiles).
PL C δ3 PL C δ1 PL C δ4 PL C η1 PL C η2 PL C β3 PL C β2 Actin 25 30 35 Control shRNAi Cycles 25 30 35 PLCδ1 PLCη1 A C GFP-PLCδ1 FuraRed * * untransfected + GFP-PLCδ1 100 s 0.4 Ca 2+ (F/F 0 ) 1.0 2-APB BK D 0.4 intensity (a.u) 30 Pixels Actin PLCδ1 1 2 Actin 1 2 PLCδ1 1 2 B Peak Sustained 0 20 40 60 * Ca 2+ ( ∆FRET%) PLCη1 RNAi PLCδ1 RNAi Control 100 s 30 Ca 2+ ( ∆FRET% ) 0 BK
quantitative PCR [Fig. 4A, lower panel; Table S1; Table S2]. Individual shRNA constructs were cotransfected in N1E-115/TRPM7 cells together with the (genetically encoded) Ca2+ sensor Yellow Cameleon. Strikingly, when cells were challenged with BK, PLCδ1 knockdown strongly suppressed sustained Ca2+ influx [Fig. 4B]. In contrast, knockdown of PLCη
1 or PLCδ3 (data not shown) did not affect the response.
If knockdown of PLCδ1 abolishes TRPM7-induced Ca2+ influx, then overexpression of the enzyme is expected to augment sustained influx in N1E-115/TRPM7 cells. Cells were transiently transfected with GFP-tagged PLCδ1 and loaded with the Ca2+ dye FuraRed. This allows simultaneous monitoring of Ca2+ kinetics in PLCδ
1 overexpressing (GFP-positive) and neighboring untransfected cells (GFP-negative) [see Fig. 4C, lower panel]. Indeed, in GFP-PLCδ1 positive cells stimulation with BK evoked a much larger sustained phase of Ca2+ influx. Again, this phase was completely blocked by buffering of Ca2+ with excess BAPTA (not shown) or by 2-APB [Fig. 4C].
The relatively high levels of Ca2+ necessary for full activation of PLCδ
1 (in the micro molar range, Allen et al., 1997) are not generally reached throughout the cytosol during normal Ca2+ signaling, but are documented to exist close to the pore of Ca2+ channels, including IP3-receptor channels (Patterson et al., 1999) and therefore, possibly, also TRPM7 channels (Wei et al., 2009). However, whereas PLCγ1 and several PLCβ isoforms were found to weakly interact with the TRPM7 kinase domain in glutathione S-transferase (GST) pulldown purification assays, there are conflicting results for the interaction with PLCδ1 (Runnels et al., 2002; Xie et al., 2011). Alternatively, we therefore studied the localization of PLCδ1 with respect to TRPM7 by confocal imaging of GFP-PLCδ1. Full-length PLCδ1 was found localized predominantly at the plasma membrane, where it is known to bind with its PIP2- and PS binding domains (Lemmon and Ferguson, 2000; Paterson et al., 1995). We also found PLCδ1 enriched in invadosomes [Fig. 4D], in a subset of N1E-115/TRPM7 cells, where we previously detected TRPM7 by immunolocalization (Clark et al., 2006 and Chapter 5). This shows that the enzyme may localize in close proximity to TRPM7 channels. Collectively, these data indicate that PLCδ1 is the Ca2+-sensitive phosphoinositidase operating within the TRPM7 regulatory loop.
Discussion
The model presented in Figure 5 holds that activation of Gαq-coupled receptors activates PLCβ3 [Fig. 1F] to generate second messengers that trigger the release of Ca2+ from internal stores [Fig. 2C]. Locally, Ca2+ levels raise high enough to activate PLCδ
1 [Fig. 3; Fig 4], which is present together with TRPM7 at the plasma membrane [Fig. 4]. In turn, PLCδ1 degrades PIP2, which we propose to be necessary for sustained TRPM7 opening [Fig. 3]. Thus, Ca2+ entering through the channels prolongs the activation of PLCδ1 and thereby, activity of
4
TRPM7, effectively constituting a positive feedback (or feedforward) loop. Interestingly, thisactivation loop is also self-limiting, that is, it contains negative feedback as well. In particular, activation limits itself because (local) near-complete depletion of PIP2 does not support TRPM7 conductance [Fig. S1], in accordance with previous reports (Langeslag et al., 2007; Macianskiene et al., 2008; Runnels et al., 2002; Xie et al., 2011).
Whereas our model describes activation and maintenance of the conductive state, it does not address termination. A feedforward regulatory loop can be terminated by
GPCR IP3 STIMULUS Extracellular space Myosin II Actin IP3R ER Ca2+ Ca2+ TRPM7 Ca2+ P PLC δ1 1 Ca2+ Ca2+ Ca2+ Ca2+ Ca2+ Ca2+ Ca2+ Ca2+ PLCβ3 Initial TRPM7 activation Sustained TRPM7 opening 2 1 PLCβ PIP2 hydrolysis 1 2 2 1 1 Cytosol ? ?
? Biological response to sustained TRPM7 opening
Figure 5 | Model of receptor-operated feedforward regulation of Ca2+ entry through TRPM7. (1)
Initial TRPM7 activation (black arrows): Following activation of PLCβ3 by Gαq-coupled receptors, PIP2 is hydrolyzed, forming IP3 (and DAG), and Ca2+ is released into the cytosol by IP
3 receptor channels
present in the ER-membrane. This causes Ca2+ levels to (locally) rise high enough to activate PLCδ
1,
which localizes in close to proximity of TRPM7 channels. The PLCδ1-mediated drop in PIP2 facilitates the opening of TRPM7 channels and subsequent Ca2+ influx. (2) Sustained TRPM7 opening (dashed
gray arrows): Ca2+ influx through TRPM7 (locally) promotes prolonged activation of PLCδ
1 and PIP2
breakdown, and thereby sustains TRPM7 opening. (?) Biological response to sustained TRPM7 opening: Continued Ca2+-influx through TRPM7 may facilitate the activation of downstream effectors
and signaling pathways: the association of the TRPM7 kinase domain with myosin II, for example (solid gray arrow), which would trigger myosin II heavy chain phosphorylation and actomyosin remodeling (Clark et al., 2006; Clark et al., 2008a; Clark et al., 2008b).
breaking it at any stage. Conceivably, termination could be by inactivation or dislocation (e.g. internalization) of TRPM7 and PLCδ1, or when PIP2 runs out. The latter would trigger a reverse-avalanche effect whereby gradual closure of TRPM7 would diminish Ca2+ influx, leading to further inactivation of PLCδ1, and so on. In line with this reasoning, we find that the sustained Ca2+ phase most often displays a relatively stable plateau phase, which returns to base line rather abruptly after a variable time span [Fig. 1] (Langeslag et al., 2007).
TRPM7 has been shown to be an essential determinant of spatially constricted Ca2+ signals (or Ca2+ sparks/flickers) that have been proposed to guide cell migration (Wei et al., 2009). Furthermore, many of the regulatory components of the actomyosin cytoskeleton bind PIP2. It is therefore tempting to speculate that the here described regulatory loop involving TRPM7 would locally modulate the actomyosin cytoskeleton, in particular since the association of its kinase domain with the myosin heavy chain is Ca2+-dependent (Clark et al., 2006; Clark et al., 2008a). In Chapter 5, we addressed this hypothesis in detail. Remarkably, in that analysis we find no evidence that TRPM7-mediated local Ca2+ sparks, or, for that matter, global Ca2+ fluxes control invadosome dynamics in N1E-115/TRPM7 cells.
We also addressed the paradoxical results that appeared in literature on PIP2 dependency of TRPM7 gating. The data described here and available in the literature (e.g. Langeslag et al., 2007; Runnels et al., 2002) indicate that moderate PIP2 breakdown such as caused by activated (endogenous) receptors, stimulates the channels and is in fact essential, as evidenced by the inhibitory effect of clamping PIP2 levels by PIP kinase 1α overexpression
[Fig. 2D & E]. On the other hand, near-complete wipe-out of the PIP2 pool, for example by rapamycin-induced recruitment of IPP to the membrane [Fig. S1], completely blocked TRPM7-mediated Ca2+ influx, in line with whole-cell patch clamp data. This indicates a biphasic dependency of the channel on PIP2. Interestingly, a similar biphasic dependency on PIP2 levels has been proposed for TRPM8 (Rohacs et al., 2005; Yudin et al., 2011) and for TRPV1 (Lukacs et al., 2007; Lukacs et al., 2013).
Dual regulation by PIP2 suggests the existence of more than one PIP2-sensing motive within the TRPM7 sequence. Interestingly, the C-terminus of TRPM7 houses several potential PIP2–interacting sites, namely the TRP domain (Rohacs et al., 2005; Xie et al., 2011), and two further polybasic stretches which we termed P1 (aa 1147-1154) and P2 (aa 1196-1218); the latter one homologous to a PIP2 binding site in TRPV1 (Prescott and Julius, 2003). Three conserved basic residues within the TRP domain (positively charged residues K1112, R1115 and K1125) that were proposed to bind PIP2 are required for proper channel activity of TRPM7, as well as in TRPM6 and TRPM8 (Rohacs et al., 2005; Xie et al., 2011). However, to obtain direct evidence of binding of PIP2 to these sites remains a challenge. We have also identified a so-called split PH domain (van Rossum et al., 2005) within the C-terminus of TRPM7 (M. Langeslag and K. Jalink, unpublished observations). This domain,
4
located between aa 1643-1658 within the kinase domain is predicted to combine with acomplementary halve present within PLCγ1 to form a complete PH domain with PIP2-binding properties. Interestingly, PLCγ1 interacts with the TRPM7 kinase-domain in GST pulldown purification assays (Runnels et al., 2002). On the other hand, in our experiments PLCγ1 knockdown did not noticeably affect TRPM7 activation in N1E-115 cells, indicating that the split PH domain or the interaction with PLCγ1 has little effect on the regulation of TRPM7. It is also conceivable that additional phosphoinositide-dependent mechanisms play a role in biphasic regulation of TRPM7. For example, ion channels may be controlled by pinch-off from- or fusion with the plasma membrane of TRPM7-containing vesicles, processes with documented PIP2/PIP3 dependency (Oancea et al., 2006; Yaradanakul et al., 2007). Finally, PIP2 sensitivity could reside in one of the many proteins that interact with TRPM7 (see Chapter 3) as was, for example, described for A-Kinase Anchoring Protein 150 and TRPV1 sensitivity to PIP2 (Jeske et al., 2011). This latter option would explain why the dual regulation was thus far not detected in whole-cell patch clamp studies, in which the channels are typically highly overexpressed and interactors may thus be lacking. Like in other TRP-family channels (Rohacs, 2009), the regulation of TRPM7 by membrane phosphoinositides thus appears highly complex and further experimentation is needed to resolve this issue. Similarly, other details of the regulatory loop described in this chapter await further study. It is, for example, not well understood how termination of Ca2+ influx is orchestrated.
In conclusion, we here described, for the first time, components of a feedforward regulatory loop that controls activation of TRPM7. We conclude that PLC isoforms and PIP2 hydrolysis are required to explain the time course of Ca2+ influx through the TRPM7 channel, and vice versa, that TRPM7 controls PLC activation and PIP2 levels. Our experiments thus provide a good starting point for further elucidation of TRPM7-mediated Ca2+ signaling in cellular processes.
Materials and methods
Materials
Ionomycin, bradykinin and thapsigargin were from Calbiochem-Novabiochem (La Jolla, CA, USA). 2-Aminoethyl diphenylborinate (2-APB), 1-Oleoyl-2-acetyl-sn-glycerol (OAG), Phorbol 12-myristate 13-acetate (PMA), wortmannin and rapamycin were from Sigma-Aldrich (St. Louis, MO, USA). Fura Red-AM, Oregon Green 488 BAPTA-AM, EDTA-AM and Phalloidin-Alexa-586 were from Invitrogen-Molecular Probes (Eugene, OR, USA). Iso-Ins(1,4,5)P3/PM (caged) was from Alexis Biochemicals (Lausen, Switzerland). Salts were from Merck (Darmstadt, Germany). Dulbecco’s MEM, fetal calf serum, penicillin and streptomycin were obtained from Gibco BRL-Invitrogen (Paisley, Scotland). FuGene HD transfection reagent was from Roche Diagnostics B.V. (Penzbreg, Germany). PLCβ antibodies were from Santa Cruz Biotechnology (Santa Cruz, USA) and the TRPM7 antibody from Alomone Labs (Jerusalem, Israel). HRP-conjugated secondary antibodies were from DAKO (Glostrup, Denmark).
Constructs
eGFP-PH(PLCδ1), eCFP-PH(PLCδ1) and eYFP-PH(PLCδ1) in pcDNA3 vectors are as previously described (van der Wal et al., 2001). GFP-PLCδ1 was a kind gift of M. Katan (The Institute of Cancer Research, London, UK). PI(4)P 5-kinase 1α was kindly provided by N. Divecha (The Paterson Institute, Manchester, UK). The IP3 FRET sensor (Probe 0 269), the membrane-targeted FRB-CFP and mRFP-FKBP-IPP domain were kindly given by T. Balla (National Institutes of Health, Bethesda, USA). Yellow Cameleon Ca2+
sensor was provided by R. Tsien (Howard Hughes Medical Institute, La Jolla, USA). Cell culture
Mouse N1E-115 neuroblastoma cells and N1E-115/TRPM7 cells were seeded on 24-mm glass-coverslips in 6-well plates (for microscopy) or in a 10-cm petridish (for biochemical assays) in DMEM supplemented with 10% FCS and antibiotics. Constructs were transfected using FuGene HD, at 1 mg DNA per well per construct or ~10 µg DNA per petridish. After 8-12 hours, the medium was refreshed.
Ca2+ imaging
For pseudo-ratiometrical Ca2+ recordings, cells on glass coverslips were incubated for 30 minutes with
Fura Red-AM (2 µg/100 µl) and Oregon Green 488 BAPTA-AM (0.5 µg/100 µl), followed by further incubation in medium for at least 15 min (Langeslag et al., 2007; Rasmussen et al., 1986). Coverslips were mounted on a Nikon inverted microscope fitted with a Biorad MRC600 scanhead (Biorad, Herts, England). Recordings were made at 37°C in HEPES-buffered saline, composed of (in mM): NaCl (140), KCl (5), MgCl2 (1), CaCl2 (2), HEPES (10) and glucose (10), pH 7.2. Excitation of Oregon Green and Fura-Red was at 488 nm and single-cell fluorescence emission was detected at 522 ± 16 nm and at >585 nm, respectively. All Ca2+ recordings were normalized by setting basal levels at 1.0. For Ca2+ uncaging
experiments, Iso-Ins(1,4,5)P3/PM (caged) (2.0 µg per 100 µl) was co-loaded with Ca2+ dyes into cells.
Uncaging of Iso-Ins(1,4,5)P3/PM (caged) was achieved by a sub-second flash of UV light (355 ± 25 nM) from a mercury arc lamp. Excitation of eGFP was at 488 nm and emission was detected at 522 ± 16 nm. Confocal imaging and deconvolution
Cells grown for 24 hours on glass coverslips were fixed for 10 minutes at room temperature in phosphate-buffered saline and 4% paraformaldehyde. Subsequently, cells were permeabilized with 0.1% triton X-100 in phosphate-buffered saline. Cells were incubated with rabbit anti-TRPM7 (1:500) followed by Alexa-488-conjugated anti-rabbit Ig (1:400) and Alexa-568-phalloidin (0.1 mg/100 ml). For actin staining in GFP-transfected cells, incubation with antibodies was omitted. The cells were mounted and placed on an inverted TCS-SP5 confocal microscope (Leica, Mannheim, Germany). For deconvolution, Z-stacks were recorded at z-intervals of 250-300 nm and deconvolved with Huygens deconvolution Software (Scientific Volume Imaging, Hilversum, the Netherlands)
Dynamic FRET essays
Cells grown on coverslips were transfected with FRET constructs (1 µg/coverslip) and experiments were performed as described previously (Ponsioen et al., 2004; van der Wal et al., 2001). In brief, coverslips were placed on an inverted Nikon microscope and excited at 425nm using an ND3 filter. CFP- and YFP emission were collected simultaneously through 470 ± 20 and 530 ± 25 nm bandpass filters. Data were acquired at 2 samples per second and FRET was expressed as ratio of CFP to YFP signals. This ratio was set to 1.0 at the onset of the experiments and changes are expressed as percent deviation from this initial value
4
RNA interference and RT-PCR
Small-hairpin RNA constructs were generated by insertion (BglII/HindIII) of oligonucleotides into the pSuper vector and verified by sequencing analysis. Target sequences are listed in Table S1. Transfections were done using FuGene HD and a mix of pSuper vectors (listed in Table S1). Target sequences for PLCβ3 were a kind gift of W. Moolenaar (the Netherlands Cancer Institute, Amsterdam). For RT-PCR, RNA was collected from cells using RNA-Bee (AMS Biotechnology, Europe) according to manufacturers’ guidelines and cDNA was obtained using Superscript RNase H- Reverse Transcriptase (Gibco-Invitrogen). A subsequent PCR was performed using oligonucleotides listed in Table S2. SDS-PAGE and immunoblotting
Cells were harvested in 1% NP40 lysis buffer, subsequently sample buffer was added and boiled for 10 min. and subjected to immunoblot analysis according to standard procedures. Filters were blocked in TBST/5% milk, incubated with primary and secondary antibodies, and visualized by enhanced chemoluminescence (Amersham Pharmacia).
Acknowledgements
We thank Dr. T. Balla (National Institutes of Health, Bethesda, USA), Dr. R. Tsien (University of California, San Diego, USA), Dr. D. Clapham (Howard Hughes Medical Institute, Boston, USA) and Dr. N. Divecha (Paterson Institute, Manchester, UK) for plasmids. We also thank members of the Dept. of Cell Biology I for discussions and critical comments on this manuscript. This work was supported by KWF grants to FNvL and KJ (KUN2007-3733 and NKI 2010-4626) and by an investment grant from NWO to KJ.
References
Aarts, M, Iihara, K, Wei, WL, Xiong, ZG, Arundine, M, Cerwinski, W, MacDonald, JF, and Tymianski, M. (2003) A key role for TRPM7 channels in anoxic neuronal death. Cell; 115 (7); 863-877.
Abed, E and Moreau, R. (2007) Importance of melastatin-like transient receptor potential 7 and cations (magnesium, calcium) in human osteoblast-like cell proliferation. Cell Prolif.; 40 (6); 849-865. Allen, V, Swigart, P, Cheung, R, Cockcroft, S, and Katan, M. (1997) Regulation of inositol lipid-specific phospholipase cdelta by changes in Ca2+ ion concentrations. Biochem.J.; 327 ( Pt 2) 545-552. Callera, GE, He, Y, Yogi, A, Montezano, AC, Paravicini, T, Yao, G, and Touyz, RM. (2009) Regulation of the novel Mg2+ transporter transient receptor potential melastatin 7 (TRPM7) cation channel by bradykinin in vascular smooth muscle cells. J.Hypertens.; 27 (1); 155-166.
Chen, HC, Su, LT, Gonzalez-Pagan, O, Overton, JD, and Runnels, LW. (2012) A key role for Mg(2+) in TRPM7’s control of ROS levels during cell stress. Biochem.J.; 445 (3); 441-448.
Chen, JP, Luan, Y, You, CX, Chen, XH, Luo, RC, and Li, R. (2010) TRPM7 regulates the migration of human nasopharyngeal carcinoma cell by mediating Ca(2+) influx. Cell Calcium; 47 (5); 425-432. Chokshi, R, Matsushita, M, and Kozak, JA. (2012) Detailed examination of Mg2+ and pH sensitivity of human TRPM7 channels. Am.J.Physiol.Cell Physiol.; 302 (7); C1004-C1011.
Clapham, DE. (2003) TRP channels as cellular sensors. Nature; 426 (6966); 517-524.
Clark, K, Langeslag, M, van Leeuwen, B, Ran, L, Ryazanov, AG, Figdor, CG, Moolenaar, WH, Jalink, K, and van Leeuwen, FN. (2006) TRPM7, a novel regulator of actomyosin contractility and cell adhesion.
EMBO J.; 25 (2); 290-301.
Clark, K, Middelbeek, J, Dorovkov, MV, Figdor, CG, Ryazanov, AG, Lasonder, E, and van Leeuwen, FN. (2008a) The alpha-kinases TRPM6 and TRPM7, but not eEF-2 kinase, phosphorylate the assembly domain of myosin IIA, IIB and IIC. FEBS Lett.; 582 (20); 2993-2997.
Clark, K, Middelbeek, J, Lasonder, E, Dulyaninova, NG, Morrice, NA, Ryazanov, AG, Bresnick, AR, Figdor, CG, and van Leeuwen, FN. (2008b) TRPM7 regulates myosin IIA filament stability and protein localization by heavy chain phosphorylation. J.Mol.Biol.; 378 (4); 790-803.
Dellis, O, Dedos, SG, Tovey, SC, Taufiq-Ur, R, Dubel, SJ, and Taylor, CW. (2006) Ca2+ entry through plasma membrane IP3 receptors. Science; 313 (5784); 229-233.
Dhennin-Duthille, I, Gautier, M, Faouzi, M, Guilbert, A, Brevet, M, Vaudry, D, Ahidouch, A, Sevestre, H, and Ouadid-Ahidouch, H. (2011) High expression of transient receptor potential channels in human breast cancer epithelial cells and tissues: correlation with pathological parameters. Cell Physiol. Biochem.; 28 (5); 813-822.
Dorovkov, MV and Ryazanov, AG. (2004) Phosphorylation of annexin I by TRPM7 channel-kinase.
J.Biol.Chem.; 279 (49); 50643-50646.
Gwanyanya, A, Sipido, KR, Vereecke, J, and Mubagwa, K. (2006) ATP and PIP2 dependence of the magnesium-inhibited, TRPM7-like cation channel in cardiac myocytes. Am J Physiol Cell Physiol; 291 (4); C627-C635.
Hardie, RC. (2007) TRP channels and lipids: from Drosophila to mammalian physiology. J Physiol; 578
(Pt 1); 9-24.
Jeske, NA, Por, ED, Belugin, S, Chaudhury, S, Berg, KA, Akopian, AN, Henry, MA, and Gomez, R. (2011) A-kinase anchoring protein 150 mediates transient receptor potential family V type 1 sensitivity to phosphatidylinositol-4,5-bisphosphate. J.Neurosci.; 31 (23); 8681-8688.
Jin, J, Desai, BN, Navarro, B, Donovan, A, Andrews, NC, and Clapham, DE. (2008) Deletion of Trpm7 disrupts embryonic development and thymopoiesis without altering Mg2+ homeostasis. Science; 322 (5902); 756-760.
Jin, J, Wu, LJ, Jun, J, Cheng, X, Xu, H, Andrews, NC, and Clapham, DE. (2012) The channel kinase, TRPM7, is required for early embryonic development. Proc.Natl.Acad.Sci.U S A; 109 (5); E225-E233. Kim, BJ, Lim, HH, Yang, DK, Jun, JY, Chang, IY, Park, CS, So, I, Stanfield, PR, and Kim, KW. (2005) Melastatin-type transient receptor potential channel 7 is required for intestinal pacemaking activity. Gastroenterology; 129 (5); 1504-1517.
Kozak, JA, Matsushita, M, Nairn, AC, and Cahalan, MD. (2005) Charge screening by internal pH and polyvalent cations as a mechanism for activation, inhibition, and rundown of TRPM7/MIC channels. J Gen Physiol; 126 (5); 499-514.
Langeslag, M, Clark, K, Moolenaar, WH, van Leeuwen, FN, and Jalink, K. (2007) Activation of TRPM7 channels by phospholipase C-coupled receptor agonists. J.Biol.Chem.; 282 (1); 232-239.
Lemmon, MA and Ferguson, KM. (2000) Signal-dependent membrane targeting by pleckstrin homology (PH) domains. Biochem.J.; 350 Pt 1 1-18.
Li, W, Llopis, J, Whitney, M, Zlokarnik, G, and Tsien, RY. (1998) Cell-permeant caged InsP3 ester shows that Ca2+ spike frequency can optimize gene expression. Nature; 392 (6679); 936-941.
4
Liu, W, Su, LT, Khadka, DK, Mezzacappa, C, Komiya, Y, Sato, A, Habas, R, and Runnels, LW. (2011) TRPM7 regulates gastrulation during vertebrate embryogenesis. Dev.Biol.; 350 (2); 348-357.
Lukacs, V, Thyagarajan, B, Varnai, P, Balla, A, Balla, T, and Rohacs, T. (2007) Dual regulation of TRPV1 by phosphoinositides. J Neurosci; 27 (26); 7070-7080.
Lukacs, V, Yudin, Y, Hammond, GR, Sharma, E, Fukami, K, and Rohacs, T. (2013) Distinctive changes in plasma membrane phosphoinositides underlie differential regulation of TRPV1 in nociceptive neurons. J.Neurosci.; 33 (28); 11451-11463.
Macianskiene, R, Gwanyanya, A, Vereecke, J, and Mubagwa, K. (2008) Inhibition of the magnesium-sensitive TRPM7-like channel in cardiac myocytes by nonhydrolysable GTP analogs: involvement of phosphoinositide metabolism. Cell Physiol Biochem; 22 (1-4); 109-118.
Middelbeek, J, Kuipers, AJ, Henneman, L, Visser, D, Eidhof, I, van Horssen, R, Wieringa, B, Canisius, SV, Zwart, W, Wessels, LF, Sweep, FC, Bult, P, Span, PN, van Leeuwen, FN, and Jalink, K. (2012) TRPM7 Is Required for Breast Tumor Cell Metastasis. Cancer Res.; 72 (16); 4250-4261.
Nadler, MJ, Hermosura, MC, Inabe, K, Perraud, AL, Zhu, Q, Stokes, AJ, Kurosaki, T, Kinet, JP, Penner, R, Scharenberg, AM, and Fleig, A. (2001) LTRPC7 is a Mg.ATP-regulated divalent cation channel required for cell viability. Nature; 411 (6837); 590-595.
Numata, T, Shimizu, T, and Okada, Y. (2007) TRPM7 is a stretch- and swelling-activated cation channel involved in volume regulation in human epithelial cells. Am.J.Physiol.Cell Physiol.; 292 (1); C460-C467. Oancea, E, Wolfe, JT, and Clapham, DE. (2006) Functional TRPM7 channels accumulate at the plasma membrane in response to fluid flow. Circ.Res.; 98 (2); 245-253.
Oh, HG, Chun, YS, Kim, Y, Youn, SH, Shin, S, Park, MK, Kim, TW, and Chung, S. (2012) Modulation of transient receptor potential melastatin related 7 channel by presenilins. Dev.Neurobiol.; 72 (6); 865-877.
Paterson, HF, Savopoulos, JW, Perisic, O, Cheung, R, Ellis, MV, Williams, RL, and Katan, M. (1995) Phospholipase C delta 1 requires a pleckstrin homology domain for interaction with the plasma membrane. Biochem.J.; 312 ( Pt 3) 661-666.
Patterson, RL, van Rossum, DB, and Gill, DL. (1999) Store-operated Ca2+ entry: evidence for a secretion-like coupling model. Cell; 98 (4); 487-499.
Penner, R and Fleig, A. (2007) The Mg2+ and Mg(2+)-nucleotide-regulated channel-kinase TRPM7.
Handb.Exp.Pharmacol.; (179); 313-328.
Ponsioen, B, Zhao, J, Riedl, J, Zwartkruis, F, van der, KG, Zaccolo, M, Moolenaar, WH, Bos, JL, and Jalink, K. (2004) Detecting cAMP-induced Epac activation by fluorescence resonance energy transfer: Epac as a novel cAMP indicator. EMBO Rep.; 5 (12); 1176-1180.
Prescott, ED and Julius, D. (2003) A modular PIP2 binding site as a determinant of capsaicin receptor sensitivity. Science; 300 (5623); 1284-1288.
Rasmussen, H, Kojima, I, Apfeldorf, W, and Barrett, P. (1986) Cellular mechanism of hormone action in the kidney: messenger function of calcium and cyclic AMP. Kidney Int.; 29 (1); 90-97.
Rhee, SG. (2001) Regulation of phosphoinositide-specific phospholipase C. Annu Rev Biochem; 70
Rohacs, T. (2009) Phosphoinositide regulation of non-canonical transient receptor potential channels.
Cell Calcium;
Rohacs, T, Lopes, CM, Michailidis, I, and Logothetis, DE. (2005) PI(4,5)P2 regulates the activation and desensitization of TRPM8 channels through the TRP domain. Nat Neurosci; 8 (5); 626-634.
Rohacs, T and Nilius, B. (2007) Regulation of transient receptor potential (TRP) channels by phosphoinositides. Pflugers Arch.; 455 (1); 157-168.
Runnels, LW, Yue, L, and Clapham, DE. (2001) TRP-PLIK, a bifunctional protein with kinase and ion channel activities. Science; 291 (5506); 1043-1047.
Runnels, LW, Yue, L, and Clapham, DE. (2002) The TRPM7 channel is inactivated by PIP(2) hydrolysis.
Nat.Cell Biol.; 4 (5); 329-336.
Ryazanova, LV, Rondon, LJ, Zierler, S, Hu, Z, Galli, J, Yamaguchi, TP, Mazur, A, Fleig, A, and Ryazanov, AG. (2010) TRPM7 is essential for Mg(2+) homeostasis in mammals. Nat.Commun.; 1
109-Rybarczyk, P, Gautier, M, Hague, F, Dhennin-Duthille, I, Chatelain, D, Kerr-Conte, J, Pattou, F, Regimbeau, JM, Sevestre, H, and Ouadid-Ahidouch, H. (2012) Transient receptor potential melastatin-related 7 channel is overexpressed in human pancreatic ductal adenocarcinomas and regulates human pancreatic cancer cell migration. Int.J.Cancer; 131 (6); E851-E861.
Schlingmann, KP, Weber, S, Peters, M, Niemann, NL, Vitzthum, H, Klingel, K, Kratz, M, Haddad, E, Ristoff, E, Dinour, D, Syrrou, M, Nielsen, S, Sassen, M, Waldegger, S, Seyberth, HW, and Konrad, M. (2002) Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat.Genet.; 31 (2); 166-170.
Schmitz, C, Perraud, AL, Johnson, CO, Inabe, K, Smith, MK, Penner, R, Kurosaki, T, Fleig, A, and Scharenberg, AM. (2003) Regulation of vertebrate cellular Mg2+ homeostasis by TRPM7. Cell; 114
(2); 191-200.
Soboloff, J, Spassova, M, Hewavitharana, T, He, LP, Luncsford, P, Xu, W, Venkatachalam, K, van Rossum, D, Patterson, RL, and Gill, DL. (2007) TRPC channels: integrators of multiple cellular signals.
Handb Exp Pharmacol; (179); 575-591.
Su, LT, Agapito, MA, Li, M, Simonson, WT, Huttenlocher, A, Habas, R, Yue, L, and Runnels, LW. (2006) TRPM7 regulates cell adhesion by controlling the calcium-dependent protease calpain. J.Biol.Chem.; 281 (16); 11260-11270.
Su, LT, Liu, W, Chen, HC, Gonzalez-Pagan, O, Habas, R, and Runnels, LW. (2011) TRPM7 regulates polarized cell movements. Biochem.J.; 434 (3); 513-521.
Suh, BC and Hille, B. (2005) Regulation of ion channels by phosphatidylinositol 4,5-bisphosphate. Curr
Opin Neurobiol; 15 (3); 370-378.
Sun, HS, Jackson, MF, Martin, LJ, Jansen, K, Teves, L, Cui, H, Kiyonaka, S, Mori, Y, Jones, M, Forder, JP, Golde, TE, Orser, BA, MacDonald, JF, and Tymianski, M. (2009) Suppression of hippocampal TRPM7 protein prevents delayed neuronal death in brain ischemia. Nat.Neurosci.; 12 (10); 1300-1307. Sun, M, Goldin, E, Stahl, S, Falardeau, JL, Kennedy, JC, Acierno, JS, Jr., Bove, C, Kaneski, CR, Nagle, J, Bromley, MC, Colman, M, Schiffmann, R, and Slaugenhaupt, SA. (2000) Mucolipidosis type IV is caused by mutations in a gene encoding a novel transient receptor potential channel. Hum.Mol. Genet.; 9 (17); 2471-2478.
4
Takezawa, R, Schmitz, C, Demeuse, P, Scharenberg, AM, Penner, R, and Fleig, A. (2004) Receptor-mediated regulation of the TRPM7 channel through its endogenous protein kinase domain. Proc.Natl. Acad.Sci.U S A; 101 (16); 6009-6014.
Touyz, RM. (2008) Transient receptor potential melastatin 6 and 7 channels, magnesium transport, and vascular biology: implications in hypertension. Am.J.Physiol.Heart Circ.Physiol.; 294 (3); H1103-H1118. van der Wal, J, Habets, R, Varnai, P, Balla, T, and Jalink, K. (2001) Monitoring agonist-induced phospholipase C activation in live cells by fluorescence resonance energy transfer. J Biol Chem; 276 (18); 15337-15344.
van Rossum, DB, Patterson, RL, Sharma, S, Barrow, RK, Kornberg, M, Gill, DL, and Snyder, SH. (2005) Phospholipase Cgamma1 controls surface expression of TRPC3 through an intermolecular PH domain. Nature; 434 (7029); 99-104.
van Zeijl, L, Ponsioen, B, Giepmans, BN, Ariaens, A, Postma, FR, Varnai, P, Balla, T, Divecha, N, Jalink, K, and Moolenaar, WH. (2007) Regulation of connexin43 gap junctional communication by phosphatidylinositol 4,5-bisphosphate. J Cell Biol; 177 (5); 881-891.
Vennekens, R. (2011) Emerging concepts for the role of TRP channels in the cardiovascular system.
J.Physiol; 589 (Pt 7); 1527-1534.
Wei, C, Wang, X, Chen, M, Ouyang, K, Song, LS, and Cheng, H. (2009) Calcium flickers steer cell migration. Nature; 457 (7231); 901-905.
Wei, YJ, Sun, HQ, Yamamoto, M, Wlodarski, P, Kunii, K, Martinez, M, Barylko, B, Albanesi, JP, and Yin, HL. (2002) Type II phosphatidylinositol 4-kinase beta is a cytosolic and peripheral membrane protein that is recruited to the plasma membrane and activated by Rac-GTP. J Biol Chem; 277 (48); 46586-46593.
Woudenberg-Vrenken, TE, Bindels, RJ, and Hoenderop, JG. (2009) The role of transient receptor potential channels in kidney disease. Nat.Rev.Nephrol.; 5 (8); 441-449.
Xie, J, Sun, B, Du, J, Yang, W, Chen, HC, Overton, JD, Runnels, LW, and Yue, L. (2011) Phosphatidylinositol 4,5-bisphosphate (PIP(2)) controls magnesium gatekeeper TRPM6 activity. Sci.Rep.; 1
146-Yaradanakul, A, Feng, S, Shen, C, Lariccia, V, Lin, MJ, Yang, J, Kang, TM, Dong, P, Yin, HL, Albanesi, JP, and Hilgemann, DW. (2007) Dual control of cardiac Na+ Ca2+ exchange by PIP(2): electrophysiological analysis of direct and indirect mechanisms. J.Physiol; 582 (Pt 3); 991-1010.
Yogi, A, Callera, GE, Antunes, TT, Tostes, RC, and Touyz, RM. (2011) Transient receptor potential melastatin 7 (TRPM7) cation channels, magnesium and the vascular system in hypertension. Circ.J.; 75 (2); 237-245.
Yogi, A, Callera, GE, O’Connor, S, Antunes, TT, Valinsky, W, Miquel, P, Montezano, AC, Perraud, AL, Schmitz, C, Shrier, A, and Touyz, RM. (2013) Aldosterone signaling through transient receptor potential melastatin 7 cation channel (TRPM7) and its alpha-kinase domain. Cell Signal.; 25 (11); 2163-2175. Yogi, A, Callera, GE, Tostes, R, and Touyz, RM. (2009) Bradykinin regulates calpain and proinflammatory signaling through TRPM7-sensitive pathways in vascular smooth muscle cells. Am J Physiol Regul Integr Comp Physiol; 296 (2); R201-R207.
Yudin, Y, Lukacs, V, Cao, C, and Rohacs, T. (2011) Decrease in phosphatidylinositol 4,5-bisphosphate levels mediates desensitization of the cold sensor TRPM8 channels. J.Physiol; 589 (Pt 24); 6007-6027.
Supplemental Material
TRPM7-mediated Ca2+ influx in intact cells: Dual regulation by PIP
2.
At first sight, the observations presented in Figures 1 and 2 would seem to conflict with the observed blockage of TRPM7 by PIP2 depletion in whole-cell patch clamp experiments (Gwanyanya et al., 2006; Langeslag et al., 2007; Macianskiene et al., 2008; Runnels et al., 2002). To further address this issue in intact cells, we employed the rapamycin-induced membrane recruitment of inositolpolyphosphate-5-phosphatase (IPP) (Suh et al., 2006; Varnai et al., 2006) to rapidly deplete the plasma membrane from PIP2 (see Fig. S1, next page). In these experiments, a membrane-bound, CFP-tagged FRB domain is coexpressed in cells with a mCherry-tagged IPP-FKBP chimera that is cytosolic and therefore inactive towards membrane PIP2. Addition of (membrane-permeable) rapamycin, which binds to FRB and FKBP simultaneously with high affinity, rapidly recruits the phosphatase to the plasma membrane to cause depletion of PIP2 by dephosphorylation at the 5’-position (Fig. S1A, middle panel photomicrographs). Indeed, administration of rapamycin during the BK-induced sustained Ca2+ phase caused influx to
rapidly decline (Fig. S1A, top panel, gray trace). In control N1E-115/TRPM7 cells expressing either one of the constructs alone, rapamycin had no effect (data not shown). TRPM7 closure was also observed when PIP2 was depleted by interfering with its resynthesis using high levels (1 µM) of Wortmannin (Suh and Hille, 2002) (Fig. S1B). Thus, in intact cells too, Ca2+ assays show that near-complete depletion
of PIP2 inhibits the channel, in agreement with the earlier mentioned whole-cell patch clamp experiments. Collectively, these data show that TRPM7 is dually regulated by membrane PIP2: whereas a drop in PIP2 levels is essential for TRPM7 activation, the near-complete depletion of this lipid blocks channel functioning altogether. Put in other words, a limited range of PIP2 levels supports TRPM7 conductance. Note that biphasic PIP2 dependency has also been found for for example TRPV1 (Lukacs et al., 2007; Lukacs et al., 2013) and TRPM8 (Rohacs et al., 2005; Yudin et al., 2011). It is interesting to note that the block of TRPM7 following near-complete PIP2 breakdown may constitute a negative feedback mechanism: when PIP2 levels drop below a critical threshold, TRPM7 closes and further PIP2 breakdown would be prevented. See next page for Fig. S1.
Supplemental Table 1 | RNA interference target sequences.
PLCη1 #1 GCAATAAGGGAAAGGTGTA #2 CTGATCCTCAAGACGTTAA PLCγ1 #1 GATCTACTACTCTGAGGAG #2 CCGGCTCTTCGTCTTCTCC TRPM7 #1 GCGCTTTCCTTATCCACTTAA #2 CAGCAGAGCCCGATATTATTT PLCδ1 #1 CCCAAGGAGGATAAGCTAA #2 GCTTGCGAAAGGCTGATAA Supplemental Table 2 | RT-PCR oligonucleotides.
PLCβ2 Fw CACAGATATGTTCCTTCCTTG Rv TGAATGAACAGGTCTTAGCTT PLCβ3 Fw TCTGACTACATCCCAGATGAC Rv TGGAACTCTCGATACTGTTTG PLCη1 Fw TCTGTCATTCTTTTGGATGAT Rv AAAAAGCAAATGACATCTGAA PLCη2 Fw AAGACAGACAGACAGCAAGAG Rv CAGACTCTTGGACTTAGCAGA PLCδ1 Fw TTGTACGTTTCATGGTAGAGG Rv TAAAGTCAACTAGGGGTAGGG PLCδ3 Fw GACTTAACCCTAACATCAGCA Rv CCTCTTGGGCTCTTCTATAAC PLCδ4 Fw ATTTCATCCTTTTCTGAGTCC Rv TCCTGCTATAATCCTTTACCA
4
A
1.0 1.2 1.4 1.6 Ca 2+ ( ∆F/F 0 ) + Rapamycin*
*
*
# [basal] [sustained] s1 s2 s3 b + IPP Control (- IPP) 90 s 0.5 Ca 2+ (F/F 0 ) 1.0 BK Rapamycin 2-APB s1 s2 s3 bB
1.0 1.2 1.4 1.6 Ca 2+ (a.u.)*
#*
*
[sustained] s1 s2 s3 b [basal] 1 µM WM Control (50 nM WM) 60 s 0.4 Ca 2+ (a.u) 1.0 BK s1 s2 s3 bSupplemental Figure 1 | Dependence of TRPM7-mediated Ca2+ influx on membrane PIP
2. (A)
TRPM7-mediated sustained Ca2+ influx is blocked upon depletion of PIP
2. Addition of rapamycin recruits
inositolpolyphosphate-5-phosphatase (IPP) to the membrane and disrupts the sustained Ca2+ phase
(gray trace, ‘s1-3’), whereas the response in a neighboring untransfected cell is unaffected (black trace). Middle panel: GFP-PH labeling of a cell before (‘b’, left) and 2 minutes after rapamycin addition (‘s2’, right) shows complete loss of membrane PIP2. Typical example of N = 34. (B) BK-induced Ca2+
responses in cells pretreated with Wortmannin. Treatment with 1 µM to inhibit PIP-4-kinase causes depletion of PIP2 within ~ 5 min (middle panel; ‘s3’, right versus ‘b’, left) and completely blocks the sustained Ca2+ phase (gray trace, ‘s1-3’). As a control, treatment with 50 nM Wortmannin, which blocks
PI 3-kinase but leaves PIP-4-kinase activity unaltered, was without effect (black trace) (N = 6 cells). Quantifications are depicted in the bar graphs in the lower panels of both A and B. * and #, p < 0.001 and p < 0.003 compared to respective basal values. ‘b’, basal; ‘s1-3’, time points during sustained phase.