Immunotolerance during bacterial pneumonia and sepsis

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Hoogerwerf, J.J.

Publication date

2010

Link to publication

Citation for published version (APA):

Hoogerwerf, J. J. (2010). Immunotolerance during bacterial pneumonia and sepsis.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

(2)

55

4

Priming of alveolar macrophages upon

instillation of lipopolysaccharide in the

human lung

JJ Hoogerwerf, AF de Vos, C van ’t Veer, P Bresser, A de Boer, MWT Tanck, C Draing, JS van der Zee, T van der Poll

Am J Respir Cell Mol Biol 2010;42:349-356

C

h

a

p

t

e

r

(3)

56

⏐

Chapter 4

Abstract

The airways are continuously exposed to respiratory pathogens, which may result in bacterial pneumonia, one of the most common infectious diseases and the leading cause of sepsis. Considering that recurrent exposure to microbial products can lead to tolerance of immune cells and that this might contribute to the susceptibility to nosocomial infection, we investigated the effect of in vivo lipopolysaccharide (LPS) instillation on the responsiveness of alveolar macrophages. In eight healthy humans sterile saline was instilled into a lung segment by bronchoscope, followed by instillation of LPS into the contralateral lung; 6 hours later a bilateral bronchoalveolar lavage was performed and purified alveolar macrophages were ex

vivo stimulated with LPS or lipoteichoic acid (LTA), triggering Toll-like receptor (TLR) 4 and 2 respectively. In vivo LPS-exposed alveolar macrophages were primed as reflected by increased ex vivo LPS- and LTA-induced

interleukin-1β and -6 gene expression and production compared to in vivo saline-exposed alveolar macrophages. LPS instillation did not influence the surface expression of TLR4 or TLR2. Furthermore, LPS instillation did not impact on the expression of a number of extracellular and intracellular regulators of TLR signaling. However, p38 mitogen-activated protein kinase (MAPK) remained phosphorylated in alveolar macrophages upon LPS instillation. The current data demonstrate that LPS instillation in the human lung primes alveolar macrophages for further stimulation with either LPS or LTA possibly by sustained p38MAPK activation.

(4)

Priming of alveolar macrophages upon instillation of lipopolysaccharide in the human lung

⏐

57

Introduction

Bacterial pneumonia is one of the most common infectious diseases and the leading cause of sepsis1. Recognition of pathogens in the alveolar compartment by Toll-like receptors (TLRs) results in activation of immune responses and elimination of pathogens2-4. Immune responses in the lung are tightly regulated, since the lungs are continuously exposed to environmental pollutants and respiratory pathogens and must restrain excessive inflammatory responses to prevent tissue damage. Disproportionate dampening of the immune response will lead to an increased susceptibility to nosocomial infections in critically ill patients. This immune dysregulation is - amongst other mechanisms - thought to result from hypo-responsiveness of immune cells upon recurrent multiple exposures to microbial products, often referred to as tolerance to endotoxin (lipopolysaccharide; LPS)5-7. In recent years, various negative regulators of TLR signaling have been shown to contribute to endotoxin tolerance, including ST2, A20, IL-1R-associated kinase (IRAK)-M, MyD88 short (MyD88s), MAP kinase phosphatase (MKP)-1 and suppressor of cytokine signaling (SOCS)-3 8,9. Regulation of Nuclear Factor kappa B (NF-κB) and p38 mitogen-activated protein kinase (MAPK) further influences the ability to produce cytokines. Importantly, A20 is a direct negative feedback inhibitor of TLR induced NF-κB signalling by the rapid transcription of A20 upon NF-κB activation and subsequent blockade of TRAF6 by A20 10. The phosphatase MKP-1 is a highly dynamic and crucial regulator of p38MAPK activity by the direct dephosphorylation of phospho-p38MAPK by MKP-1 11. In addition, triggering receptors expressed by myeloid cells (TREM) can impact on TLR signalling by macrophages: whereas TREM-1 is able to amplify TLR signalling, TREM-2 can inhibit cellular activation by TLR ligation12.

Many investigations have been published on endotoxin tolerance of monocytes in the systemic compartment during human sepsis, trauma or major surgery13-15. In contrast, however, alveolar macrophages, obtained from the lung during a systemic inflammatory response induced by intravenous LPS or sepsis, do not display tolerance and may even be primed for ex vivo rechallenge, suggesting that endotoxin tolerance is a compartmentalized phenomenon5,16. Although alveolar macrophages pre-exposed to LPS or Escherichia coli in vitro produce diminished levels of cytokines on subsequent challenge with LPS, hence are “tolerized”17,18, contrasting results have been reported in models investigating the influence of an in vivo local challenge in the lung on the responsiveness of alveolar macrophages19,20. In the present study, we sought to investigate the influence of in vivo LPS challenge on alveolar macrophages in humans, using the well-established model of bronchial instillation.

(5)

58

⏐

Chapter 4

Materials and Methods

Subjects

Eight non-smoking males (age 21.3 ± 0.6 yrs, mean ± SEM) were recruited by advertising. Screening, consisting of a questionnaire, physical examination, routine blood and urine investigation, electrocardiogram and spirometry, did not reveal any abnormality. The subjects were part of a simultaneous study investigating the inflammatory response upon bronchial instillation of LPS or LTA in the human lung21, which was approved by the institutional ethics and research committees. Written informed consent was obtained from all subjectsbefore enrollment in the study.

Study design

Ten milliliters of sterile saline was instilled into a lung subsegment (either the right middle lobe or lingula) followed by instillation of LPS (in 10 ml saline) from Escherichia

coli (United States Pharmacopeial Convention, Lot G, Bureau of Biologics, United

States Food and Drug Administration, Rockville, MD) into the contralateral lung, using a flexible video bronchoscope. The subjects were randomized to left or right lungs for saline or LPS instillation. The subjects received LPS at a dose of 4 ng/kg body weight, which was identical to that used in previous studies22,23. Vital variables were measured on an hourly basis; volunteers had no complaints and were completely ambulant.

Bronchoalveolar lavage

A bilateral bronchoalveolar lavage (BAL) was performed 6 hours post-challenge in a standardized fashion according to the guidelines of the American Thoracic Society, using a flexible video bronchoscope. Seven successive 20 ml aliquots of pre-warmed 0.9% saline were instilled in the saline-challenged subsegment of the lung and each aspirated immediately with low suction. This procedure was repeated in the LPS-challenged subsegment of the contralateral lung. Cell differentials were performed on cytospins stained with a modified Giemsa stain (Diff-Quick; Dade Behring AG, Düdingen, Switzerland).

Isolation of alveolar macrophages

BAL fluid (BALF) was immediately centrifuged for 10 min at 1200 rpm at 4°C. BALF cells were passed over a 40 µm nylon filter (BD Falcon, Bedford, MA) and resuspended in ice-cold sterile automated magnetic cell sorting and separation (autoMACS) buffer (PBS, 0.5% bovine serum albumin, 2 mM EDTA; pH=7.4). Subsequently, cells were incubated for 15 min with CD71 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) at 4°C. Of note, our laboratory previously reported that bronchial LPS instillation does not influence CD71 expression by alveolar macrophages24. Cells were

(6)

⏐

59 washed again in autoMACS buffer and purified by autoMACS (Miltenyi Biotec). Total and viable cell counts were determined before and after the isolation procedure using a Burker-Turk haemocytometer and trypan blue (Emergo, Landsmeer, the Netherlands). Additionally, cytospins were prepared before and after autoMACS and stained with Giemsa. Total and differential cell counts revealed a recovery of 35-40% macrophages and a purity of isolated macrophages of >95% in all groups. After isolation, alveolar macrophages were either incubated in RPMI 1640 medium (Life Technologies, Rockville, MD) supplemented with 2 mM L-glutamine, penicillin, streptomycin and 10% FCS for further stimulation or dissolved in RNAeasy lysis Buffer (buffer RLT, QIAGEN, Hilden, Germany) and stored at -80°C until used for RNA isolation. Hence, in each subject alveolar macrophages were harvested from a lung segment instilled with LPS (further indicated by LPS-AM) and from a contralateral lung segment instilled with sterile saline (further indicated by saline-AM).

Ex vivo stimulation of alveolar macrophages

1 x 105 alveolar macrophages (either LPS-AM or saline-AM) were stimulated with 0.1, 1 or 10 μg/ml LPS (from Escherichia coli O55:B5; 200 ng/ml; Sigma-Aldrich) or 0.1, 1 or 10 μg/ml lipoteichoic acid (LTA) and medium control for 2 or 20 hours at 37˚C and 5% CO2 in 24-wells plates (Greiner, Alphen a/d Rijn, Netherlands). The LTA preparation

(from Staphylococcus aureus (DSM 20233) was >99% pure and was prepared as described before21,25. After 2 hours stimulation, alveolar macrophages were dissolved in RNAeasy lysis Buffer (buffer RLT, QIAGEN, Hilden, Germany) and RNA was isolated using RNeasy Mini kit (QIAGEN, Hilden, Germany).

Assays

Interleukin (IL)-1β, IL-6, IL-10, IL-12p70 and tumor necrosis factor (TNF)-α were measured in supernatants from 20 hour ex vivo stimulations using a cytometric bead array (BD biosciences, San Diego, CA).

Multiplex ligation-dependent probe amplification

Expression of TNF-α, IL-1β and IL-6 mRNA’s was analyzed by multiplex ligation-dependent probe amplification (MLPA) as described previously24,26-28. All samples were tested with the same batch of reagents. Levels of mRNA for each gene were expressed as a normalized ratio of the peak area divided by the peak area of the ß2 microglobulin mRNA, to give the relative abundance of mRNAs of the genes of interest24,26-28. LPS did not influence β2 microglobulin mRNA expression (data not shown).

(7)

60

⏐

Chapter 4

p38MAPK and NF-κB phosphorylation

Total cell lysates of isolated alveolar macrophages were prepared using a Bio-Plex cell lysis kit (Bio-Rad Laboratories, Hercules, CA) according to the manufacturer’s instructions and were stored at minus 80°C for further analysis. Phosphorylation of p38MAPK and NF-κB was analyzed using Bio-Plex multiplex beads detecting NF-κBp65-phosphoSer536 and p38MAPK-phosphoThr180/Tyr182 in combination with the Bio-Plex phosphodetection reagent kit (Bio-Rad Laboratories, Hercules, CA). Bead fluorescence was evaluated in a Luminex 100TM analyzer (Bio-Rad Laboratories, Hercules, CA) according to the manufacturer’s instructions. Data are presented as the ratio of phosphoprotein to total cellular protein.

Flow cytometric analysis of alveolar macrophages

Expression of CD14, TLR4, TLR2, TREM-1, TREM-2 and ST2 on alveolar macrophages was analyzed using unseparated BALF cells by flow cytometric analysis using fluorochrome-conjugated mouse anti-human CD14, CD15, HLA-DR (BD Pharmingen, San Diego, CA), TLR4 and TLR2 antibody (eBioscience, San Diego, CA), TREM-1, TREM-2 (R&D systems, Minneapolis, MN) and ST2 antibody (MBL, Woburn, MA) in combination with isotype controls. Alveolar macrophages were selected using side scatter (SSC), HLA-DR and CD14 (HLA-DR+/CD14+ cells were defined as macrophages). Using this gate definition macrophages can be discriminated from neutrophils (HLA-DR-/CD15+) and lymphocytes (SSC low/HLA-DR+).

Evaluation of mRNA levels by quantitative Real-Time PCR

Isolated RNA was treated with RQ1 RNase-Free DNase (Promega) and reverse transcribed using oligo(dT) primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) according to recommendations of the suppliers. Real-Time (RT)-PCR was performed on cDNA samples that were 4-fold diluted in H2O using FastStart DNA Master SYBR Green I (Roche Diagnostics) with

2.5 mM MgCl2 in a LightCycler (Roche Diagnostics) apparatus. Primers used are

indicated in Table 4.1 and were added to a final concentration of 500 nM. PCR conditions were: 5 min 95°C hot start, followedby 40 cycles of amplification (95°C for 15 s, 60°C for5 s, 72°C for 20 s). For quantification, standard curveswere constructed by PCR on serial dilutions of a concentratedcDNA and data were analyzed using the LightCycler software asdescribed by the manufacturer. Gene expression is presented as a ratio of the expression of the house keeping gene β2 microglobulin28,29.

Statistical analysis

Values are expressed as means ± SEM. Data were checked for normal distribution and equal variances using the residuals. Depending on the results of these tests, data were

(8)

⏐

61 analyzed either parametrically or nonparametrically. Statistical comparisons were made by paired t-test or Wilcoxon signed rank test to establish significance between separate datasets. These analyses were performed using SPSS (version 12.0.1; SPSS Inc., Chicago, IL). A P-value of less than 0.05 was considered to represent a statistically significant difference.

Table 4.1 Primer sequences used for Real-Time PCR using the LightCycler.

Gene Primer Sequence Fragment Size

Forward, TCCAGAACACCATTCCGTG A20 Reverse, TGAGGTGCTTTGTGTGGTTC 184 Forward, GTACATCAAGACGGGAAGGC IRAK-1 Reverse, AGTGTGCTCTGGGTGCTTCT 186 Forward, GTACATCAGACAGGGGAAACTTT IRAK-M Reverse, GACATGAATCCAGGCCTCTC 167 Forward, CAACCACAAGGCAGACATCA MKP-1 Reverse, CTTCGCCTCTGCTTCACAA 198 Forward, GGGACACAGCATTGGGCATA

MyD88 (short specific)

Reverse, ACATTCCTTGCTCTGCAGGT 250 Forward, CAGTCTGGGACCAAGAACCT SOCS-3 Reverse, GAGGAGGGTTCAGTAGGTGG 176 Forward, CTCGCGCTACTCTCTCTCTTTCT β2-microglobulin Reverse, TGCTCCACTTTTTCAATTCTCT 185

Results

Ex vivo LPS-induced cytokine release and gene expression by alveolar

macrophages after in vivo bronchial instillation of LPS or sterile saline

To determine the effect of pre-exposure to LPS in vivo on the capacity of alveolar macrophages to produce cytokines upon ex vivo restimulation with LPS, alveolar macrophages were isolated from BALF obtained from lung segments instilled with either saline (saline-AM) or LPS (LPS-AM) in vivo 6 hours earlier and incubated with either control medium or LPS for 2 (for cytokine gene expression) and 20 hours (for release of cytokines). Upon incubation with medium only, LPS-AM displayed an increased spontaneous release of IL-1β and IL-6 (but not TNF-α) when compared with saline-AM (Figure 4.1A, C, E). Both saline-AM and LPS-AM produced increased amounts of TNF-α, IL-6 and IL-1β upon ex vivo stimulation with LPS (10 µg/ml) as compared to incubation with medium only, although for LPS-AM the difference between IL-1β release upon incubation of medium or LPS did not reach statistical significance (P=0.07)(Figure 4.1A, C, E). Notably, ex vivo LPS-induced levels of IL-1β and IL-6 by LPS-AM were much higher than those measured after LPS stimulation of saline-AM (Figure 4.1C and E). The capacity to release TNF-α upon incubation with LPS

(9)

62

⏐

Chapter 4

stimulation of saline-AM did not lead to enhanced mRNA expression of either TNF-α, IL-1β or IL-6 (Figure 4.1B, D, F). In contrast, relative to saline-AM, LPS-AM displayed significantly enhanced mRNA expression of IL-6 and IL-1β, both after incubation with medium and after stimulation with LPS (10 µg/ml) ex vivo; in addition, re-stimulation of LPS-AM with LPS induced increased IL-1β and IL-6 mRNA expression when compared to incubation with medium only (Figure 4.1D and F). Ex vivo stimulation with 0.1 and 1 µg/ml LPS resulted in similar results (data not shown). IL-10 and IL-12p70 levels were below detection in all samples (data not shown). Thus, the spontaneous release of IL-1β and IL-6 by LPS-AM was stronger than that by saline-AM, and LPS-AM demonstrated an enhanced capacity to further increase IL-1β and IL-6 production upon ex vivo restimulation when compared with saline-AM. Indeed, analysis of LPS-induced IL-1β and IL-6 release relative to spontaneous release of these cytokines (i.e. LPS-induced cytokine levels minus levels after incubation with medium only) revealed that both IL-1β and IL-6 release elicited by LPS stimulation ex vivo was higher by LPS-AM than by saline-AM (IL-1β: 35 ± 11 vs. 3 ± 1 pg/ml, P<0.05; IL-6: 378 ± 94 vs. 112 ± 31 pg/ml, P=0.05). Together these results suggest that in vivo exposure to LPS primes macrophages in the alveolar compartment, as reflected by increased ex

vivo LPS-induced IL-1β and IL-6 gene expression and production.

Ex vivo LTA-induced cytokine release and gene expression in alveolar

macrophages after in vivo bronchial instillation of LPS or sterile saline

To investigate whether pre-exposure to LPS in vivo also primes alveolar macrophages for further stimulation by other TLR agonists, saline-AM and LPS-AM were stimulated

ex vivo with LTA (TLR2 agonist) or incubated with medium only. Saline-AM produced

increased amounts of TNF-α upon stimulation with LTA 10 µg/ml ex vivo (Figure 4.2A), whereas LTA did not induce IL-1β or IL-6 release from saline-AM (Figure. 4.2C, 4.2E). LTA stimulation modestly enhanced the secretion of TNF-α and IL-1β by LPS-AM when compared with incubation with medium only (not significant; Figure 4.2A, 4.2C). In contrast, LTA strongly enhanced IL-6 release by LPS-AM relative to that detected after incubation of LPS-AM with medium only (Figure 4.2E). Ex vivo LTA stimulation of saline-AM did not result in enhanced mRNA expression of TNF-α, IL-1β or IL-6 (Figure 4.2B, 4.2D, 4.2F). In contrast, in LPS-AM LTA increased IL-1β mRNA expression relative to incubation with medium only (Figure 4.2D). Ex vivo stimulation of alveolar macrophages with 0.1 and 1 µg/ml LTA did neither induce cytokine release nor enhanced mRNA expression (data not shown). When corrected for higher spontaneous release of IL-1β and IL-6 by LPS-AM (by subtracting cytokine concentrations measured after incubation with medium only from those detected after incubation with LTA), IL-6 release elicited by LTA stimulation ex vivo was higher by LPS-AM when compared with saline-AM (IL-6: 231 ± 101 vs. 21 ± 11 pg/ml, P<0.05), whereas IL-1β release upon ex vivo LTA stimulation tended to be higher (11 ± 4 vs. 0.5 ± 0.2 pg/ml, P=0.09).

(10)

⏐

63

Figure 4.1 Ex vivo LPS-induced cytokine release and gene expression by alveolar macrophages after in

vivo instillation of LPS or sterile saline in the bronchoalveolar space.

Alveolar macrophages, obtained from bronchoalveolar lavage fluid 6 hours after instillation of saline in a lung segment and LPS (4 ng/kg bodyweight, N=8) in the contralateral lung, were incubated ex vivo with 10 µg/ml LPS or medium only. TNF-α (A), IL-6 (C) and IL-1β (E) were determined in supernatants after 20 hours stimulation. mRNA expression of TNF-α (B), IL-6 (D) and IL-1β (F) was determined in RNA isolated from alveolar macrophages after 2 hours stimulation. Open dots indicate in vivo saline challenged alveolar macrophages, filled dots indicate in vivo LPS challenged alveolar macrophages. † indicates P<0.05 vs. ex vivo medium control (RPMI); * indicates P<0.05 vs. in vivo saline-challenged control.

0 10 0 30 60 90 saline LPS † † μg/ml LPS TNF -α (p g/ ml ) A 0 10 0.0 0.1 0.2 0.3 LPS μg/ml LPS saline IL -6 (r el ar iv e to β2M ) B 0 10 0 25 50 75 100 125 saline LPS † * * μg/ml LPS IL -1 β (p g/ml ) C 0 10 0 1 2 3 4 saline LPS μg/ml LPS † * * D 0 10 0 250 500 750 saline LPS † † * * μg/ml LPS IL -6 (p g/ ml ) E 0 10 0 1 2 3 saline LPS † * * μg/ml LPS F TNF -α (r el ar iv e to β 2M ) IL -1 β (r e lar iv e to β2M ) 0 10 0 30 60 90 saline LPS † † μg/ml LPS TNF -α (p g/ ml ) A 0 10 0.0 0.1 0.2 0.3 LPS μg/ml LPS saline IL -6 (r el ar iv e to β2M ) B 0 10 0 25 50 75 100 125 saline LPS † * * μg/ml LPS IL -1 β (p g/ml ) C 0 10 0 1 2 3 4 saline LPS μg/ml LPS † * * D 0 10 0 250 500 750 saline LPS † † * * μg/ml LPS IL -6 (p g/ ml ) E 0 10 0 1 2 3 saline LPS † * * μg/ml LPS F TNF -α (r el ar iv e to β 2M ) IL -1 β (r e lar iv e to β2M )

(11)

64

⏐

Chapter 4

Figure 4.2 Ex vivo LTA-induced cytokine release and gene expression by alveolar macrophages after in

vivo instillation of LPS or sterile saline in the bronchoalveolar space.

Alveolar macrophages, obtained from bronchoalveolar lavage fluid 6 hours after instillation of saline in a lung segment and LPS (4 ng/kg bodyweight, N=8) in the contralateral lung, were incubated ex vivo with 10 µg/ml LTA or medium only. TNF-α (A), IL-6 (C) and IL-1β (E) were determined in supernatants after 20 hrs stimulation. mRNA expression of TNF-α (B), IL-6 (D) and IL-1β (F) was determined in RNA isolated from alveolar macrophages after 2 hours stimulation. Open dots indicate in vivo saline challenged alveolar macrophages, filled dots indicate in vivo LPS challenged alveolar macrophages. † indicates P<0.05 (†† P<0.001) vs. ex

vivo medium control (RPMI); * indicates P<0.05 vs. in vivo saline-challenged control.

0 10 0 30 60 90 saline LPS † * μg/ml LTA TNF -α (p g/ml ) 0 10 0 25 50 75 100 125 saline LPS * * μg/ml LTA 0 10 0 250 500 750 saline LPS ††* * μg/ml LTA 0 10 0.0 0.1 0.2 0.3 saline LPS μg/ml LTA TNF -α (r el at iv e to β 2M ) 0 10 0 1 2 3 4 LPS μg/ml LTA * † * saline 0 10 0 1 2 3 saline LPS μg/ml LTA *p= 0.06 * A C E B D F Il-1 β (p g/ m l) Il-6 (p g/ ml ) IL -6 (r el at iv e to β 2M) IL -1 β (r el at iv e to β 2M ) 0 10 0 30 60 90 saline LPS † * μg/ml LTA TNF -α (p g/ml ) 0 10 0 25 50 75 100 125 saline LPS * * μg/ml LTA 0 10 0 250 500 750 saline LPS ††* * μg/ml LTA 0 10 0.0 0.1 0.2 0.3 saline LPS μg/ml LTA TNF -α (r el at iv e to β 2M ) 0 10 0 1 2 3 4 LPS μg/ml LTA * † * saline 0 10 0 1 2 3 saline LPS μg/ml LTA *p= 0.06 * A C E B D F Il-1 β (p g/ m l) Il-6 (p g/ ml ) IL -6 (r el at iv e to β 2M) IL -1 β (r el at iv e to β 2M )

(12)

⏐

65

Phosphorylation of transcriptional factors in alveolar macrophages

Enhanced cytokine production may be the result of augmented gene transcription and/or prolonged mRNA stability, which is regulated by NF-κB and p38MAPK respectively. Therefore, we investigated the effect of bronchial LPS instillation on the phosphorylation of NF-κB and p38MAPK in alveolar macrophages. Remarkably, p38MAPK was still robustly activated in alveolar macrophages 6 hours after in vivo LPS challenge (Figure 4.3A). However, NF-κB phosphorylation was not increased upon LPS challenge compared to saline (Figure 4.3B).

Figure 4.3 p38MAPK and NFκB phosphorylation in alveolar macrophages upon instillation of LPS or sterile saline in the bronchoalveolar space.

Six hours after instillation of saline in a lung segment and LPS (4 ng/kg bodyweight, N=8) in the contralateral lung, bronchoalveolar lavage fluid was obtained and isolated alveolar macrophages were stored as cell lysates. Phospho-p38MAPK (A) and pNFκB (B) levels were determined by a Luminex based Multiplex assay (FI/ml). Data are presented as the ratio phosphoproteins to total protein levels x 10-2. ** indicates P<0.005 vs. saline.

Bronchial instillation of LPS does not influence surface expression of

CD14, TLR4 or TLR2 on alveolar macrophages

One mechanism by which pre-exposure of alveolar macrophages to LPS in vivo could enhance their responsiveness to LPS and LTA, is increased expression of TLR4 (LPS receptor) or TLR2 (LTA receptor) on LPS-AM relative to saline-AM. To address this possibility we analyzed the surface expression of TLR4 and TLR2, together with the ligand binding part of the LPS receptor complex CD14, on alveolar macrophages harvested from lung segments instilled with saline or LPS in vivo by flow cytometry. LPS instillation did not alter CD14, TLR4 or TLR2 surface expression on alveolar macrophages (Figure 4.4). saline LPS 0 1 2 3 ** p h o spho -p 38 M A P K saline LPS 0.0 0.5 1.0 1.5 2.0 2.5 pNF -κ B A B saline LPS 0 1 2 3 ** p h o spho -p 38 M A P K saline LPS 0.0 0.5 1.0 1.5 2.0 2.5 pNF -κ B A B

(13)

66

⏐

Chapter 4

Figure 4.4 Expression of CD14, TLR4 and TLR2 on alveolar macrophages upon instillation of LPS or

sterile saline in the bronchoalveolar space.

Six hours after instillation of saline in a lung segment and LPS (4 ng/kg bodyweight, N=8) in the contralateral lung, bronchoalveolar lavage fluid was obtained and CD14 (A), TLR4 (B) and TLR2 (C) surface expression was determined on alveolar macrophages by flow cytometry. Differences between LPS and saline challenged alveolar macrophages were not significant.

Bronchial instillation of LPS does not influence surface expression of

TREM-1, TREM-2 or ST2 on alveolar macrophages

Several macrophage surface receptors have been identified that influence the response to TLR ligation. Among these, TREM-1 has been shown to amplify TLR signaling 30,31, whereas TREM-2 32 and ST2 33 can inhibit TLR signaling. Therefore, we were interested in the potential impact of bronchial LPS instillation on the expression of these surface receptors on alveolar macrophages. However, LPS instillation did not influence the expression of TREM-1, TREM-2 or ST2 on alveolar macrophages when compared with saline instillation (Figure 4.5).

A B saline LPS 0 100 200 300 TL R 4 e xp ressi o n (M FI ) C saline LPS 0 100 200 300 400 TLR 2 exp res si o n (M FI ) saline LPS 0 5 10 15 20 CD1 4 exp res si o n (M FI ) A B saline LPS 0 100 200 300 TL R 4 e xp ressi o n (M FI ) C saline LPS 0 100 200 300 400 TLR 2 exp res si o n (M FI ) C saline LPS 0 100 200 300 400 TLR 2 exp res si o n (M FI ) saline LPS 0 5 10 15 20 CD1 4 exp res si o n (M FI )

(14)

⏐

67

Figure 4.5 Expression of TREM-1, TREM-2 and ST2 on alveolar macrophages upon instillation of LPS or

sterile saline in the bronchoalveolar space.

Six hours after instillation of saline in a lung segment and LPS (4 ng/kg bodyweight, N=8) in the contralateral lung, bronchoalveolar lavage fluid was obtained and TREM-1 (A), TREM-2 (B) and ST2 (C) surface expression was determined on alveolar macrophages by flow cytometry. Differences between LPS and saline challenged alveolar macrophages were not significant.

Expression patterns of intracellular regulators of TLR-cascade in alveolar

macrophages

Several intracellular regulators have been identified that serve to inhibit TLR signaling. We were interested in the effect of bronchial LPS in the expression of these negative TLR regulators in alveolar macrophages and therefore determined mRNA expression of IRAK-M, MyD88s, MKP-1, SOCS-3 and A20 in alveolar macrophages purified from BALF obtained 6 hours after LPS or saline instillation. In addition, we analyzed mRNA expression of IRAK-1, which is an important positive mediator of signaling through both TLR4 and TLR2. In vivo LPS challenge did not alter the mRNA expression of IRAK-M, IRAK-1, MyD88s, MKP-1 or SOCS-3 (Figure 4.6A-E). Remarkably, A20 mRNA expression was upregulated in alveolar macrophages upon in vivo LPS challenge (Figure 4.6F). saline LPS 0 100 200 300 400 500 TR EM -2 exp res si on (MFI) saline LPS 0 100 200 300 400 500 TR EM -1 e xpre ss io n (M FI ) A B saline LPS 0 100 200 300 ST 2 exp ress ion (MFI) C saline LPS 0 100 200 300 400 500 TR EM -2 exp res si on (MFI) saline LPS 0 100 200 300 400 500 TR EM -1 e xpre ss io n (M FI ) A B saline LPS 0 100 200 300 400 500 TR EM -2 exp res si on (MFI) saline LPS 0 100 200 300 400 500 TR EM -1 e xpre ss io n (M FI ) A B saline LPS 0 100 200 300 ST 2 exp ress ion (MFI) C saline LPS 0 100 200 300 ST 2 exp ress ion (MFI) C

(15)

68

⏐

Chapter 4

Figure 4.6 Gene expression patterns of regulators of TLR signaling in alveolar macrophages upon

instillation of LPS or sterile saline in the bronchoalveolar space.

Six hours after instillation of saline in a lung segment and LPS (4 ng/kg bodyweight, N=8) in the contralateral lung, bronchoalveolar lavage fluid was obtained and RNA was isolated from alveolar macrophages. mRNA expression of IRAK-M (A), IRAK-1 (B), MyD88s (C), MKP-1 (D), SOCS-3 (E) and A20 (F) was determined by quantitative Real-Time PCR using the LightCycler. Gene expression is presented as a ratio of the expression of the house keeping gene ß2 microglobulin x 10-3. * indicates P<0.05 vs. saline.

Discussion

The airways are continuously exposed to respiratory pathogens, which may cause bacterial pneumonia when pathogens pass innate defenses in the upper airways and enter the alveolar space. Considering that recurrent exposure to microbial products can lead to tolerance of immune cells and that this might render the host more susceptible to nosocomial infections, we were interested to investigate the effect of

saline LPS 0 1 2 3 4 IR AK-M m R N A saline LPS 0.0 2.5 5.0 7.5 10.0 IR AK-1 m R N A saline LPS 0 5 10 15 My D88 s mRN A saline LPS 0.0 0.5 1.0 1.5 MK P -1 m R N A saline LPS 0 2 4 6

*

A2 0 mR NA saline LPS 0 1 2 3 4 SO CS -3 mR N A A B C D E F saline LPS 0 1 2 3 4 IR AK-M m R N A saline LPS 0.0 2.5 5.0 7.5 10.0 IR AK-1 m R N A saline LPS 0 5 10 15 My D88 s mRN A saline LPS 0.0 0.5 1.0 1.5 MK P -1 m R N A saline LPS 0 2 4 6

*

A2 0 mR NA saline LPS 0 1 2 3 4 SO CS -3 mR N A A B C D E F

(16)

⏐

69 an in vivo LPS challenge into the human bronchoalveolar space on the responsiveness of alveolar macrophages to subsequent ex vivo stimulation with LPS or LTA. Our results demonstrate that LPS instillation into a pulmonary segment did not render alveolar macrophages less responsive to either LPS or LTA, but rather primed these cells, as manifested by enhanced cytokine production.

The results of the current study should be considered in the context of previously reported investigations. Endotoxin tolerance has been well-described in various animal and human models and in a number of cell types, including monocytes and macrophages7. The vast majority of in vivo studies reported on tolerance of circulating immune cells upon induction of systemic inflammation13-15,34-36. Evidence indicates that alveolar macrophages may respond differently to repeated exposure to bacterial antigens when compared with macrophages from other body sites. Indeed, whereas intravenous administration of LPS to humans results in a diminished capacity of circulating leukocytes to produce proinflammatory cytokines upon restimulation with LPS ex vivo34-36, it has been found to lead to priming of alveolar macrophages, as reflected by increased ex vivo LPS-induced IL-1 release16. Similarly, Fitting et al.5 demonstrated that alveolar macrophages could escape the tolerization process after intravenous administration of LPS in mice. These studies provided evidence that a systemic LPS challenge does not “tolerize” alveolar macrophages, but may even prime them for enhanced cytokine production in the lungs. Investigations that studied the responsiveness of alveolar macrophages after direct pre-exposure to LPS or other proinflammatory stimuli (i.e. in vitro or within the bronchoalveolar space in vivo) have yielded variable results. LPS stimulation of rabbit or rat alveolar macrophages following in vitro pre-exposure to LPS or E. coli rendered these cells tolerant for further stimulation17,18. Furthermore, alveolar macrophages obtained from patients with community-acquired pneumonia were shown to be hyporesponsive to further stimulation with LPS19. In contrast, alveolar macrophages obtained from mice with acute lung injury following intratracheal hydrochloric acid administration were shown to be primed upon secondary LPS challenge20. In line with the latter investigation, our results show that human alveolar macrophages exposed to LPS in vivo were primed, rather than “tolerized”, as shown by increased ex vivo LPS-induced IL-1β and IL-6 production. In accordance with a primed state, LPS-AM, but not saline-AM, displayed an increase in IL-1β and IL-6 mRNA upon incubation with LPS ex vivo.

TNF-α release was not influenced by pre-exposure to LPS. In line, TNF-α release by alveolar macrophages was not significantly increased upon ex vivo LPS stimulation following intravenous LPS challenge16 and no increase in TNF-α was found in BALF of guinea pigs after recurrent intranasal administration of LPS37. The differential results on TNF-α production and that of IL-1β and IL-6 by LPS-AM might be influenced by augmented gene transcription and/or prolonged mRNA stability38-41. p38MAPK has been shown to be involved in stabilizing mRNAs encoding IL-6, IL-1β and TNF-α41.

(17)

70

⏐

Chapter 4

Unstimulated macrophages display repressed stability and ensuing rapid degradation of mRNAs of these cytokines, whereas stimulation of these cells leads to activation of p38MAPK, which stabilizes mRNAs of multiple stress-induced factors41. Our results show a strong sustained phosphorylation of p38MAPK in alveolar macrophages. Although our data do not provide direct proof, it is tempting to speculate that the increase in spontaneous IL-6, IL-1β and to a lesser extent TNF-α mRNA expression upon LPS instillation may be partially due to p38MAPK dependent enhanced mRNA stability. Different than IL-6 and IL-1β, the somewhat enhanced mRNA expression of TNF-α is not followed by increased cytokine production. The latter may be due to the fact that transcription of TNF-α is more dependant on activation of transcription factor NF-κB38, which was unaltered in alveolar macrophages.

Additional evidence that pre-exposure to LPS in vivo results in an increased responsiveness of alveolar macrophages was provided by the ex vivo stimulations of AM with LTA. Indeed, whereas saline-AM did not respond to LTA stimulation, LPS-AM showed a strongly increased IL-6 release, suggesting that both TLR4 and TLR2 stimulation (such as induced by LPS and LTA respectively)2 was associated with enhanced responsiveness of these cells. We investigated several mechanisms that might have contributed to this finding. We did not detect enhanced expression of CD14, TLR4 or TLR2 at the surface of LPS-AM, making this an unlikely explanation for the data generated upon ex vivo stimulation. Recently, our laboratory reported on the expression of multiple TLR regulators in blood leukocytes upon intravenous injection of LPS34,42. LPS tolerance observed in this systemic model was associated in time with an increased expression of IRAK-M mRNA with a concurrently decreased expression of IRAK-1 mRNA 34. Induction of IRAK-M in pulmonary macrophages has also been implicated in an impaired capacity to mount an effective inflammatory response to respiratory tract infection by Pseudomonas in mice suffering from sublethal peritonitis43. In our study, bronchial LPS instillation did not result in significant changes in the expression of IRAK-M or IRAK-1; moreover, the levels of SOCS3 and MyD88s mRNAs were not altered in LPS-AM when compared with saline-AM. MKP-1, a phosphatase involved in regulation of p38MAPK activity44, was not altered. In this respect it is interesting to note that in vitro induced p38MAPK phosphorylation by LPS in murine alveolar macrophages is fiercely counteracted by MKP-1 45. The sustained p38MAPK activation in our alveolar macrophages obtained after LPS segmental lung challenge was not associated with MKP-1 transcription. Just recently it has been recognized that acetylation of MKP-1 is an important issue in LPS mediated responses of macrophages46. Potentially alveolar macrophages may have a deficit in vivo in their capacity to acetylate MKP-1 which would allow increased p38MAPK phosphorylation, as we observed in our study. Obviously, our studies prompt in depth investigations on the in vivo regulation of p38MAPK activity and its inhibitor MKP-1 in alveolar macrophages.

(18)

⏐

71 Of the different negative TLR regulators studied only A20 was significantly upregulated in LPS-AM. Expression of A20 is directly controlled by NF-κB dependent transcription. Thus, the increased expression of A20 indicates earlier NF-κB activity in these LPS-AM. A20 is essential in the termination of TLR responses10 which is executed by a rapid 50-100 fold increase of A20 transcription. Thus the ~2.3 fold increase in A20 transcription in LPS-AM in our study should probably be interpreted as the lingering expression of an earlier A20 peak that apparently succeeded in attenuation of NF-κB activity to baseline levels.

Finally, bronchial LPS instillation did not influence the surface expression of ST2, TREM-1 or TREM-2 on alveolar macrophages. Of these, ST2 and TREM-2 have been found to inhibit TLR signaling32,33, whereas TREM-1 can amplify TLR responses30,31. Previously, our laboratory reported increased TREM-1 expression on blood leukocytes of humans intravenously injected with LPS42 and patients with sepsis caused by the gram-negative bacterium Burkholderia pseudomallei47. However, pulmonary macrophages of mice infected with Burkholderia pseudomallei showed reduced rather than increased TREM-1 expression47. Together, these data suggest that TREM-1 expression by alveolar macrophages is not easily altered by infectious or inflammatory stimuli and is unlikely to explain our results obtained with LPS-AM. Notably, to the best of our knowledge our study is the first to report on TREM-2 expression by human alveolar macrophages.

Our results indicate that alveolar macrophages recovered from LPS-challenged lung segments exhibited greater spontaneous mRNA expression and production of IL-6 and IL-1β than did macrophages from the saline-challenged lung segments. This finding represents an in vivo activated state of alveolar macrophages within the LPS-challenged lung segment, which we have described previously in this model21 and is further supported by previous studies reporting increased spontaneous cytokine release by alveolar macrophages upon intravenous LPS administration5 and in patients suffering from community-acquired pneumonia19.

The current study has several limitations. First, the model of bronchial instillation involves the administration of relatively low doses of LPS into a single lung segment, which differs significantly from the clinical setting of acute lung injury or pneumonia. Secondly, studies were done with alveolar macrophages obtained at one time point (6 hours) after bronchial instillation with LPS. Although a kinetic analysis over multiple time-points would be of considerable interest, we chose not to expand the number of time-points in light of the invasive procedure to obtain BALF samples. Third, our study does not provide direct evidence for a mechanism underlying the priming effect of LPS on alveolar macrophages. In this respect it should be noted that interventional studies, such as inhibition of p38 MAPK, are difficult to perform in healthy humans for ethical reasons, while in vitro investigations using alveolar macrophages may not

(19)

72

⏐

Chapter 4

adequately reproduce the effects of in vivo exposure to LPS17,18. With respect to the latter, it is possible that the priming effect of LPS in vivo at least in part is caused indirectly by an effect on epithelial cells and/or neutrophils, resulting in the release of mediators that subsequently impact on alveolar macrophages responsiveness. Finally, our study does not exclude a possible confounding immune enhancing effect of the CD71 microbeads used to purify alveolar macrophages.

In conclusion, our data demonstrate that LPS instillation in the human lung primes alveolar macrophages for further stimulation with either LPS or LTA. This is in line with previous reports stating that alveolar macrophages cannot be “tolerized” in vivo and supporting the suggestion that tolerance is a compartmentalized phenomenon5,48. In theory, the absence of tolerance upon a primary stimulus in the lung could be beneficial for host defence against pneumonia; on the other hand, the increased responsiveness of alveolar macrophages may render the host more vulnerable to acute lung injury. Further studies are needed to evaluate the mechanisms underlying the enhanced responsiveness of alveolar macrophages upon bronchial instillation of LPS.

(20)

⏐

73

References

1. Laterre PF, Garber G, Levy H, Wunderink R, Kinasewitz GT, Sollet JP, Maki DG, Bates B, Yan SC, Dhainaut JF. Severe community-acquired pneumonia as a cause of severe sepsis: data from the PROWESS study. Crit Care Med 2005;33:952-961.

2. Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;124:783-801. 3. Knapp S, Schultz MJ, van der Poll T. Pneumonia models and innate immunity to respiratory bacterial

pathogens. Shock 2005;24 Suppl 1:12-18.

4. Martin TR. Recognition of bacterial endotoxin in the lungs. Am J Respir Cell Mol Biol 2000;23:128-132. 5. Fitting C, Dhawan S, Cavaillon JM. Compartmentalization of tolerance to endotoxin. J Infect Dis

2004;189:1295-1303.

6. Adib-Conquy M, Adrie C, Moine P, Asehnoune K, Fitting C, Pinsky MR, Dhainaut JF, Cavaillon JM. NF-kappaB expression in mononuclear cells of patients with sepsis resembles that observed in lipopolysaccharide tolerance. Am J Respir Crit Care Med 2000;162:1877-1883.

7. West MA, Heagy W. Endotoxin tolerance: A review. Crit Care Med 2002;30:S64-S73.

8. O'Neill LA. When signaling pathways collide: positive and negative regulation of toll-like receptor signal transduction. Immunity 2008;29:12-20.

9. Liew FY, Xu D, Brint EK, O'Neill LA. Negative regulation of toll-like receptor-mediated immune responses. Nat Rev Immunol 2005;5:446-458.

10. Boone DL, Turer EE, Lee EG, Ahmad RC, Wheeler MT, Tsui C, Hurley P, Chien M, Chai S, Hitotsumatsu O, McNally E, Pickart C, Ma A. The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nat Immunol 2004;5:1052-1060.

11. Chi H, Barry SP, Roth RJ, Wu JJ, Jones EA, Bennett AM, Flavell RA. Dynamic regulation of pro- and anti-inflammatory cytokines by MAPK phosphatase 1 (MKP-1) in innate immune responses. Proc Natl Acad

Sci U S A 2006;103:2274-2279.

12. Klesney-Tait J, Turnbull IR, Colonna M. The TREM receptor family and signal integration. Nat Immunol 2006;7:1266-1273.

13. Munoz C, Carlet J, Fitting C, Misset B, Bleriot JP, Cavaillon JM. Dysregulation of in vitro cytokine production by monocytes during sepsis. J Clin Invest 1991;88:1747-1754.

14. Majetschak M, Flach R, Kreuzfelder E, Jennissen V, Heukamp T, Neudeck F, Schmit-Neuerburg KP, Obertacke U, Schade FU. The extent of traumatic damage determines a graded depression of the endotoxin responsiveness of peripheral blood mononuclear cells from patients with blunt injuries.

Crit Care Med 1999;27:313-318.

15. Cabie A, Fitting C, Farkas JC, Laurian C, Cormier JM, Carlet J, Cavaillon JM. Influence of surgery on in-vitro cytokine production by human monocytes. Cytokine 1992;4:576-580.

16. Smith PD, Suffredini AF, Allen JB, Wahl LM, Parrillo JE, Wahl SM. Endotoxin administration to humans primes alveolar macrophages for increased production of inflammatory mediators. J Clin Immunol 1994;14:141-148.

17. Lin SM, Frevert CW, Kajikawa O, Wurfel MM, Ballman K, Mongovin S, Wong VA, Selk A, Martin TR. Differential regulation of membrane CD14 expression and endotoxin-tolerance in alveolar macrophages. Am J Respir Cell Mol Biol 2004;31:162-170.

18. Blackwell TS, Blackwell TR, Christman JW. Induction of endotoxin tolerance depletes nuclear factor-kappaB and suppresses its activation in rat alveolar macrophages. J Leukoc Biol 1997;62:885-891. 19. Compartmentalized cytokine production within the human lung in unilateral pneumonia. Am J Respir

Crit Care Med 1994;150:710-716.

20. van Westerloo DJ, Knapp S, van't Veer C, Buurman WA, de Vos AF, Florquin S, van der Poll T. Aspiration pneumonitis primes the host for an exaggerated inflammatory response during pneumonia. Crit Care Med 2005;33:1770-1778.

21. Hoogerwerf JJ, de Vos AF, Bresser P, van der Zee JS, Pater JM, de Boer A, Tanck M, Lundell DL, Her-Jenh C, Draing C, von Aulock S, van der Poll T. Lung inflammation induced by lipoteichoic acid or lipopolysaccharide in humans. Am J Respir Crit Care Med 2008;178:34-41.

22. O'Grady NP, Preas HL, Pugin J, Fiuza C, Tropea M, Reda D, Banks SM, Suffredini AF. Local inflammatory responses following bronchial endotoxin instillation in humans. Am J Respir Crit Care

(21)

74

⏐

Chapter 4

23. Nick JA, Coldren CD, Geraci MW, Poch KR, Fouty BW, O'Brien J, Gruber M, Zarini S, Murphy RC, Kuhn K, Richter D, Kast KR, Abraham E. Recombinant human activated protein C reduces human endotoxin-induced pulmonary inflammation via inhibition of neutrophil chemotaxis. Blood 2004;104:3878-3885. 24. Maris NA, de Vos AF, Dessing MC, Spek CA, Lutter R, Jansen HM, van der Zee JS, Bresser P, van der

Poll T. Antiinflammatory effects of salmeterol after inhalation of lipopolysaccharide by healthy volunteers. Am J Respir Crit Care Med 2005;172:878-884.

25. Morath S, Geyer A, Hartung T. Structure-function relationship of cytokine induction by lipoteichoic acid from Staphylococcus aureus. J Exp Med 2001;193:393-397.

26. Maris NA, Dessing MC, de Vos AF, Bresser P, van der Zee JS, Jansen HM, Spek CA, van der Poll T. Toll-like receptor mRNA levels in alveolar macrophages after inhalation of endotoxin. Eur Respir J 2006;28:622-626.

27. Wettinger SB, Doggen CJ, Spek CA, Rosendaal FR, Reitsma PH. High throughput mRNA profiling highlights associations between myocardial infarction and aberrant expression of inflammatory molecules in blood cells. Blood 2005;105:2000-2006.

28. Spek CA, Verbon A, Aberson H, Pribble JP, McElgunn CJ, Turner T, Axtelle T, Schouten J, Van Der Poll T, Reitsma PH. Treatment with an anti-CD14 monoclonal antibody delays and inhibits lipopolysaccharide-induced gene expression in humans in vivo. J Clin Immunol 2003;23:132-140. 29. Lupberger J, Kreuzer KA, Baskaynak G, Peters UR, le Coutre P, Schmidt CA. Quantitative analysis of

beta-actin, beta-2-microglobulin and porphobilinogen deaminase mRNA and their comparison as control transcripts for RT-PCR. Mol Cell Probes 2002;16:25-30.

30. Bouchon A, Dietrich J, Colonna M. Cutting edge: inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes. J Immunol 2000;164:4991-4995.

31. Bouchon A, Facchetti F, Weigand MA, Colonna M. TREM-1 amplifies inflammation and is a crucial mediator of septic shock. Nature 2001;410:1103-1107.

32. Turnbull IR, Gilfillan S, Cella M, Aoshi T, Miller M, Piccio L, Hernandez M, Colonna M. Cutting edge: TREM-2 attenuates macrophage activation. J Immunol 2006;177:3520-3524.

33. Brint EK, Xu D, Liu H, Dunne A, McKenzie AN, O'Neill LA, Liew FY. ST2 is an inhibitor of interleukin 1 receptor and Toll-like receptor 4 signaling and maintains endotoxin tolerance. Nat Immunol 2004;5:373-379.

34. van 't Veer C, van den Pangaart PS, van Zoelen MA, de Kruif M, Birjmohun RS, Stroes ES, de Vos AF, van der Poll T. Induction of IRAK-M is associated with lipopolysaccharide tolerance in a human endotoxemia model. J Immunol 2007;179:7110-7120.

35. van der Poll T, Coyle SM, Moldawer LL, Lowry SF. Changes in endotoxin-induced cytokine production by whole blood after in vivo exposure of normal humans to endotoxin. J Infect Dis 1996;174:1356-1360.

36. Granowitz EV, Porat R, Mier JW, Orencole SF, Kaplanski G, Lynch EA, Ye K, Vannier E, Wolff SM, Dinarello CA. Intravenous endotoxin suppresses the cytokine response of peripheral blood mononuclear cells of healthy humans. J Immunol 1993;151:1637-1645.

37. de Rochemonteix-Galve B, Marchat-Amoruso B, Dayer JM, Rylander R. Tumor necrosis factor and interleukin-1 activities in free lung cells after single and repeated inhalation of bacterial endotoxin.

Infect Immun 1991;59:3646-3650.

38. Hacker H, Karin M. Regulation and function of IKK and IKK-related kinases. Sci STKE 2006;2006:re13. 39. Skinner SJ, Deleault KM, Fecteau R, Brooks SA. Extracellular signal-regulated kinase regulation of

tumor necrosis factor-alpha mRNA nucleocytoplasmic transport requires TAP-NxT1 binding and the AU-rich element. J Biol Chem 2008;283:3191-3199.

40. Winzen R, Kracht M, Ritter B, Wilhelm A, Chen CY, Shyu AB, Muller M, Gaestel M, Resch K, Holtmann H. The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. Embo J 1999;18:4969-4980. 41. Kotlyarov A, Gaestel M. Is MK2 (mitogen-activated protein kinase-activated protein kinase 2) the key

for understanding post-transcriptional regulation of gene expression? Biochem Soc Trans 2002;30:959-963.

42. Knapp S, Gibot S, de Vos A, Versteeg HH, Colonna M, van der Poll T. Cutting edge: expression patterns of surface and soluble triggering receptor expressed on myeloid cells-1 in human endotoxemia. J

(22)

⏐

75

43. Deng JC, Cheng G, Newstead MW, Zeng X, Kobayashi K, Flavell RA, Standiford TJ. Sepsis-induced suppression of lung innate immunity is mediated by IRAK-M. J Clin Invest 2006;116:2532-2542. 44. Nimah M, Zhao B, Denenberg AG, Bueno O, Molkentin J, Wong HR, Shanley TP. Contribution of MKP-1

regulation of p38 to endotoxin tolerance. Shock 2005;23:80-87.

45. Zhao Q, Shepherd EG, Manson ME, Nelin LD, Sorokin A, Liu Y. The role of mitogen-activated protein kinase phosphatase-1 in the response of alveolar macrophages to lipopolysaccharide: attenuation of proinflammatory cytokine biosynthesis via feedback control of p38. J Biol Chem 2005;280:8101-8108. 46. Cao W, Bao C, Padalko E, Lowenstein CJ. Acetylation of mitogen-activated protein kinase

phosphatase-1 inhibits Toll-like receptor signaling. J Exp Med 2008;205:1491-1503.

47. Wiersinga WJ, Veer CT, Wieland CW, Gibot S, Hooibrink B, Day NP, Peacock SJ, van der Poll T. Expression profile and function of triggering receptor expressed on myeloid cells-1 during melioidosis.

J Infect Dis 2007;196:1707-1716.

48. Cavaillon JM, Annane D. Compartmentalization of the inflammatory response in sepsis and SIRS. J