The smallest region of Colicin N is capable of
inducing toxicity, altering function of the Tol-Pal
system in Escherichia coli
Kenney Gino Amirkhan Student ID : 11197188 Bachelor Biomedical Sciences University of Amsterdam Senior Supervisor : mw. dr. T. den Blaauwen Supervisor : mw. drs. J. Verheul Swammerdam Institute for Life Sciences (SILS) Final version June 12th, 2020
Introduction
Escherichia coli is one of the most studied gram-negative bacteria, it is used as a model
organism for bacterial studies and is part of our microbiome. In addition, E. coli can also be pathogenic causing infections such as infection of the urinary tract (Hirakawa et al., 2019). This type of infection can be treated with antimicrobials however, the greatest medical and global concern of this generation is the growing resistance of bacteria to antimicrobial agents. Due to the lack of therapeutic options to treat bacterial infections. The spread of bacterial resistance is caused by over-usage of antibiotic drugs in the field of medicine and agriculture (von Baum and Marre, 2005). The resistance of bacteria is caused by multiple mechanisms such as antibiotic stress and selective pressure (Durão
et al., 2018). These events causes the emerging problem of multidrug resistance in
bacteria and research is needed to provide novel approaches to combat this problem. One of these approaches is targeting the permeability of the outer membrane (OM) of gram-negative bacterial species such as E. coli. The main function of the OM is to form a physical and permeable barrier that prevents large antibiotics like vancomycin to enter the cell (Szczepaniak et al., 2020). The Tol-Pal system is an essential part in the dividing mechanism of bacteria that involves many proteins and systems occupying the cell envelope. The Tol-Pal system maintains OM integrity by correctly connecting the layers in the bacterial envelope and ensures the constriction of the OM by proper septal peptidoglycan splitting (Gerding et al., 2007; Yakhnina and Bernhardt, 2020). The Tol-Pal system consists of TolA which is located in the IM and spans across the periplasm, where it can change conformation by interaction with TolQ and TolR due to the proton
1
Abstract
The greatest medical and global concern of this generation is the growing resistance of bacteria to antimicrobial agents. An approach to combat this is targeting the permeability of the outer membrane (OM) of gram-negative bacterial species such as E. coli. The Tol-Pal system, containing the proteins Pal, TolB and TolA, ensures and maintains OM integrity in the bacterial envelope during cell constriction. Colicin N, a bacteriocin secreted by E. coli, can compete with TolB for a binding place on TolA and can hinder the OM integrity during cell constriction. This study will provide a proof of principle that the smallest region of Colicin N (ColN40-74) can efficiently compete with TolB and therefore, hinder OM integrity and increase the effectiveness of antibiotics. This study provided that ColN40-74 is capable of competing efficiently with TolB, therefore inducing a toxic effect on E. coli cells. This was obtained by creating cloning constructs of TolB and ColN with the help of molecular techniques. These constructs were then expressed in strains to establish localization patterns and functionality. At last, a plate reader experiment was performed to establish the toxicity of ColN40-74, to provide novel approaches to increase effectiveness of antibiotics to combat multidrug-resistant bacteria.
Figure 1: Schematic model during invagination of the cell envelope in
E.coli cells. TolB (green) can bind Pal-molecules (blue), mobilizes them
and repositions them near mid cell at the OM invagination. TolA (orange) can bind TolB and interrupts the binding of TolB-Pal. Pal molecules
motive force, working together as TolAQR (Szczepaniak et al., 2020). TolB is a two-domain soluble protein in the periplasm and can interact with TolA and Pal (Ridley and Lakey, 2015). Pal is a protein in the OM that binds to meso-diaminopimelate sidechains of peptides in the peptidoglycan layer (Szczepaniak et al., 2020). Previous research has stated that during cell division TolB can diffuse freely and bind Pal molecules, therefore mobilizing them by disrupting Pal connection with the peptidoglycan layer and functions as a mark for later dissociation by TolAQR. Subsequently TolB-Pal can diffuse and reposition at mid cell near membrane invagination. TolA can stretch through the periplasm with the help of TolQR to establish a binding with its C-terminal domain to the N-terminal domain of TolB and can pull it towards the IM, where TolB is recycled. This results in Pal-peptidoglycan interactions at mid-cell during cell-division (Walburger et al., 2002; Szczepaniak et al., 2020) (Fig 1). It shows that the Tol- Pal system is responsible for the connection of the OM with the peptidoglycan layer and the connection between the OM and IM (Gerding et al., 2007; Egan et al., 2018). Research has stated that the Tol-Pal system is also involved in the activity of cell-wall remodeling enzymes near the OM (Yakhina and Bernhardt, 2020). In short, accumulation of immobilized Pal-molecules ensures and stabilizes the link between the OM and the underlying cell wall in daughter cells and therefore maintains OM integrity and proper OM invagination during cell division.
Tol-Pal mutants have shown defects in the division machinery, resulting in blebbing of the OM and release of OM vesicles, due to dysregulation of the proteins involved in the Tol-Pal system (Gerding et al., 2007; Szczepaniak et al., 2020). Other research has shown that Colicin N (ColN), a bacteriocin secreted by E. coli, can penetrate the OM of competing bacteria and can compete with TolB for a binding-site on TolA (Ridley and Lakey, 2015). ColN binds with ColN-T1-90, to TolA (Y62-H66) by β-strand addition,
therefore creating an extended β-sheet. The toxic N-terminal domain of ColN prevents TolB from carrying out its function which is maintaining OM integrity (Ridley and Lakey, 2015). ColN can target OM integrity by competing with TolB and limits accumulation of Pal molecules at mid cell. This causes the OM to become more permeable for larger antibiotics like vancomycin (Szczepaniak et al., 2020). Targeting the OM integrity can possibly be applied for killing multidrug resistance E. coli by
combinatorial therapy with anti-Tol which can lower the minimum inhibitory concentration of antibiotics.
However, information about how efficient ColN can compete with TolB is still poorly understood. In this thesis the smallest region of ColN, ColN40-74, that is able to efficiently compete with TolB for binding of TolA will be determined, and to what extent this can be used to increase the effectiveness of antibiotics in E. coli. It is expected that the region of ColN that results in an efficient competition with TolB, has similar biochemical properties as the binding site of TolB with TolA. However, it is known that ColN has a higher affinity for TolA than TolB has for TolA. It is expected that this region is near W44-W46 and Y62-F66, which is essential for binding TolAIII (Ridley and Lake,
2015). This is expected because the domain has the most protein-protein interaction (Kim et al., 2014). The central question has been answered by creating sfmTq2ox -TolB20-end and mCherry-ColN40-74 constructs with an artificial signal sequence for translocation into the periplasm. These constructs were expressed in strains and analyzed by measuring growth curves and by microscopy to answer the central question in this study.
Methods
Expression of sfmTq2ox-TolB and mCherry-ColN and plasmid construction
E. coli TolB was expressed as an N-terminal sfmTq2ox fusion protein with a Glycine-Serine-Glycine)2-Serine linker separating the sfmTq2ox and amino terminus of TolB (bold)
. The tolB gene was amplified with the help of colony-PCR on LMC500 using Pfu DNA polymerase, with forward primer : 5’-GCATAGGAATTCGGTTCTGGAGGTTCTGCTGAAGTCCGCATTGTGATCG-3’ and reverse primer 5’-GCATAGAAGCTTTCACAGATACGGCGACCAGG-3’. The PCR product was restricted with HindIII/EcoRI-HF (underlined) and ligated with T4 DNA ligase, in a 3:1 (vector: insert) ratio, into pESC vector to form sfmTq2ox-TolB20-end (Fig
2A). Successful cloning was verified with a 1% Agrose gel with BamHI/EcoRV and sent
for sequencing with forward primer : 5’-GCGATCACATGGTCCTG-3’ and reverse primer : 5’-GTCTTGCGTCTTCGCCAGACTA-3’. Colicin N was expressed as an N-terminal mCherry fusion protein with a Glycine-Serine-(Glycine)2-Serine linker
separating the mCherry and amino terminus of ColN (bold). The colN gene was amplified with the help of PCR using Phusion DNA polymerase with forward primer :
5’-ATATATGAATTCGGATCTGGAGGATCTAATTCAATGGATGGTCATGGAGTAATAA GCCTCATAAAAATGATG-3’ and reverse primer 5’-TATATAAAGCTTCTAAGGCTTTGAATTATTGTCCCCATGAAATGTAATATGGTAAG
AACCATCACTGTGGAAGCCATC-3’, the primers functioned as template. PCR product was restricted with HindIII/EcoRI-HF (underlined) and ligated with T4 DNA ligase (3:1), into pSAV to form mCherry-ColN40-74 (Fig 2B). Successful cloning was verified with sequencing results with forward primer 5’-CATCTACAAGGTGAAGCTGC-3’ and reverse primer 5’-CCCAGTCTTTCGACTGAGCC-3’ (See supplementary Fig 1-6).
Growth conditions and image analysis
The made construct were transformed in strains (Supplementary Table 1) . Cells were grown overnight at 37°C in TY medium (containing bactotrypton, yeast extract, NaCl and NaOH (1M)) and supplemented with 0,5% glucose, to suppress expression, and 1:1000 antibiotic. The cells were then grown exponentially in TY to an OD of 0.4, then diluted 1:4 and induced with 15 µM IPTG. Cells were also grown at 28°C in minimal glucose medium (GB1) to steady state (containing K2HPO4, KH2PO4, (NH4)2,
MgSO4·7H2O, FeSO4·7H2O, Ca(NO3)·4H2O, thiamine and lysine) and absorbance was
measured at OD450 . Growth in GB1 obtains no variance in metabolism and no
overlapping cell cycles. The axis of the measured cells can be correlated to the age of the cells (Den Blaauwen et al., 1999; (Aarsman et al., 2005). Cells were induced with 15 µM IPTG were 1% Agarose was added to microscope slides and covered with a siliconized coverslip, were 3µl of culture and IPTG was added to image living cells. The used fluorescence microscope was Olympus BX-60 Fluorescence Microscope (Tokyo, Japan). Fluorescence filters were used to visualize fluorescence with corresponding cut-offs for RFP, GFP and CFP (See supplementary Fig 7 ) These cut-offs were used for quantification of fluorescence signals together with an estimate of absolute protein
b) a)
Figure 2 : a) pECS-DsbAss-LEGPAGL-SfmTq2ox-GSGGS,TolB20-End, SpR, ColE1 plasmid
consisting of insert TolB20-End, Turquoise fluorescence, ColE1 origin, lacIq promoter, LEGPAGL/GSGGS-linker, Lac-operon and spectomycin resistance gene b) pSAV-DsbAss-LEGPAGL-MCherry-GSGGS-ColB40-74,CamR,P15Aori consisting of insert ColN40-74, mCherry
fluorescence, P15A origin, Promotor_P_1, LEGPGL/GSGGS-linker, Lac-operon and chloramphenicol resistance gene.
synthesis rates from a study performed by Li et al., 2014 (See Supplementary Equation
1).
Experiment performed by Jolanda Verheul and analyzed with ImageJ.
Measuring OD450 and growth curves under different IPTG conditions
LMC500 and BW25113 cells were grown from an overnight culture in GB4 minimal medium (containing Ca(NO3)2·4 H2O, MgSO4·7 H2O, K2HPO4, Glucose 20% w/v,
Vitamine B1 4mg/ml, Lysine 20 mg/l with a pH of 7.0 and a 150 mOsm) at 28°C till exponential phase with an OD of 0.06-0.013. Subsequently diluted in a ratio of 1:5 till the cells had the same OD. Cells were grown in the presence of 5-20µM IPTG, to induce plasmid expression. The cell cultures were transferred into a 96 wells plate and the OD was measured at 450 nm for 20 hours at 30°C. Afterwards the plate was stored and measurements were continued for another 20 hours under the same conditions and protocol. The endpoint fluorescence was measured with an excitation of 560nm and emission of 630nm at 22.9°C to measure fluorescence from mCherry-ColN40-74 plasmid. Experiment performed by Jolanda Verheul.
Results
sfmTq2ox-TolB20-end localization in LMC500 cells
In order to investigate whether the construct sfmTq2ox-TolB20-end localizes in the
presence of TolA, the construct was expressed in LMC500 (Fig 3).
5
Figure 3: sfmTq2ox-TolB20-end expressed in LMC500 and grown in TY. A) First image on the left is a fluorescence image with GFP
filter, image with CFP filter, phase-contrast image and last a co-localization image with filters CFP and GFP. B) Sorted map of the cells axis, right GFP channel, CFP channel and last the phase-contrast channel. Scale bar has a length of 5µm.
Fluorescence at mid cell in both the CFP and GFP channel can be observed in figure three. However, from the sorted map only a clear localization pattern can be observed in the CFP channel. To investigate whether the construct sfmTq2ox-TolB localizes in the
presence of TolA-GFP, the construct was expressed in LMC500 Mut2GFP-TolA (Fig 4).
From figure four can be observed that there is fluorescence signal at mid cell in both the GFP- and CFP-channel. In the sorted maps there is a clear localization pattern at mid-cell for both channels. The morphology of the cells were analyzed by plotting the volume of the cells (see Supplementary Fig 9). There was no difference between the morphology. Fluorescence intensity between the LMC500 cells were analyzed and quantified (see
Supplementary Fig 8). This showed that there is less GFP than what is shown in the
GFP channel and could be due to sfmTq2ox fluorescence signal in the GFP channel. To establish co-localizations between TolA and TolB an strain was used with mKO, Red Cherry bound to TolA that expressed sfmTq2ox-TolB20-end (See Supplementary Fig 10). Localization pattern is observed for sfmTq2ox-TolB20-end at mid cell and not for
mKO-TolA.
sfmTq2ox-TolB20-end localization in BW25113 cells
In order to investigate whether construct sfmTq2ox-TolB20-end localizes in BW25115
Figure 4: sfmTq2ox-TolB20-end expressed in LMC500 Mut2GFP-TolA and grown in TY. A) First image on the left is a fluorescence
image with GFP filter, image with CFP filter, phase-contrast image and last on the right is a co-localization image with filters CFP and GFP. B) Sorted map of the cells axis with on the right GFP channel, CFP channel and last the phase-contrast channel. Scale bar has a length of 5µm.
strains. sfmTq2ox-TolB20 was first expressed in BW25113 to see if in this particular strain
the constructs localizes (Fig 5).
From figure five can be observed that the construct localizes at mid cell in the presence of TolA. From the sorted maps can be observed that the localization of the construct becomes more visible when the cells take on a longer axis. To see whether the construct localizes in the absence of TolA, sfmTq2ox-TolB was expressed in BW25113 ∆TolA (Fig 6). From image six can be observed that there is localization of the construct near mid cell. However, localization patterns other than mid cell can be observed. This is because the cells show a chaining phenotype and therefore show mid cell localization at more sites. BW25113 ∆TolA cells have a longer morphology due to the wrong formation of the septum, which results in ‘ballooning’ of cells (Szcepaniak et al., 2020) . Also small cells can be observed that resemble the chaining phenotype. This can be due to the absence of TolA which was also observed in BW25113 ∆TolA strain. At last, sfmTq2ox-TolB20-end was expressed in BW25113 ∆TolB to establish localization
in the absence of TolB (Fig 7).
7
Figure 5 : sfmTq2ox-TolB20-end expressed in BW25113 and
grown in TY. A) First on the left is a fluorescence image with
CFP filter and on the right phase-contrast image B) Sorted map of the cells axis with on the left CFP channel and right the phase-contrast channel. Scale bar has a length of 5µm.
Figure 6: sfmTq2ox-TolB20-end expressed in BW25113 ∆TolA
and grown in TY. A) First on the left is a fluorescence image
with CFP filter and on the right phase-contrast image B) Sorted map of the cells axis with on the right CFP channel and right the phase-contrast channel. Scale bar has a length of 5µm.
From figure seven can be observed that the construct localizes at mid cell more specific in comparison with the BW25113 and BW25113 ∆TolA cells. The fluorescence concentration of the cells were quantified and the volume of the cells were plotted (See
supplementary Fig 11-12).
This showed that ∆TolB morphology is restored when sfmTq2ox-TolB20-end is expressed and indicates restoration of deleted tolB function. The ∆TolA cells show less fluorescence concentration at mid cell which could indicate a better localization of TolB construct in BW251113 ∆TolB cells.
mCherry-ColN40-74 localization in LMC500 cells
To investigate whether ColN localizes, mCherry-ColN40-74 was expressed in LMC500 (See Supplementary Fig 13). Due to background fluorescence and noise in RFP channel a second sample was prepared (Fig 8).
Figure 7: sfmTq2ox-TolB20-end expressed in BW25113 ∆TolB and
grown in TY. A) First on the left is a fluorescence image with CFP
filter and on the right phase-contrast image B) Sorted map of the cells axis with on the right CFP channel and left the phase-contrast channel. Scale bar has a length of 5µm.
This sample shows localization of ColN in the periplasm. However, judging from the sorted maps no clear localization pattern can be observed. This sample showed long cells with chaining phenotype and formation of inclusion bodies. To investigate whether the seen phenotype is caused by growth in TY medium, LMC500 cells expressing mCherry-ColN40-74 were grown in GB1 medium (Fig 9).
LMC500 cells grown in GB1 shows no noise in the RFP channel. The construct is localizing and fluorescence intensity is seen in the cell poles and periplasm. When mid cell fluorescence is plotted against the axis a decrease in fluorescence intensity can be observed and shows that a sub population is expressing the construct.
9
Figure 8 : mCherry-ColN40-74 expressed in LMC500 cells grown in TY. A) First image on the left is a phase contrast and on the right
image with RFP filter B) Sorted map of the cells axis with on the left phase contrast and right the RFP channel. Scale bar has a length of 5µm.
Figure 9: mCherry-ColN40-74 expressed in LMC500 cells grown in GB1. A) First on the left is a
fluorescence image with RFP filter and on the right phase-contrast image B) Sorted map of the cells axis with on the left RFP channel and right phase-contrast channel. C) The fluorescence measured at the center of the cells plotted against the axis. Scale bar has a length of 5µm.
In order to investigate whether construct, mCherry-ColN40-74, localizes in the presence of Mut2GFP-TolA, mCherry-ColN40-74 was expressed in LMC500 Mut2GFP-TolA (Fig
10).
Expression in LMC500 Mut2GFP shows that there is a localization pattern of ColN in the periplasm. Co-localization with GFP-TolA could not be observed. Cells had normal morphology but cells showed a higher volume when the cells expressed the construct (See supplementary Fig 14). Quantification of fluorescence signals of LMC500 cells expressing mCherry-ColN40-74, showed that mCherry fluorescence is higher than GFP signal (See supplementary Fig 15).
mCherry-ColN40-74 localization in BW25113 cells
Due to ColN competing with TolB for a binding place on TolA, it is of great importance to see the localization pattern when TolB and TolA are absent. mCherry-ColN40-74 was first expressed in BW25113 cells (Fig 11).
Figure 10: mCherry-ColN40-74 expressed in LMC500 Mut2GFP-TolA grown in TY. A) First on the left is the
phase contrast image, fluorescence image with RFP filter, image with GFP filter and last on the right is a co-localization image with filters RFP and GFP. B) Sorted map of the cells axis with on the left the phase contrast channel, RFP channel and last GFP channel. Scale bar has a length of 5µm.
From figure 11 can be observed that the construct localizes at the cell membrane poles and not at mid cell. There were cells that had normal morphology and cells that where forked shaped.
To determine whether the construct also localizes in absence of TolA, mCherry-ColN40-74 was expressed in BW25113 ∆TolA (Fig 12).
11
Figure 11: mCherry-ColN40-74 expressed in BW25113 grown in TY. A) First on the left is phase contrast image
and image on the right is with RFP filter B) Sorted map of the cells axis of analyzed cells with on the left phase contrast channel and right RFP channel. Scale bar has a length of 5µm.
Figure 12: mCherry-ColN40-74 expressed in BW25113 ∆TolA grown in TY. A) First on the left is a phase contrast image right
RFP fluorescence image. B) Sorted map of the cells axis with on the right phase contrast channel and on the left for the RFP channel . Scale bar has a length of 5µm.
BW25113 ∆TolA cells show in both samples a morphology of long chaining cells. The RFP channel shows signal over the whole volume of the cells with some bright fluorescence spots near the membrane. Localization of the construct was observed near mid cell, which can be seen in sample 1. No clear localization pattern can be observed
from the sorted maps.
At last, mCherry-ColN40-74 cells were expressed in BW25113 ∆TolB cells. To see whether the construct localizes in the absence of TolB (Fig 13).
BW25113 ∆TolB cells that express mCherry-ColN40-74 are either small or show a chaining phenotype, where inclusion bodies are formed. In both samples the fluorescence intensity was vague, therefore localization could not be observed.
ColN40-74 toxicity determination by measuring OD450 under different IPTG conditions
To investigate whether ColN40-74 is toxic in cells a plate reader experiment is performed under different conditions of IPTG. The OD450 is measured which results in
growth curves that could indicate whether mCherry-ColN40-74 is toxic (Fig 14).
Figure 13: mCherry-ColN40-74 expressed in BW25113 ∆TolB grown in TY. A) First on the left is phase contrast image with on
the right the fluorescence image with RFP filter. B) Sorted map of the cells axis, left phase contrast channel and on the right RFP channel. Scale bar has a length of 5µm
13
Figure 14: Plate reader at OD450 of cells grown in GB4 medium under different IPTG conditions. Plate reader
experiment shows growth curves under different conditions and different strains. Rows are indicated with type of strains and columns show the amount of IPTG used in this experiment. With positive control (LMC500 cells) and negative control (GB4). Absorbance was measured for 2h at 450 nm. Top plate reader layout represent t=0 till t=20h and bottom plate reader layout represents t=20h till t=40h.
The positive and negative control showed growth and no growth respectively. Incubation of LMC500 that expressed dsbA-mCherry showed growth, indicating that the toxicity is not caused by the mCherry fluorescence protein. Both samples of LMC500 cells that express mCherry-ColN40-74 show no growth with an exception of the third replicate with 10 µM IPTG and the first replicate with 15µM IPTG in the first 20 hours, in the second 20 hours a growth curve could be observed in the majority of the replicates. To see whether the construct was degraded a SDS PAGE was performed (See
Supplementary Fig 16). All samples showed signs of degradation, where the first
sample of LMC500 cells expressing the construct showed full degradation. BW25113 cells expressing the construct show normal growth , however when tolA and tolB is deleted in the same strain, no growth could be observed in the first 20 hours. In the second 20 hours a small growth curve can be observed in the replicates. Indicating that the construct hinders growth of cells.
In order to investigate how much mCherry-ColN40-74 is presence in the plate reader experiment at endpoint, fluorescence was measured (See Supplementary Fig 17). Measuring fluorescence showed that almost no fluorescence was measured in the first sample of LMC500 cells that express mCherry-ColN40-74. In addition, the fluorescence increased as the amount of IPTG was supplemented in other samples.
Discussion
TolB localizes at mid cell in the presence of TolA and TolA-GFP and in the absence of wild-type TolB and TolA. However, localization was less specific in the strain where
tolA was deleted in comparison with the strain where tolB was deleted. This indicates
that the TolB construct has a higher affinity for TolA than wild-type TolB. Transformation of the TolB construct to a deleted tolB strain showed restoration of normal morphology, indicating that the construct is functional. In contrast, the localization pattern of ColN was not specific. Transformation of the construct showed localization in the periplasm, membrane or no localization due background noise. These transformations indicated toxicity therefore, the toxicity was tested and showed that the smallest region of Colicin N is capable of inducing toxicity in LMC500 cells and made clear in BW25113 cells that dysregulating the Tol-Pal system has a more toxic affect than deleting the Tol-Pal system in E. coli cells. In conclusion, the smallest region of ColN can induce toxicity, therefore providing evidence that altering function of the Tol-Pal system by ColN has an more toxic effect than deleting the Tol-Pal system and can be applied to increase effectiveness of antibiotics in E.coli.
Initially, the objective of this study was to research whether the smallest region of ColN was able to efficiently compete with TolB with an competition essay. However, during this study ColN showed toxicity by changing morphology of cells and toxicity was later
established with a plate reader experiment. The mechanism of the Tol-Pal complex is based on protein-protein interaction, where ColN N-terminal domain interacts with Tol proteins which results in a tol phenotype (Bouveret et al., 2002). In order to hinder function of TolB, ColN needs to bind TolA (Ridley and Lakey, 2015). Therefore, it is plausible to assume that the smallest region of ColN is able to compete efficiently with TolB. Next research can elaborate more on the competition between ColN and TolB by performing a transformation of both fluorescence fusion proteins, to see whether there is difference in localization or by performing a plate reader experiment where the fluorescence is measured.
No experiment was performed to see whether ColN can increase effectiveness of antibiotics. However, this study provided that ColN could induce toxicity resulting in cells that show chaining phenotypes. These findings are in accordance with the phenotypes of cells where proteins of the Tol-Pal system were deleted and showed an even more toxic effect when ColN is expressed. These studies have stated that deletions in Tol-Pal system results in hypersensitivity to detergents and large antibiotics (Onodera
et al., 1970; Casales et al., 2002; Bouveret et al., 2002; Yakhina et al., 2020) and deleting
genes in the Tol-Pal system is comparable with deletion of a multidrug efflux transporter, responsible for drug resistance in E. coli (Kowata et al., 2016). Therefore, it is plausible to mind that ColN can increase the hypersensitive of detergents and next research can elaborate further on this subject. Phenotypes caused by deletion of Tol-Pal proteins can be observed due to activating two main cell envelope stress response pathways Rcs and σE (Szczepaniak et al., 2020). These pathway senses lateral interaction between LPS molecules and modulates gene expression for adaption and modification, upregulate capsule productionand increases kinase activity and downregulates tolQRA expression (Clavel et al., 1996; Knonovalova et al., 2016; Wall et al., 2018). This results in alternation of OM integrity and OM proteins (Storek et al., 2019). With this in mind, ColN could trigger these stress response pathways and hence cause toxicity within the cells.
With fluorescence fusion proteins there is a change of obtaining a dysfunctional
protein or induction of toxicity, which can influence biological systems within the cell (Jost and Walters, 2019). In addition, fluorescence fusion proteins expressed on a plasmid is done in cells that already express the endogenous protein therefore, overexpression and ectopically expression can originate (Schnell et al., 2012; Stadler et
al., 2013). Therefore immunolabeling and validation of the specificity of the used
antibody is performed in order to analyze functionality of the fusion protein and localization patterns (See Supplementary Fig 18). This analyzation have shown overlapping localization patterns and morphology of cells along with the found results that the TolB construct restored normal morphology. Therefore the TolB construct is functional and can resemble in vivo situation. Due to ColN and TolB having different
protein lengths and hence different rates of translation, expression of fusion proteins can give erroneous analyzation caused by overexpression. Therefore quantification of fluorescence signal is of great importance and is applied in this study with the help of data generated by Li et al., 2014. Another approach to avoid erroneous analyzation, is chromosomal replacement of the original gene by fusion. This is often a complicated task to succeed however, plasmid expression of the fusion protein with validation steps is a more efficient approach. The used plasmids could have different promotors that would even out the translation rate of the two proteins of interest however, quantification of fluorescence signal and supplementing different concentrations of IPTG is sufficient enough to justify the procedure done in this study. However, these novel solutions can yield a fairer competition between ColN and TolB and can be elaborated further on in future research.
Previous research have shown that Tol-Pal mutants have shown defects in the division machinery, resulting in blebbing of the OM and release of OM vesicles (Gerding et al., 2007; Szcepaniak et al., 2020). These findings are in accordance with this study, where the same phenotype was observed in Tol-Pal mutants. In addition, this study provides an more toxic effect which is induced by expression of the smallest region of ColN changing morphology of cells and in some cases alters cells growth due to improper regulation during constriction. ColN can therefore potentially be used to make multi-drug resistant bacteria more sensitive for detergents and large antibiotics. This provides an novel approach in combating the generation of multidrug resistance bacteria by targeting the Tol-Pal system which ensures and maintains OM integrity. Next research can focus on establishing the toxic effect of ColN, where the sequence of ColN can be chemically modified and used as a supplement to potentially kill bacteria. This study provided evidence that ColN can induce toxicity and therefore reducing function of the Tol-Pal system. This indicates that ColN can compete efficiently with TolB for binding of TolA, which can be used to target OM integrity and provided novel approach to increase the effectiveness of antibiotics in combating multi-drug resistance bacteria.
References
1. Aarsman, M., E., G., Piette, A., Fraipont, C., Vinkenvleugel, T., M., F.,
Nguyen-Distèche, M., & den Blaauwen, T., (2005). Maturation of the Escherichia coli divi-some occurs in two steps. Molecular Biology 55(6), 1631-1645 doi: 10.1111/j.1365-2958.2005.04502.x
2. von Baum, H., & Marre, R., (2005). Antimicrobial resistance of Escherichia coli
and therapeutic implications. International Journal of Medical Microb iology 295 503-511 doi:10.1016/j.ijmm.2005.07.002.
3. Bouveret, E., Journet, L., Walburger, A., Cascales, E., Bénédetti, H., & Lloubès, R.,
(2002). Analysis of the Escherichia coli Tol-Pal and TonB systems by periplasmic production of TOl, TonB, colicin, or phage capsid soluble domains. Biochimie (84) 5-6 413-421 doi:10.1016/S0300-9084(02)01423-2
4. den Blaauwen, T., Buddelmeijer, N., & Aarsman, M., E., G., (1999). Timing of FtsZ
Assembly in Escherichia coli. Journal of Bacteriology 181(17) 5167-5175
5. Casales, E., Gavioli, M., Sturgis, J., & N., Lloubès, R., (2002). Proton motive force
drives the interaction of the inner membrane TolA and outermembrane Pal pro-teins in Escherichia coli. Molecular Microbiology (38) 4 904-915 doi: 10.1046/j.1365-2958.2000.02190.x
6. Clavel, T., Lazzaroni, J., C., Vianney, A., & Portalier, R., (1996). Expression of the
tolQRA genes of Escherichia coli K-12 is controlled by the RcsC sensor protein involved in capsule synthesis. Molecular microbiology 19(1) doi:10.1046/j.1365-2958.1996.343880.x
7. Durão, P., Balbontín, R., & Gordo, I., (2018). Evolutionary Mechanisms Shaping
the Maintenance of Antibiotic Resistance. Trends in Microbiology 26 8 677-691 doi:10.1016/j.tim.2018.01.005
8. Egan, A., J., F., (2018) Bacterial Outer membrane constriction. Molecular microbiology 107(6) 676-687 doi:10.111/mmi.13908
9. Hirakawa, H., Suzue, K., Kurabayashi, K., & Tomita, H., (2019). The Tol-Pal
System of Uropathogenic Escherichia coli is Responsible for Optimal Internalization Into and Aggregation Within Bladder Epithelial Ce. Frontiers in
microbiology lls, Colonization of the Urinary Tract of Mice and Bacterial Motility
10;1827 doi:10.3389/fmicb/2019.01827
10. Gerding, M., A., Ogata, Y., Pecora, N., D., Niki, H., & de Boer, P., A., J., (2007). The
Trans-envelope Tol-Pal complex is part of the cell division machinery and required for proper outer-membrane invagination during cell constriction in
E.coli. Molecular Biology 63(4) 1008-1025 doi:10.1111/j.1365-2958-2006-05571.x 11. Jost, A., P., T., & Walters, J., C., (2019). Designing a rigorous microscopy
experi-ment : validating methods and avoiding bias. Journal of Cell Biology 218(5) 1452-1466 doi:10.1083/jcb.201812109
12. Kim, Y., C., Tarr, A., W., & Penfold, C., N., (2014). Colicin import into E.coli cells:
A model system for insights into the import mechanisms of bacteriocins.
Biochimica et Biophysica Acta (BBA) – Molecular Cell Research 1843(8) 1717-1731
doi:10.1016/j.bbamcr.2014.04.010
13. Konovalova, A., Mitchell A., M., & Silhavy T., J., (2016). A lipoprotein/beta-barrel
complex monitors lipopolysaccharide integrity transducing information across the outer membrane. eLife 5 1-17 doi: 10.7554/eLife.15276
14. Kowata, H., Tochigi, S., Kusano, T., & Kojima, S., (2016). Quantitative
Measurement of the Outer Membrane Permeability in Escherichia Coli Lpp and
Tol-Pal mutants defines the Significance of Tol-Pal Function for Maintaining Drug Resistance. The Journal of Antibiotics 69(12) 863-870 doi:10.1038/ja.2016.50.
15. Li, G., W., Burkhardt, D., Gross, C., & Weissman, J., S., (2014). Quantifying
absolute protein synthesis rates reveals principles underling allocation of cellular resources. Cell, 157(3), 624-635 doi:10.1016/j.cell2014.02.033
16. Onodera, K., Rolfe, B., & Bernstein, A., (1970). Demonstration of missing
membrane proteins in deletion mutatns of E. coli K12. Biochem Bipphys Res
commun 39(5) 969-975 doi:10.1016/0006-291x(70)90419-5
17. Pugsley, A., P., & Schnaitman, C., A., (1978). Identification of Three Genes
Controlling Production of New Outer Membrane Pore Proteins in Escherichia Coli K-12. Journal of Bacteriology 135 (3) 1118-1129 doi: 0021-9193/78/0135-1118802.00/0
18. Ridley, H., & Lakey, J., H., (2015). Antibacterial toxin colicin N and phage protein
G3p compete with TolB for a binding site on TolA. Microbiology 161 503-515 doi:10.1099/mic.0.000024
19. Schnell, U., Dijk, F., Sjollema, K., A., & Giepmans, B., N., G., (2012).
Immunolabeling artifacts and the need for live-cell imaging. Nature methods 9(2) 152-159 doi: 10.1038/NMETH.1855
20. Stadler, C., Rexhepaj, E., Singan, V., R., Murphy, R., F., Pepperkok, R., Uhlén, M.,
Simpson, J., C., et al., (2013). Immunofluorescence and fluorescent-protein tagging show high correlation for protein localization in mammalian cells. Nature methods 10(4) 3-15-326 doi:10.1038/NMETH.2377
21. Storek, K., M., Vij, R., Sun, D., Smith, P., A., Koerber, J., T., & Rutherford, S., T.,
(2019). The Escherichia coli beta-Barrel Assembly Machinery is Sensitized to Pertubation under High Membrane fluidity Journal of Bacteriology 201 (1) doi: 10.1128/JB.00517-18
22. Szczepaniak, J., Holmes, P., Rajasekar, K., Kaminska, R., Samsudin, F., Inns, P.,
G., Rassam, P., et al., (2020). The lipoprotein Pal stabilizes the bacterial outer membrane during constriction by a mobilization-and-capture mechanism. Nature
Communications 11(1):1305 doi: 10.1038/s41467-020-15083-5
23. Szczepaniak, J., Press, C., & Kleanthous, C., (2020). The multifarious roles of
Tol-Pal in Gram-negative bacteria. FEMS Microbiology Reviews Accepted Manuscript doi:10.1093/femsre/fuaa018
24. Walburger, A., Lazdunski, C., & Corda, Y., (2002). The Tol/Pal System Function
Recquires an Interaction Between the C-terminal Domain of TolA and the N-terminal Domain of TolB. Molecular Microbiology 44:3 695-708 doi:10.1046/j.1365-2958.2002.02895.x
25. Wall, E., Majdalani, N., & Gottesman, S., (2018). The Complex Rcs Regulatory
Cascade. Annual review of microbiology 72 111-139 doi: 10.1146/annurev-micro-090817-062640
26. Yakhnina, A., A., & Bernhardt, T., G., (2020). The Tol-Pal system is required for
peptidoglycan cleaving enzymes to complete bacterial cell division. Proceedings of
the National Academy of Sciences of the United States of America 117(12) 6777-6783
doi:10.1073/pnas/1919267117
