University of Groningen Cell envelope related processes in Bacillus subtilis van den Esker, Mariëlle Henriëtte

(1)

Cell envelope related processes in Bacillus subtilis

van den Esker, Mariëlle Henriëtte

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below.

Document Version

Publisher's PDF, also known as Version of record

Publication date: 2018

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):

van den Esker, M. H. (2018). Cell envelope related processes in Bacillus subtilis: Cell death, transport and cold shock. Rijksuniversiteit Groningen.

Copyright

Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

(2)

521545-L-bw-vdEsker 521545-L-bw-vdEsker 521545-L-bw-vdEsker 521545-L-bw-vdEsker Processed on: 25-7-2018 Processed on: 25-7-2018 Processed on: 25-7-2018

Processed on: 25-7-2018 PDF page: 61PDF page: 61PDF page: 61PDF page: 61

Submitted.

Mariëlle H. van den Esker and Oscar P. Kuipers

The cold shock response of

Bacillus

subtilis analyzed by RNA-sequencing:

YplP regulates pyruvate transport at

low temperatures

(3)

62

Abstract

Although the optimal growth temperature of Bacillus subtilis lies around 30-37°C, it is able

to survive a wide range of temperatures by employing various adaptation mechanisms. After a sudden transfer to temperatures below 20°C, initial strategies focus on survival by maintaining optimal membrane fluidity and adjusting the transcription and translation machinery. At the long term, cells acclimatize to lower growth rates by decreasing their metabolic activity. Several transcriptome and proteome studies have characterized the

cold shock response of B. subtilis. However, all transcriptome studies performed so far

used microarrays, whereas RNA sequencing has several advantages over microarrays, including insight in the expression of non-coding RNAs. Using RNA sequencing, we compared gene expression after short (0.5 h) and prolonged (2 h) incubation at low temperatures to growth at 37°C. We identified novel genes that play a role during growth

at low temperatures, thereby extending the knowledge on the cold shock response of B.

subtilis. One major cold induced gene is yplP, which encodes a putative transcriptional activator required for adaptation to low temperatures. A comparative RNA sequencing

analysis performed in this study suggests that YplP induces ysbAB expression and thereby

(4)

63

Introduction

When B. subtilis is subjected to a sudden decrease in temperature, a cold shock response

(CSR) is provoked, enabling survival at low temperatures. Initially, the bacterial strategy is focused on survival and growth is completely blocked, but after acclimatization the bacterium pursues growth at a lower rate. The CSR consists of several mechanisms, including membrane adaptation to maintain its fluidity, and adjustment of the

transcription and translation machinery 70_{. On the short term, membrane fluidity is}

preserved via the desaturation of fatty acids by the Des protein, that is induced by the

two-component regulatory thermometer DesKR 147,148_{. On the longer term, the incorporation of}

anteiso-branched fatty acids is induced, because the melting point of anteiso-branched

fatty acids is significantly lower than iso-branched fatty acids 74,149–151_{. Translation at low}

temperatures is mainly modulated by cold-shock proteins (CSPs). These proteins interact with specific RNA-helicases to increase mRNA stability and facilitate proper translation

and protein folding 152_.

Transcriptome and proteome studies identified many other genes and proteins that

are either induced or repressed by cold shock 78,153–156_{. Post-transcriptional and translational}

regulation is particularly important for cold adaptation, but the transcriptional response

is also substantial 156_{; 2.5-9% of the entire transcriptome is changed after the bacterium is}

subjected to a cold shock 78,154_{. Microarray studies indicated that the expression of genes}

involved in metabolism and amino acid synthesis are altered after cold shock, whereas des and genes encoding for specific RNA helicases and translation machineries were upregulated. Furthermore, it was shown that SigL plays a major role in cold adaptation

79_{. This sigma factor is unique, as it belongs to the RpoN family of sigma factors}157_{, making}

it structurally and functionally distinct from other sigma factors 158_{. RpoN sigma factors}

control specific physiological processes, and bind to promoter motifs located -24 and -12 basepairs upstream of the transcriptional start site. They require the binding of bacterial enhancer binding proteins (bEBPs) that provide ATP in order to initiate gene

transcription. The expression of bEBPs depends on environmental conditions 159_.

The genome of B. subtilis encodes five known bEBPs, which activate their regulon

during growth on acetoin (AcoR), arginine (RocR), levan and fructose (LevR), and during cold shock (BkdR and YplP). BkdR regulates branched-chain amino acid utilization, and

functions in maintaining membrane fluidity 160_{. The engagement of YplP in cold adaptation}

was first discovered during a microarray analysis, where it was shown to be induced

8-fold after cold shock 78_{. Subsequent mutational studies demonstrated that deletion of}

(5)

64

yplP increased cold sensitivity, and sequence similarity indicated its function as bEBP 78,79_{. However, the regulon of the putative transcriptional activator YplP is yet unknown.} All transcriptome studies performed so far used microarrays to characterize the

cold shock response of B. subtilis. However, RNA sequencing is nowadays most popular

as it has several advantages over microarrays: RNA sequencing is more sensitive, has a broader dynamic range and novel transcripts, including non-coding RNAs (ncRNAs), can be detected. Therefore, we employed this technique to examine gene transcription after initial (0.5 h) and prolonged (2 h) cold shock, thereby identifying novel genes and ncRNAs. Moreover, we defined the YplP regulon by comparing the transcriptome of an yplP deletion mutant with the wild-type after short (0.5 h) and long (2 h) incubation at 15°C. Our results suggest that YplP optimizes intracellular pyruvate availability via

induction of ysbAB.

Results

The general cold shock response of Bacillus subtilis

To assess differences in the transcriptome of B. subtilis, RNA was harvested after 0.5

h (‘short’) and 2 h (‘long’) incubation at 15°C, and gene expression was compared to genes expressed at 37°C. 158 RNAs were changed significantly after 0.5 h, whereas 397 transcripts were expressed differentially after 2 h, including 19%, respectively 27%, genes with unknown function or genes of which the function has been predicted only (Table S1). Almost 57% of DEGs at 0.5 h were still significantly changed after 2 h. The DEGs were divided into 23 functional classes according to the Subtwiki database (http://

subtiwiki.uni-goettingen.de/apps/expression.php) 161_{. The number of DEGs in these classes}

is shown in Figure 1. Our transcriptome data corresponded considerably with previous

published studies, in particular with the macroarray study performed by Beckering et.

al.78_{. Additionally, our study clearly shows differences between the short and long term}

CSR of B. subtilis. Here, we will discuss the most prominent changes. A list of all DEGs is

provided in Table S1.

Most apparent was the change in expression of certain cold shock genes. Especially des and desKR, the fatty acid desaturase and its corresponding two-component regulatory system, were induced substantially after both 0.5 h (~35x) and 2 h (~110x). In accordance with previous transcriptome studies, upregulation of CSPs was modest, and only CspC

was activated significantly after 2 h (10x) 78,154,156_{. Other genes with unknown function, but}

known to play a role in cold shock (e.g. ydjO and the entire ytr-operon), were also induced

(6)

65 was upregulated only after 2 h (10x), whereas transcription of the bEBP YplP was 16 and 27 x higher after 0.5 h respectively 2 h growth at low temperatures, confirming previous

studies that established this gene as major cold-shock protein 78,79_._{yplQ, the gene located}

next to yplP was induced at similar rates as yplP, suggesting that both genes form an operon

as is also implied by the Subtiwiki Expression server 161_{. Some other SigB regulated genes}

involved in coping with general stress were overexpressed as well (e.g. yflT and yjbC).

Finally, our data showed the repression of opu-genes (3-13x) required for coping with salt

stress, as was also observed in other transcriptome studies 154,156_.

Growth at low temperatures demands adaptation of the transcription and translation machinery, as mRNA is more prone to the formation of secondary structures. CSPs (discussed above) act as RNA chaperones and thereby assist in proper protein

folding. Synthesis of the ribosomal machinery was also increased: genes of the large

rps-rpl-operon, encoding for ribosomal proteins, were induced 4-6x, but only after 0.5 h; after 2 h differential expression of these genes was not detected anymore. Genes coding for class

I heat shock proteins (HSPs) (groEL, groES, grpE, dnaK, dnaE, htpG) were repressed after

both 0.5 and 2 h confirming that HSPs and CSPs are regulated antagonistically as was

proposed before 78_{. For proper transcription, the DNA topology is important. The DNA}

gyrases GyrA and GyrB regulate gene expression by negative coil formation 162_{, and their}

expression was induced 3-4x after 2 h. Moreover, disA-radA expression was induced. DisA

and RadA are DNA scanning proteins that have a role in DNA repair and recombination 163_.

Figure 1. Classes of genes differentially expressed in B. subtilis after a cold shock of 0.5 (left) or 2 (right)

h. The horizontal axis represents the number of genes down- or upregulated in the cold shocked cells compared to the cells growing at 37°C.

(7)

66

Compounds involved in growth and metabolism were also affected after cold shock. Amino acid metabolism was altered with, on the short term, 10 genes being overexpressed and 4 genes being repressed. The genes that were induced were involved in arginine

synthesis (the entire argC-argF operon; also identified by Budde et. al.156_{) and}

methionine-to-cysteine conversion (mccA and yrhB), whereas the synthesis of serine, branched and

aromatic amino acids was reduced. After 2 h, 11 genes were overexpressed in this class (required for methionine-to-cysteine conversion, arginine utilization), and 23 genes (mainly involved in methionine salvage and uptake, and aromatic amino acid synthesis) were repressed. Purine and pyrimidine synthesis was generally induced after 0.5 h, but repressed after 2 h. Other genes involved in nucleotide synthesis were repressed as

well after 2 h (nrd-operon, deoD, xpt-pbuX, upp, dra), corresponding to lower growth rates

achieved at low temperatures. Genes involved in ATP synthesis were also downregulated after 2 h. Besides, motility was repressed after 0.5 h, as flagellar biosynthesis was reduced (flg-fli-flh-che operon downregulation). Genes involved in lipid synthesis (e.g fab- and isp- genes) were induced after 2 h, probably relating to adaptation of the membrane by anteiso-fatty acid production.

Remarkably, the entire pst-operon, encoding a high-affinity phosphate uptake

transporter, was upregulated substantially after 2 h (43-127x), suggesting an increased

demand for phosphate. In line with this finding, the complete tua-operon was

overexpressed greatly (14-254 x) after 2 h of growth at 15°C. This operon is involved in the synthesis of teichuronic acids, which replace wall teichoic acids in the cell wall under phosphate limiting conditions. Together with the observation of increased expression

of the pst-operon, this suggests that cold shocked cells on the long term experience a

phosphate limitation in the medium used.

Finally, the expression of genes required for carbohydrate metabolism was changed, especially after 2 h (e.g. glycerol and lichenan transport increases, whereas fructose transport diminishes), revealing a shift in carbon utilization. The biggest fold-change was

observed for the ysbA-ysbB operon (107 and 102x induced) after 2 h. The YsbAB proteins

operate as a facilitated transport system specific for pyruvate 164,165_{. After 2 h, the majority}

of glucose is probably consumed, making the cells switch to overflow pathways which evidently differ between cold shocked cells and cells growing at 37°C.

Next to the expression of mRNAs, RNA sequencing gives insight into the expression of ncRNAs. The transcription of seven tRNAs was induced after 0.5 h, while after 2 h growth under cold shock conditions, 23 transfer RNAs (tRNAs) were upregulated. Induced tRNAs covered 14 amino acid species. Other upregulated ncRNA included miscRNAs with unknown function. In general, miscRNAs serve a variety of functions,

(8)

67 such as RNA processing and enzyme-like catalysis. Besides, some of these small RNAs

may serve as switches 166_.

YplP deletion increases cold sensitivity

It has previously been shown that YplP is important for adaptation after cold shock, possibly because it interacts as bEBP with SigL and activates the expression of certain

genes required for cold adaptation 78,79_{. Our sequencing results also demonstrate the}

upregulation of yplP after cold shock. To confirm the engagement of YplP in cold shock

adaptation, yplP was inactivated with a tetracycline cassette. Growth of the mutant and

wild-type was followed after transition to 15°C to examine the CSR in the wild-type

and ∆yplP (Fig. 2). Indeed, the ∆yplP mutant is more sensitive to cold shock compared

to the wild-type; especially at the longer term the culture density of the yplP deletion

mutant decreases faster than that of the wild-type. YplP is a putative SigL-dependent transcriptional activator that is activated during cold shock, and therefore, reduced

activation of the SigL-YplP regulon might be responsible for this 79_{. To identify potential}

genes that are induced by SigL-YplP, we performed a software analysis that predicted

novel SigL boxes in the genome of B. subtilis. Subsequently, we compared differences in

RNA transcription of the short- and long term CSR in the ∆yplP strain and the wild-type.

Figure 2. Cold shock experiment with wild-type and ∆yplP. Strains were grown in SMM and transferred

from 37°C to 15°C at an OD₆₀₀ of 0.5 (indicated by the arrows), and the change in absorbance was followed over time.

(9)

68

With this approach, we aimed to characterize the SigL-YplP regulon, which could be responsible for this altered cold sensitivity.

Software prediction of SigL motifs in the B. subtilis genome

In order to identify putative SigL-YplP binding sites, all SigL motifs in the B. subtilis genome

were predicted using a software-based approach. Since genes regulated by other known bEBPs have already been described, we aspired to find new candidate genes for YplP activation by making a list of other possible SigL regulated genes. First, all sequences of experimentally proven SigL binding sites were combined, resulting in a consensus sequence shown in Figure 3. This sequence was used to create a position frequency

matrix, and the intergenic regions of the entire B. subtilis genome were screened for the

presence of similar sequences.

Our analysis revealed 31 regions upstream of genes that encode putative SigL binding sites (Table 1). The promoter motifs were subsequently divided into four classes depending on the probability of SigL actually controlling gene expression, resulting in a list with 14 genes that are less likely to be regulated by SigL, and 17 genes that are possibly, likely or certainly regulated by SigL. From these 17 genes, six have a confirmed SigL promoter and known function, and it is also established which bEBP is required to activate the

transcription of these genes. Three other genes (trpP, gutR and ugtP) have a known function

and three genes have a putative function based on similarity to other genes (tpx, ynaD,

yoaE). The roles of the five genes (yfmN, ykpC, ypjP, yraI, ydeO) are completely unknown. The total list of 11 unconfirmed genes was used to screen for potential YplP activated genes.

The expression of the 11 genes possibly regulated by SigL was evaluated using the Subtiwiki expression browser (http://subtiwiki.uni-goettingen.de/apps/expression.php)

Figure 3. Consensus motif of the SigL promoter in the B. subtilis 168 genome. Logo created with http://

(10)

69

161_{. We investigated which genes of table 1 were upregulated during cold shock, but none of}

the genes were obviously induced after cold shock according to the Subtiwiki expression browser, and no clear suggestions could be derived using this strategy. Therefore, we performed a RNA sequencing analysis in which we compared gene expression of the

wild-type to the ∆yplP mutant after 0.5 h and 2 h growth at 15°C. None of the 11 genes

were significantly altered in expression, indicating that YplP does not regulate the transcription of these genes. Hence, no evidence was found that any of the software-predicted SigL-regulated genes were activated by the bEBP YplP under the circumstances tested.

Transcriptome analysis of the YplP regulon

To identify other genes that may be controlled by YplP, all DEGs of the wild-type were

compared to the ∆yplP mutant 0.5 and 2 h after cold shock (Table 2; Table S1). After a cold

shock of 0.5 h, four RNAs were differentially expressed in the wild-type compared to the yplP-mutant: yplP transcription was upregulated in the wild-type, whereas tetB, the native

tetracycline resistance gene of B. subtilis, was induced 47x in the yplP mutant, probably in

a reaction to the presence of tetracycline during overnight growth. Besides, two tRNAs

(3 and 19) were 3.4x and 3.5x upregulated in the wild-type compared to ∆yplP.

After 2 h incubation at 15°C, more differences were observed: in total, 18 genes were

significantly changed in expression. Again, tetB was expressed higher in the yplP mutant

(17x). Furthermore, two entire operons were induced in the wild-type: ysbA-ysbB

(33.5-64.1 x) and argC-argJ-argB-argD-carA-carB-argF (3.4-7x; Table 2). The ysbAB operon encodes

for a pyruvate transporter 164,165_{. The operon is induced in the presence of pyruvate by the}

two-component regulatory system LytST, and repressed in the presence of glucose by

CcpA 164_{. The}_{arg-car operon is required for arginine biosynthesis and is a member of the}

SigA, CodY and AhrC regulon 174–176_{. The function of the other differentially expressed}

y-genes is unknown.

We examined the promoter of the ysbAB operon with the DBTBS server to find

putative sigma factors that initiate RNA synthesis of this operon. Remarkably, the only sigma factor identified was SigL (cutoff 10%). The SigL motif is located upstream of the cre-site and overlaps for 75% with the consensus sequence (Fig. 4). Hence, our data

suggests that the ysbAB operon is upregulated during the CSR via SigL-YplP induction.

Our analysis did not reveal the presence of an additional putative SigL motif in the

arg-promoter. Therefore, the difference in expression between the wild-type and ∆yplP may

be the result of altered availability of certain precursors in both strains.

(11)

70

Table 1. Predicted SigL motifs in the B. subtilis genome.

Sco re ge ne /op er on Fun cti on Fu rt he r i nf or mat io n ( bE B P) Pr om ot er : Si gL s ite , T SS C la ss 1 20 .5 1 aco A B C L ace to in u ti liz at io n Ex pe ri m en ta l e vi de nce ( A co R ) 167 AAA G A C TG G C A CA C TT C TT G CA TT TA TA AT G G TG A A CCC 21 .58 le vD EF G -s ac C le va n a nd f ru ct os e u til iz at io n Ex pe ri m en ta l e vi de nce ( Le vR ) 16 8, 16 9 C TG TG T TG G C A C G AT C C TT G CA T TAT AT AT G G AT G TA C A 20 .5 3 ptb -bc d-bu k-lp dV-bk dA A B B br an ch ed -c ha in a mi no a ci d ut iliz at io n Ex pe ri m en ta l e vi de nce ( B kd R ) 16 0 A AG AG C TG G C A TG G A A C T TG C ATA AT AAAA G G C G G A G TC 20 .4 8 ro cA B C ar gi ni ne u ti liz at io n Ex pe ri m en ta l e vi de nce ( R oc R ) 17 0 A G AAAA TG G C AT G AT TC TT G CA TTTTT ATT CA TA TG CGA 20 .7 7 ro cD EF ar gi ni ne u ti liz at io n Ex pe ri m en ta l e vi de nce ( R oc R ) 17 1 TT G ATT TG G C A C AG A A C TT G CA T T TA TA TA A A G G G AAA G 19 .8 3 ro cG ar gi ni ne u ti liz at io n Ex pe ri m en ta l e vi de nce ( R oc R ) 17 2 AAAA G C TG G TA C G G AT C T TG C ATG AT G AT A A G G G TG A AT C la ss 2 11 .26 tr pP tr ypt op ha n u pt ak e 1% c ut of f TC C G T T TG G TA TA C TG T TT G CA T A A CA CA TT C TG TA A A G 8.69 gut R re gu la ti on o f g lu ci to l ut iliz at io n 1% c ut of f G TCA TT TG G C A A G T TC C TT T C T T TA G AAAA TAAAA TG TA 8.3 5 yf m N unk no w n f un ct io n 1% c ut of f TGC G GC TG G G A TTT AT C TT G CA G A A G C TG A G A ATG TG TC 8. 46 yk pC unk no w n f un ct io n 1% c ut of f C AC ACG C G GC A A ATTT C T TG C T T C TTTTTT C C TCA C TT C C la ss 3 11 .9 Tp x pr ob ab le t hi ol p er ox id as e 1% c ut of f; S ig F a nd S ig W f ou nd w it h 5 % c ut of f TTT TTT TG G C A TA A A C T TT G CA G TTT G CA G G A A A C TTT A 10. 08 ypj P-ypj Q unk no w n f un ct io n 1% c ut of f; a ls o S ig E f ou nd w it h 1 % c ut of f TT CA TA T A G TA C AT G A C TT G CA T G T T T TG G ATG TG C TA A 9.5 2 yna D Si m ila r t o N -a ce ty lt ra ns fe ra se 1% c ut of f; a ls o S ig H f ou nd w it h 1 % c ut of f G C A AT C TG G C T TA C G A G TT G CA T C C A C A G TA A AT G AT C T 9 yra I unk no w n f un ct io n 5% c ut of f; o nl y s ig m a f ac to r f ou nd G G T TG C G G A CA C TG A A C T TG CA G CA T TT A C G C TG AT T TG 8. 89 Ug tp inhi bi to r o f ce ll d iv is io n 5% c ut of f; a ls o S ig W f ou nd w it h 5 % c ut of f C T TA C G AT GC A TG A A G C T TG C T T G TT G TT G ATT A CA TT G 12 .26 yde O unk no w n f un ct io n 5% c ut of f; a ls o S ig H f ou nd w it h 5 % c ut of f A AC A G G C G GC A C G G TA C A TG A AT G T TC TA AG TC A A AG AG 10 .4 3 yo aE pu ta ti ve f or m at e deh ydr og en as e 5% c ut of f; a ls o S ig A f ou nd w it h 5 % c ut of f A G ACG C C GG T A TAAA C C T TG C T T TC C TA TC T T TC A A G C T

(12)

71 Table 1. Predicted SigL motifs in the B. subtilis genome. (continued)

C la ss 4 8. 04 yp eP unk no w n f un ct io n 5% c ut of f; a ls o S ig D a nd S ig H f ou nd w it h 5 % cu to ff. L oc at ed i n p ut at iv e RBS (T TG sta rt c od on ) AT TC AT TG G G A G G A AC C CG G C AT CG C T TG A G AAAAAA TA 8. 07 yh dN -p ls C ge ner al s tr es s pr ot ei n 5% c ut of f; S ig B a nd S ig F f ou nd w it h 1 % c ut of f T TAAA G T T GC A CA TT A C A TG C A A A C G G C TTTTTT AT A C C 8. 87 yo bW sp or ul at io n m em br ane pr ot ei n 5% c ut of f; S ig E f ou nd w it h 1 % c ut of f AT G C G G C GG A A TAC AC CT C G C AT AT G C TAT G A A A A C A G G 9. 62 rp oY -r nj A co nt ro l o f R N A p ol ym er as e ac ti vit y 10 % c ut of f; S ig A p ro m ot er p ub lis he d 17 3 G A A C TC TG G G A C AAA T T TT T C AT TA A A G G A G GG A C TGG C 8.9 9 yvc I-yvc J-yvc K-yvc L-cr h-yvc N Pu ta ti ve n ud ix hy dro la se 10 % c ut of f; S ig A a nd S ig B f ou nd w it h 5 % c ut of f TC AT TG TG G G A G G C AT C TT GA A G C G G TA TA ATA A A G A G A 10 .4 1 Ccc a cy to ch ro me c -5 50 , r es pi rat io n 10 % c ut of f; S ig W f ou nd w it h 5 % c ut of f ATA A G A TG G A A C GGG T C T TG A A G AT C C G TT C TT C TTTTT 10 .61 ydc K unk no w n f un ct io n 10 % c ut of f, S ig E f ou nd w it h 1 0% c ut of f TTTT C A A GG A A CG C T T T T TG C AT C TG C TTTTT A A G C C A A 8. 41 sp oI IG A -s ig E-si gG m at ur at io n o f S ig E 10 % c ut of f; S ig A f ou nd w it h 1 0% c ut of f A G AC T T T CC CA C AG AG C T TG C T T TA TA C T TA TG A A G C A A 8. 23 yr hH -fat R-yr hJ pu tat iv e me th yl tr an sf er ase N ot f ou nd w it h D B T B S; S ig W a nd S ig X f ou nd w it h 1 % c ut of f 8. 46 yha I unk no w n f un ct io n N ot f ou nd w it h D B T B S; S ig G f ou nd w it h 5 % cu to ff 10 .2 6 yit J-yit I-yit H me th io ni ne b io sy nthes is N ot f ou nd w it h D B T B S; S ig B f ou nd w it h 1 0% cu to ff 8. 2 ga m R-yb gB re gu la ti on o f g lu co sa mi ne ut iliz at io n N ot f ou nd w it h D B T B S 8. 15 ilv D bi os yn thes is o f b ra nc he d-ch ai n a mi no a ci ds N ot f ou nd w it h D B T B S 8. 1 nuc B D N A d eg ra da ti on a ft er mo the r c el l l ys is N ot f ou nd w it h D B T B S C la ss es we re d efi ne d a s f ol lo w s: [1 ] P ro ve n re gu la ti on by Si gL (e xp er im en ta lly ve ri fie d), [2 ] G en es lik el y to be re gu la te d by Si gL (1 % cu to ff va lu e) [3 ] G en es th at ar e po ss ib ly re gu la te d by Si gL (5 % cu to ff , o r 1% cu to ff w it h ot he r si gm a fa ct or s fo un d), [4 ] G en es th at ar e le ss lik el y to be re gu la te d by Si gL ( ≥1 0% c ut of f, o r o th er s ig m a f ac to rs f ou nd w it h l ow er c ut of f v al ue ). R ed l et te rs i nd ic at e t he S ig L b in di ng s ite , w hi le b lu e l et te rs s ho w n uc le ot id es de vi at in g f ro m t he c on se ns us s eq ue nce . A ls o, t he b EB P a nd t ra ns cr ip ti on s ta rt s ite ( T SS ) o f c la ss 1 g en es i s s ho w n. 4

(13)

72

Table 2. DEGs between WT versus ∆yplP 0.5 h (upper part) and 2 h (lower part) after the transition

from 37°C to 15°C. Bold genes indicate which genes of an entire operon are significantly changed.

GeneID Gene Operon Fold

change Function

BSU40770 tetB tetL-tetB -47 tetracycline resistance protein

BSU_tRNA_3 not found 3.4

BSU_tRNA_19 not found 3.5

BSU21780 yplP yplP-yplQ 62 sigma L-dependent

transcriptional regulator YplP BSU40770 tetB tetL-tetB -17.9 tetracycline resistance

protein

BSU19579 yoyD yoyD-yoyF -16.8 hfypothetical protein BSU35960 rbsB rbsR-rbsK-rbsD-rbsA-rbsC-rbsB -4.9 D-ribose-binding protein

BSU35970 ywsB ywsB -4.6 hypothetical protein

BSU37780 rocA rocA-rocB-rocC -4.3 1-pyrroline-5-carboxylate dehydrogenase

BSU11220 argD argC-argJ-argB-argD-carA-carB-argF 3.4 acetylornithine aminotransferase

BSU02160 ybfA N/A 4.5 hypothetical protein

BSU11230 carA argC-argJ-argB-argD-carA-carB-argF 5.6 carbamoyl-phosphate synthase arginine-specific small chain

BSU11240 carB argC-argJ-argB-argD-carA-carB-argF 6.1 carbamoyl-phosphate synthase arginine-specific large chain

BSU11250 argF argC-argJ-argB-argD-carA-carB-argF 6.4 ornithine

carbamoyltransferase BSU11210 argB argC-argJ-argB-argD-carA-carB-argF 7.0 acetylglutamate kinase BSU34230 epsN

epsA-epsB-epsC-epsD-epsE-epsF- epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO 19.7 pyridoxal phosphate-dependent aminotransferase EpsN BSU08880 rpsN rpsJ-rplC-rplD-rplW-rplB-rpsS-rplV- rpsC-rplP-rpmC-rpsQ-rplN-rplX-rplE-rpsN-rpsH-rplF-rplR-rpsE-rpmD-rplO 20.6 alternate 30S ribosomal protein S14

BSU06078 ydzW/5 N/A 31.0 hypothetical protein (pseudogene) BSU28900 ysbB ysbA-ysbB 33.5 Pyruvate transporter

BSU11260 yjzC yjzC 43.9 hypothetical protein

BSU28910 ysbA ysbA-ysbB 64.1 Pyruvate transporter BSU21780 yplP yplP-yplQ 65.9 sigma L-dependent

(14)

73

Discussion

After being subjected to a cold shock, B. subtilis has to adapt to these new conditions

in order to survive. Previous transcriptome and proteome studies have characterized intracellular changes after a sudden cold shock, and after adaptation to low temperatures 78,154,156_{. Although these studies give a good insight in the CSR of}_{B. subtilis, some questions} were remaining. Firstly, different experimental setups and usage of varying commercial microarrays made it difficult to compare the results of these studies. Therefore, a good comparison between short and long term adaptation to low temperatures was lacking. Secondly, many genes with unknown function were differentially expressed during

growth at low temperatures. One gene was yplP, and it has been shown that YplP indeed

plays an important role during cold shock adaptation 78,79_{. YplP is a putative transcriptional}

activator that induces gene transcription by binding to SigL. However, the regulon of this protein has never been elucidated.

In this study, we used RNA sequencing to compare gene expression at 15°C and 37°C after 0.5 h (initial CSR) and 2 h growth (adaptation to low temperature). Distinctive for this technique is the low background, and consequently, a large dynamic range. Indeed, the fold changes detected in our study are more variable and have a greater range compared to the microarrays published before. The expression of the phospholipid desaturase Des

for example was changed 10-fold in two microarrays 78,154_{, but according to our data the}

change was 28 x (0.5 h) and 88 x (2 h).

After 0.5 h incubation at 15°C, 158 RNAs were expressed differentially: 77% were induced and 23% were repressed. After 2 h, we identified 397 DEGs, of which 50% was overexpressed and 50% was reduced in expression. DEGs between 0.5 h and 2 h overlap for 57%. In general, our data agrees with previous transcriptome studies: anabolic and catabolic routes changed significantly. There was however a big transition between 0.5 h and 2 h: after 0.5 h, many genes involved in e.g. nitrogen, amino acid and nucleotide biosynthesis were induced whereas after 2 h, genes in these classes were mainly repressed. Figure 4. Promoter sequence of the ysbA-ysbB operon. The putative SigL binding site is indicated

in red (nucleotides corresponding with the consensus sequence) and blue (nucleotides deviating from the consensus). The cre-site is shown in orange, while the putative RBS is bold. The ysbA start codon is underlined.

(15)

74

This might correspond to a fast adaptation of the translation and metabolic activity after 0.5 h, whereas after 2 h, acclimatization occurred and growth rates decreased, resulting in reduced metabolic rates. Indeed, translational machinery is also overproduced after 0.5 h, whereas this is not as much the case after 2 h. Hence, two states are discerned: initially a CSR occurs, followed by adaptation in which cells adjust their metabolic activity and

growth rate. The CSR also entails a reduction of motility, as was noticed in earlier work 177_.

Our data suggests that after 2 h, phosphate became limited in the cultures growing

at 15°C. A high-affinity phosphate uptake transporter (encoded by the pts-operon) and

teichuronic acid synthesis (tua-operon), both induced by the PhoP regulon at phosphate

limiting conditions 178,179_{, were overexpressed extensively. In the medium we used (SMM}

with glucose as carbon source), P_i was added as 85 mM K₂HPO₄and 40 mM KH₂PO₄. The

amount of phosphate provided in High Phosphate Defined Medium is 3.5 mM (against

0.065 mM in Low Phosphate Defined Medium) 180_{, so the concentration of phosphate in our}

medium should theoretically not be a limiting factor. Moreover, the amount of phosphate supplied at both 37°C and 15°C is equal, so apparently, the difference in PhoP regulation results from the difference in temperature. Although the solubility of phosphate decreases in lower temperatures, this difference is minimal and does not explain the difference

in expression 181_{. However, it is known that the amount of teichuronic acids in the cell}

wall is dependent on the temperature: Prayitno and Archibald found that the amount of teichuronic acids in the cell wall incorporated at 47°C was lower than at 30°C, while other

conditions remained the same 182_{. Thus, if this represents a general trend, it would mean}

that the teichuronic acid content of the cell wall at 15°C is even higher. Further research should verify if this is the case.

Contrary to microarrays, RNA sequencing gives insight into the expression of ncRNAs. After 2 h growth under cold shock conditions, 23 transfer RNAs (tRNAs) were upregulated. tRNAs provide amino acids during protein synthesis. The induction of certain tRNAs was reported before, as the composition of proteins alters after cold shock

183_{. Other studies suggested that the ribosome acts as thermosensor via changes in the}

concentration of charged tRNAs 184_{. After a cold shock, the speed of translation reduces,}

and the increased concentration of charged tRNAs block the A-site of the ribosome. Subsequently, (p)ppGpp levels are lowered via RelA, and the production of cold induced

proteins increases 184,185_{. The tRNAs induced in our study include charged tRNAs, and}

therefore our data supports this hypothesis.

Our research identified YplP as major cold shock protein, thereby verifying previous

studies 78,79_._{yplP was overexpressed after cold shock, and deletion of this gene resulted}

(16)

75 to the bEBP YplP, was also induced after 2 h (10 x). Our data suggests that one operon

is specifically activated by YplP at low temperatures. The ysbAB operon is upregulated

significantly after 2 h cold shock, but deletion of yplP abolished this, indicating YplP is

responsible for ysbAB induction. The ysbAB promoter encodes a putative SigL binding

site, supporting the hypothesis that the YplP-SigL complex induces ysbAB transcription.

Previous microarray experiments did not find ysbAB to be induced after cold shock,

probably because the experimental conditions were different. Samples were for instance

taken shorter after cold shock, and we did not observe induction after 0.5 h either 78,154_.

Another explanation includes the non-specific binding of other genes on the ysbAB probe

of the microarray, thereby eliminating any significant effects. Additional experiments

should verify the ysbAB induction via SigL-YplP during cold shock. ysbAB transcription

in the wild-type could be compared to expression in the yplP mutant under cold shock

conditions, for example with the use of reporter strains (promoter-gfp fusions), or using

RT-PCR. Moreover, an electrophoretic mobility shift assay could directly reveal binding

of SigL in the ysbA promoter and elucidate the binding motif.

The reason for ysbAB overexpression during growth at 15°C is not directly evident.

YsbAB is a facilitated pyruvate transporter 164,165_{. Pyruvate is the end product of glycolysis,}

and a key intermediate in many metabolic pathways. It is for example an important precursor for amino acid formation: alanine is synthesized via the transamination of pyruvate. Besides, valine and leucine obtain their carbons primarily from pyruvate,

and isoleucine derives two from its six carbon atoms from pyruvate 186_{. Amino acids,}

and especially branched-chain amino acids, are important precursors for the formation of branched-chain fatty acids. For cold adaptation, anteiso-branched fatty acids are

incorporated in the cell wall of B. subtilis151_{. Anteiso-branched fatty acids can be produced}

either from isoleucine, or, in some cases, from short-chain carboxylic acids 76_{. One of}

the precursors that can be used for the synthesis of anteiso-branched fatty acids, either

directly or indirectly (via the production of isoleucine or acetyl-CoA), is pyruvate 187_.

Therefore, the uptake of pyruvate might be induced via YsbAB. This also corresponds to the induction of genes involved in lipid synthesis via FapR, a regulator of lipid biosynthesis

that is essential for cold adaptation in B. subtilis188,189_.

Alternatively, increased pyruvate uptake could decrease intracelllar ROS formation. A recent study has shown that the accumulation of intracellular pyruvate protects several

fungi from ROS damage caused by heat shock 190_{. In those fungi, pyruvate acts as an}

efficient scavenger of ROS species, and is accumulated due to a decrease in pyruvate consumption. Other studies have shown that ROS production increases under cold shock

conditions in Saccharomyces cerevisiae, chickpea and in cyanobacteria as well 191–193_{. Therefore,}

(17)

76

B. subtilis may limit ROS formation via YsbAB upregulation and a subsequent increase in pyruvate uptake and higher intracellular pyruvate levels.

Although our bioinformatics approach did not reveal any genes that are possibly regulated by YplP itself, it did supply a list with genes that are potentially transcribed by SigL. Some of these genes are involved in specific physiological processes, such as tryptophan uptake and glucitol utilization, and may therefore be good candidates for SigL regulation. We cannot exclude the existence of other undiscovered bEBPs encoded

in the B. subtilis genome, and therefore, our list may be helpful to identify future

SigL-regulated targets.

Concluding, we defined the transcriptome of B. subtilis after short (0.5 h) and

prolonged (2 h) incubation at 15°C and compared gene expression to growth at 37°C. Our results overlap with previous transcriptome studies, but additionally, we were able to directly compare expression between short and prolonged incubation at 15°C, and we observed a distinction between the initial CSR and adaptation after extended growth. Furthermore, we identified novel DEGs and ncRNAs during growth at low temperatures.

Also, novel insights in the regulon of the cold shock bEBP YplP were acquired: the

ysbA-ysbB operon is a potential target for regulation. Future research will focus on confirming these results.

Experimental procedures

Bacterial strains, plasmids and media

Strains and plasmids used in this study are shown in Table 3. B. subtilis JH642 was grown in

Lysogeny Broth (LB-Lennox: 1% Bacto-Tryptone, 0.5% Bacto-yeast extract, 0.5 % NaCl) or supplemented Spizizen’s Minimal Medium (SMM) supplemented with glucose (0.5%), 1%

trace elements, phenylalanine (50 µg ml-1_{) and tryptophan (50 µg ml}-1₎109_{. When required,}

tetracycline (6 µg ml-1_{) was added to the medium. Strains were incubated at 37°C, 220}

rpm unless stated otherwise. Solid media were prepared by adding 1.5% (wt/vol) agar. Table 3. Bacterial strains and plasmid used in this study

Strain or plasmid Relevant features Reference or source

Bacillus subtilis

JH642 pheA1, sfp0_{, trpC2} _{Hoch and Mathews (1973)}194

∆yplP JH642, yplP::tc This study

Plasmid

(18)

77

Molecular cloning

Primers used in this study are listed in Table 4. DNA purification, restriction, and ligation

was carried out as described by Sambrook et al.110_{. PCRs were performed using chromosal}

DNA of B. subtilis JH642 as a template. Phusion polymerase, restriction enzymes and T4

ligase were purchased from Fermentas (USA). B. subtilis transformations were performed as

previously described 111_{, and constructs were verified by PCR and sequencing (Macrogen,}

Amsterdam).

Table 4. Oligonucleotides used in this study

Name Sequence (5’ à 3’) Information

yplP-F-up ACAGTTTCCAGCGTCCGGAAGG Construction mutant yplP_R-up-BamHI CGTCGGATCCCATCAATTGGCTCCTTTTGGTTC Construction mutant yplP-F-down-BamHI GAGCGGATCCATGATCTAGCGATCGAAAGG Construction mutant yplP-R-down TTTATCGGGCAATGGCTGGATCG Construction mutant

YplP-F AGCGCTGCGACAGAAAGAG Amplify YplP region

YplP-R CCGGTTCAGTTGTGACGATCC Amplify YplP region

YplP-Seq-F TGTGAATGACAACGTCCTTTAC Sequencing primer 1 YplP-Seq-R GTAATCGCATTGGCGATCTC Sequencing primer 2

Tet-F TGGAACAGTAGCAGGGTTTG Sequencing primer 3

Tet-R CGCGCAACTACAACCATTACGAG Sequencing primer 4

Strain construction

To create strain ∆yplP, the gene was replaced with a tetracycline cassette from pBEST309.

First, up and down flanking regions of ~1 kb were amplified using primer F-up + yplP-R-up-BamHI and yplP-F-down-BamHI + yplP-R-down. The resulting PCR products and pBEST309 were digested with BamHI. After ligating the tetracycline cassette of pBEST309 to the upstream and downstream flanking region, the mixture was concentrated in a

SpeedVac concentrator and directly transformed to B. subtilis JH642. Transformants were

selected overnight on LB plates containing tetracycline. Subsequently, colonies were checked by PCR with primer YplP-F and YplP-R, and the product was sent for sequencing with YplP-Seq-F, YplP-Seq-R, Tet-F and Tet-R.

Cold shock experiments

Cultures were inoculated from -80°C stocks on LB plates containing antibiotics, and grown overnight at 37°C. The next day, single colonies were incubated and grown in LB medium with antibiotics for 8 h at 37°C, 220 rpm. After that, the culture was diluted in

(19)

78

several ratios (ranging from 1:1500 – 1:60) in SMM and grown overnight in the presence of antibiotics. The next morning, the overnight culture that reached an absorbance of

0.8 – 1 at 600 nm was selected, and diluted to an OD₆₀₀ of 0.05 or 0.1 in 10 mL fresh SMM

without antibiotics. Flasks were incubated at 37°C, 220 rpm. When cultures reached an

OD₆₀₀ of 0.5, they were subjected to a cold shock by incubating the flasks at 15°C. Growth

was followed by measuring the absorbance at 600 nmat different time points before and after cold shock of the cultures.

Sample collection, RNA isolation and transcriptome experiments

B. subtilis JH642 and ∆yplP were grown and cold shocked as described above. 0.5 h and 2 h after switching to 15°C, cultures were harvested by centrifugation (1 min, 14,000 rpm) and the pellet was immediately frozen in liquid nitrogen and stored at -80°C until RNA extraction. As a control, cultures were also harvested from 37°C at the same time points

(0.5 and 2 h after an OD₆₀₀ of 0.5 was reached).

RNA was isolated by resuspending the cell pellet in 400 µl of TE (10 mM of Tris·HCl, 1 mM of EDTA, pH 8.0). Subsequently, 500 µl phenol/chloroform, 50 µl 10% SDS (Sodium dodecyl sulfate) and 0.5 g glass beads were added. The cells were lysed by pulsing two rounds of one minute in a Mini-BeadBeater (Biospec Products, Bartlesville, USA) at 4°C. In between, cells were cooled on ice. After centrifugation (14,000 rpm for 10 min at 4°C), the supernatant was collected and 500 µl chloroform was added. After centrifugation as above, the supernatant was used to isolate RNA with the NorGen Total RNA purification kit (Cat #17200, Biotek Corp, Canada) according to manufacturer’s instructions. The optional DNase treatment step was included, and to avoid degradation of the RNA, 3 µl RiboLock (Fermentas, USA) was added to the enzyme mixture. The concentration of the extracted RNA was measured using NanoDrop ND-1000 (Thermo Scientific, USA) and

quality was analyzed using bleach gel electrophoresis 144_.

After RNA isolation, RNA was sent to PrimBio Research Institute (Exton, USA). There, quality was analyzed by determining the RNA Integrity Number and RNA was

sequenced by next generation directional sequencing on an Ion ProtonTM_{Sequencer. The}

quality of the transcriptome data was checked and trimmed with a cutoff of > 30 nt, and

the RNA sequence reads were mapped on the reference genome of B. subtilis 168. The Reads

Per Kilobase per Million reads (RPKM) were subsequently normalized and analyzed using the Transcriptome analysis webserver for RNA-seq expression data T-rex (available

at http://genome2d.molgenrug.nl) 146_{. To detect differentially expressed genes (DEGs), a}

fold change > 3 or < -3 was used, with an adjusted P-value of < 0.01. DEGs with extremely high fold changes due to very low expression (RPKM <10) were not investigated further.

(20)

79

Software-based prediction of the SigL promoter region

To explore the presence of putative SigL promoter regions in the entire B. subtilis JH642

genome, all known SigL regulatory motifs were downloaded from DBTBS 94_{. Next, a}

position frequency matrix (PFM) was generated on the Genome2D webserver 195_{. This}

PFM was entered on the Genome2D website (http://genome2d.molgenrug.nl/), where it

was used to search in intergenic regions of the B. subtilis 168 genome for motifs similar to the

PFM. This resulted in a list of genes that contain putative SigL promoters. The promoters of these indicated genes were analyzed using the DBTBS webserver to determine the threshold (p-value) and position of the SigL motifs, and to identify potential other sigma factors involved. After this analysis, the genes on the list were divided into four categories, depending on the probability of the SigL boxes being predicted correct: [1] Proven regulation by SigL (experimentally verified), [2] Genes likely to be regulated by SigL (1% cutoff value, no other sigma factors found) [3] Genes that are possibly regulated by SigL (5% cutoff, or 1% cutoff with other sigma factors found), [4] Genes that are not likely to be regulated by SigL (≥10% cutoff, or other sigma factors found with lower cutoff value).

Supplementary Information

Table S1. Coldshock_RNAseq. A list with all DEGs can be downloaded at: http://www.molgenrug.

nl/index.php/bacillus/marielle-van-den-esker

(21)