Interindividual conservation of TCR Vß regions by minor Histocompatibility antigen specific HLA-A*0201 restricted CTL clones.

(1)

Interindividual Conservation of T-cell Receptor

p

Chain Variable Regions

**by Minor Histocompatibility Antigen-Specific HLA-A*0201-Restricted**

Cytotoxic T-cell Clones

By

EIS

Goulmy, Jos Pool,

and

Peter J.

van den Elsen

Minor histocompatibility antigens (mHags) are involved in

the induction of graft-versus-host disease (GVHD) after HLA- identical bone marrow transplantation. Previously, we iso- lated a series of HLA-A*0201+estricted cytotoxic T-cell (CTL) clones specific for the same mHag HA-l from peripheral blood of three unrelated patients who were suffering from GVHD. We have now analyzed the composition of the T-cell receptor (TCR) V regions

of

12 of these mHag HA-l-specific HLA-A*0201-restricted CTL clones by DNA sequencing of the a and

P

chains. Of these 12 clones, derived from three unrelated individuals, five independent TCRaV- and PV-re- gion sequences were established. The TCRa chains were composed of varying TCRaV and TCRaJ genes with no obvi-

HE RESULTS in human

bone marrow (BM) trans-

plantation are still not satisfactory. Despite the selec-

tion of HLA-identical siblings as BM

donors for patients

with severe aplastic anemia or leukemia, graft-versus-host

disease (GVHD) still occurs. This complication can be

caused by disparity between donor and recipient for minor

histocompatibility antigens (mHags). Besides the well

known mHags H-Y, we previously characterized five non-

sex-linked mHags designated HA-

1,

-2,

-3,

-4 and

-5;

all are

recognized in a classical major histocompatibility complex

(MHC)-restricted fashion.’ Each of these mHags is a product

of a single gene and shows a Mendelian mode of inheritance.

These genes are not coded

for within the

MHC.’ T-cell

clones specific for these mHags were derived from the pe-

ripheral blood lymphocytes (PBLs) from patients suffering

from GVHD. These cytotoxic T-cell (CTL) clones reacted

most frequently against the mHag HA-l.’ A series of HLA-

A*0201-restricted CTL clones specific for the mHag HA-l

exhibited identical reaction patterns in comprehensive immu-

nogenetic studies, suggesting that they recognize the same

mHag HA-

1 .3

Evaluation of the impact of mHag HA-

1

mis-

matching in 148 HLA-identical BM recipientldonor pairs

on the development of GVHD showed a strong correlation

between HA-l mismatch and GVHD.’”

To date, a small number of studies describe a clear domi-

nance in T-cell receptor (TCR) variable (V)-gene segment

usage in the recognition of certain MHC class Ypeptide com-

plexes in

human^.^"

Information on the TCR repertoire post

BM transplantation (BMT) in humans is extremely scarce.’”’

T

From the Department of Immunohaematology und Blood Bank, Submitted July 14, 1994: accepted December 12, 1994. Address reprint requests to Els Goulmy, PhD, Department of Immunohaematology and Blood Bank, University Hospital Leiden, Bldg 1-E3Q, PO Box 9600, 2300 RC Leiden, The Netherlands.

The publication costs of this article were defrayed in part by puge charge payment. This article must therefore be hereby marked

“advertisement” in accordance with 18 U.S.C. section 1734 solely to

indicate this fact.

University Hospital Leiden, Leiden, The Netherlands.

0 1995 by The American Society of Hematology.

0006-4971/95/8509-0034$3.00/0

2478

ous similarities in structure in the

N

regions. However, the TCRP chains all used the TCRpVSS9 gene segment, and showed remarkable similarities within the N-D-N regions; ie, three independent P-chain sequences (originating from donors Ha and Gy) shared a leucinelvaline amino acid pair, whereas the other two (originating from donors Ha and Wi) shared a serinelthreonine pair, all at positions 99 and 100 of the TCRpV region. In conclusion, the TCR analysis of HA- 1 mHag-specific CTL clones has shown that the HA-l mHagl HLA-A*0201 complex selects for highly similar TCRPV re- gions.

0 1995 by The American Society of Hematology.

Except for one piece of data in the murine system” reporting

a dominant mHag response but no TCRPV bias during the

development of a GVHD, there exists, to our knowledge, as

yet no information on TCR usage of mHag-specific GVHD-

related CTL clones. The apparent immunogenicity of mHag

HA-l reflected by the

observed dominant responses post

BMT as well as its correlation with GVHD makes the identi-

fication of the TCR structure recognizing this clinically im-

portant mHag MHC/peptide complex especially relevant.

Here we report on the TCR analyses of 12 CTL clones, all

specific for the MHC class VmHag HA-l peptide complex,

derived from three unrelated individuals. A strong bias to-

wards TCROV and N-D-N region usage in

the recognition

of the MHC/mHag HA-l complex was observed among the

three unrelated patients investigated.

MATERIALS AND METHODS

mHag HA-l-spec$c CTL clones. Twelve mHag HA-l-specific CD8’ CTL clones were originally obtained after restimulation of in vivo primed PBLs from three patients suffering from GVHD after

HLA identical but mHag nonidentical BMT.’ The post BMT CTL

lines were cloned by limiting dilution, resulting in the isolation of

a large number of mHag-specific CTL clones.’ Among the latter

series of clones, seven clones from donor Ha (patient I in reference 3 ) , four clones from donor Gy (patient IV in reference 3 ) , and one

clone from donor Wi (patient V in reference 3 ) were selected for

the TCR analyses on the basis of their concordant reaction patterns

against 100 HLA-A2+ target cells and against 25 HLA-A2+ fami-

lies 2.3

The HLA types and the clone designations of donors Ha, Gy, and Wi are depicted in Table 1.

T-cell receptor V-region analysis. Five X IO6 to 10 X 10‘ cul- tured CTL were purified by centrifugation through a Ficoll Isopaque gradient. After washing with Hanks’ balanced salt solution (HBSS; GIBCO, Paisley, Scotland) the cells were pelleted by centrifugation

and stored at -80°C for the molecular analyses. Total RNA was

extracted using the RNAzol method (CinnaBiotecx Laboratories,

Houston, TX).

Five micrograms of total RNA was transcribed into first-strand

cDNA in 25 pL reaction mixture by reverse transcriptase using oligo

dT as a primer (Promega Corp, Madison, WI).

TCRa- and TCRP-chain encoding cDNAs were amplified by us- ing 28 different TCRAV and 24 different TCRBV family-specific

oligonucleotides using the methodology as described previously.’

’.“

..

(2)

CONSERVATION OF TCR OV REGIONS

Table 1. mHeg HA-l -Specific CTL Clones

Donor HLA Type Clone Designation

HA HLA-AZ, A2, B27. 862, DRl, DR4 V, W, A, B, S, T, U Gy HIA-AP, A3, 818, 844. DR4, DR6 I, R, X, Y Wi HLA-A2, A29, 844, 049, DR5, DR7 C

For these polymerase chain reactions, 0.5 to 1.0 pL of cDNA was

added to a polymerase chain reaction (PCR) mixture containing 10

mmol/L TRIS-HCl pH 8.4, 50 mmol/L KCl, 4 mmol/L MgC12,

0.06 mg/mL bovine serum albumin (BSA), 0.5 mmol/L of each deoxyadenosine triphosphate (dATF'), deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate, 2.5

U of Taq DNA polymerase (Perkin-Elmer Cetus, Emeryville, CA), 20 pmol of a TCR 3'C-region primer and 20 pmol of a TCR V-

family-specific 5' primer in a final volume of 100 pL. AS an internal conrrol for total amplification, a reaction tube containing a 3' and 5' C-region primer was included. Each reaction mixture was overlaid

with 50 pL of mineral oil (Sigma, St Louis, MO) before PCR reac-

tion in a DNA thermal cycler (Thermocycler 60; Biomed Instru-

ments, Fullerton, CA). TCRaV- and TCRPV-specific sequences

were amplified for 30 and 25 cycles, respectively. Each cycle con-

sisted of 1 minute denaturation at 95"C, 1 minute annealing at 5 5 T , and 1 minute extension at 72°C.

After 30 (TCRaV) or 25 (TCMV) cycles of PCR, the products were size fractionated by gel electrophoresis in an 1% agarose gel. The desired PCR-products were captured in 1% low melting-point agarose, and the DNA was recovered using the Magic PCR-Preps DNA purification System (Promega). The purified DNA was used as template in a PCR-based direct dideoxy chain termination sequencing reaction (Circumvent Thermal Cycle Dideoxy DNA sequencing kit; New England Biolabs, Beverly, MA) with 33P-a dATP (Du Pont New England Nulear, Stevenage, UK) according to the instructions of the manufacturer. The sequencing reaction products

were separated on 6% polyacrylamidehrea gels and after drying,

exposed to Kodak XAR film (Eastman Kodak, Rochester, NY).

The obtained sequences were analyzed using the PCGENE DNA software package (Intelligenetics Inc. Mountain View, CA) to deter- mine TCR and N-(D)-N regions by comparison with the EMBL/ GenBank data enmes.

RESULTS

The TCR V-gene usage of 12 m a g HA-l-specific T-cell

clones, which were derived from three unrelated individuals

was investigated by PCR using TCRaV and TCRPV-family

2479

specific oligonucleotides. The structure of the TCR V-region

was subsequently determined by DNA sequence analysis of

the PCR products. The DNA sequence analysis showed the

exclusive usage of the TCROV6S9 family member by all

12

M a g HA-l specific CTL (Table 2).

When the different TCRPV region sequences were com-

pared, a number of striking features emerged. Among the 12

CTL clones, five different types of clones were determined.

Nonetheless, striking similarities were observed among these

different clones. The two independent sequences of the

clones X, Y ,

I, and R of donor Gy were almost identical,

differing only in four nucleotides in the N-D-N-regions. Both

types of clones shared the LV amino acid pair (Table 2).

When comparing the T-cell clones derived from donor Gy

with the clones B, S, T, and

U

of donor Ha, a remarkable

similarity in the nucleotide composition within the N-D-N

region was found that also resulted in the incorporation of

an LV amino acid pair in the N-D-N regions of these CTL

clones (Table 2). Conservation of a second amino acid pair,

ST, is

also shared among two types of CTL clones A, V,

and

W

of donor Ha and in clone C of donor Wi. We noted

that the CD3-regions of the T-cell clones derived from Gy

and Ha were identical in length. This was in contrast with

Wi, which exhibited a much longer CD3 region. Analysis

of the TCRaV-regions showed the usage of multiple TCRaV

genes (Table

3). The TCRa chains of donor Gy were of

variable composition. This was in contrast with donor Ha,

whose mHag HA-l CTL clones expressed identical TCRaV

genes, but different TCRaJ elements. Like for the TCRP

chain, the N region of the TCR Va chain of the d a g HA-

l-specific CTL clone of Wi was much longer than that of

the other clones analyzed.

Taken together, these data suggest strong conservation in

the TCRPV region used in the recognition of HLA-A*0201/

mHag HA-l complex, whereas the TCRaV regions display

a more interindividual heterogeneity.

DISCUSSION

MHC class I antigen presentation has shown strict proper-

ties with respect to the structural requirements of the (natu-

rally processed) peptides that are bound into the groove of

the MHC m ~ l e c u l e . ' ~ " ~

A number of studies have shown

Table 2. Alignment of Nucleotide and Amino Acid Sequences of TCRPV Regions of mHeg-Specific T-cell Clones

Clone TCRBV N-D-N TCRBJ

Nucleotide sequences

Gy (X,Y) 6S9 AGCAGC TTAGTAGCG AATCAGCCCCAGCATTTTGG 1 S5

Gy (l. R) 6S9 AGCAGC T T A G T C T C CAATCAGCCCCAGCATTTTGG 1S5

Ha (B,S.T.U) 6S9 AGCAGC TTAGTCCGGA CCTACGAGCAGTACTTCGG 2s7

Ha (A,V.W) 6S9 AGCAGC TCGACACGGCT T G A A A A A C T G T T T T T T G G

Wi (C) Gy (X.W N Q P O H F G D G T R L S I L 6S9 L V A AMY L C A S S Gy 6S9 N Q P O H F G D G T R L S I L L V S 1 S5 Ha (B.S,T,U) 6S9 F G P G T R L T V T Y E O Y AMY L C A S S L V R T Ha (A,V.W) 6S9 AMY L C A S S S T R L

-

2s7 Wi (C) 6S9 1S4 AMYLCAS T E A F F G O G T R L T V V R ~ G G V A L 1% 1 S4

6S9 AGCAG ATCTACGGGGGGCGTCGCGCT CACTGAAGCTTTCTTTGG 1s1

Amino acid sequences

-

AMY L C A S S

1 S5

-

(3)

2480 GOULMY, POOL, A N D VAN DEN ELSEN

Table 3. Alignment of Nucleotide and Amino Acid Sequences of TCRuV Regions of mHag-Specific T-cell Clones

Clone TCRAV N TCRAJ

Nucleotide sequences Gy K Y ) Gy U,R) Ha (B.S,T,U) Ha (A,V,W) Wi (C) Gy M,Y) Gy (1.R) Ha IB,S,T,U) Ha IA.V.W) Wi (C)

Amino acid sequences

23 7s2 3S1 3s 1 l0Sl 23 7s2 35 1 3s 1

1os1

T A C C T C T G T G C T G T T A C C T C T G T G C T G T G T A C T T C T G T G C T A C G G T A C T T C T T A C C T C T G T G C A G G P A T Y L C A V A S Y L C A V A S Y i C A T ASY F G L Y L C A G GAGGGGG A A G A A CCGTGA T C C T ( G C I A G G T G G G G A G A RG K K AV I F L ARWGE A C T A C C i C A G G G G A T A G C A A L l T T l C T T C T G G l T A A T A A T G C A G G A A C T C A A A 1 1 T T S G T Y K Y I F G T G T R L D S N Y Q L I W G A G T K L S S G S A R O L T F G S G T Q L N N A G N M L T F G G G T R L N S N S G Y A L N F G K G T S L 40 33 22 39 41 40 33 22 39 41 ~ ~ ~~ ~~

that the T-cell response against these MHC class Upeptide complexes is restricted.

In the CTL response against peptide antigens derived from virus-encoded proteins, skewed usage of particular TCR V genes was found. This is examplified by the predominant usage of TCRaV and TCRPV regions by HLA-A*0201- and B27-restricted influenza A virus-encoded peptide antigens, established from peripheral blood mononuclear cells (PBMCs) of different donors.4,' Likewise,

9

of 10 clones established at different time points from PBMCs from a single human immunodeficiency virus type 1 (HIV-1)-infected individual used identical TCRaV TCRPV regions.*" Moreover, analyses of T-cell antigen receptor repertoire in the PBLs from six HIV-infected individuals showed major oligoclonal expansions

of

certain TCRPV families. It ap- peared that cells expressing the latter TCRPV were

of

the CD8 type and mediated HIV cytotoxicicity.*' Also among melanoma, HLA-A2-restricted tumor-infiltrating T lymphocytes predominant usage of TCRV regions was found,' whereas

in

HLA-B27 allorecognition, the TCRa and TCRP chain repertoires exhibit a skewed usage pattern of TCRV genes."

Our study comprised 12 HLA-A*0201 -restricted mHag HA- l-specific CTL clones from three HLA nonidentical unrelated individuals. Although the nature of the mHag HA-l is still elusive, several striking features with respect to T- cell recognition have emerged from our study. First, several CTL clones, obtained from independent limiting dilutions, from individuals Gy and Ha shared fully identical TCRa and TCRP chain sequences. These observations support our notion on the in vitro immunogenic potency and the possible in vivo immunodominant behavior of mHag HA-l during the acute phase of GVHD after BM".'' (and manuscript submitted for publication). Naturally, a point of caution must be made. Although the twelve CTL clones analyzed in this study were obtained from independent limiting dilutions, there exists a possibility that in vitro expansion may prefer- entially select for some clones and not for others. Nonethe- less, a number of studies investigating the TCR gene usage of PBL from patients post BMT, showed in vivo clonal expansion of several T-cell subpopulations at the time of GVHD.'"' Analyses at the site of inflammation (ie, the skin) show significant higher recurrent TCR transcripts when com-

pared with paired samples

of

patient PBMCs."' Second, and most striking, the mHag HA-l TCRPV regions expressed by the CTLs, originating from HLA-nonidentical unrelated individuals, share extensive sequence homologies in particular within the N-D-N regions. It suggests a strong selection of TCRPV regions in particular in the mHag HA-IMLA- A*0201 complex recognition. This could be related to the as-yet-unknown nature of the mHag HA-l peptide that play a pivotal role

in

the outcome of BMT.

To our knowledge, this is the first evidence

in

humans

of

interindividual extensive conservation in TCRPV-chain usage for the recognition of an intracellular biosynthesized peptide presented by an MHC class I molecule.

ACKNOWLEDGMENT

We thank Drs F. Koning and C.J.M. Melief for their critical reading and I. Curie1 for typing the manuscript.

REFERENCES

1. Goulmy E: Minor histocompatibility antigens and their role in transplantation. Transplant Rev 2:29, 1988

2. Schreuder GMTh, Pool J, Blokland E, van Els C, Bakker A,

van Rood JJ, Goulmy E: A genetic analysis of human minor histocompatibility antigens demonstrates Mendelian segregation indepen-

dent of HLA. Immunogenetics 38:98, 1993

3. Van EIS CACM, D'Amaro J, Pool J, Bakker A, van den Elsen PJ, van Rood JJ Goulmy E: Immunogenetics of human minor Histo- compatibility antigens: Their polymorphism and immunodominance.

Immunogenetics 35: 161, 1992

3a. Goulmy E, Schipper R, Pool J, Blokland E, Falkenburg F,

Vossen J, Gratwohl A, Vogelsang G, Van Houwelingen H, Van

Rood JJ: Minor histocompatability antigen mismatches influence

the development of GVHD after HLA genotypically identical bone

marrow transplantation. N Engl J Med (submitted)

4. Moss PAH, Moots RJ, Rosenberg WMC, Rowland-Jones SJ.

Bodmer HC, McMichael AJ, Bell J1: Extensive conservation of a

and

p

chains of the human T-cell antigen receptor recognizing HLA- A2 and influenza A matrix peptide. Proc Natl Acad Sci USA 88:8987, 199 I

5 . Bowness P, Moss PAH, Rowland-Jones SJ, Bell JI, McMichael

AJ: Conservation of T-cell receptor usage by HLA B27-restricted

influenza-specific cytotoxic T lymphocytes suggests a general pat-

tern for antigen-specific major histocompatibility complex class I

restricted responses. Eur J Imrnunol 23: 141 7, 1993

(4)

CONSERVATION OF TCR DV REGIONS 2481

tarini R, Nicolini G, Herly M, Parmiani G, Anichini A: T cell recep-

tor (TCR) Structure of autologous melanoma-reactive cytotoxic T lymphocyte (CTL) clones: Tumor infiltrating lymphocytes overex- press in vivo the TCRP chain sequence used by an HLA-A2-re- stricted and melanocytelineage-specific CTL clone. J Exp Med

178:1231, 1993

7. Dietrich P-Y, Caignard A, Diu A, Genevee C, Pic0 J-L, Henry-

Amar M, Bosq J, Angevin E, Triebel F, Hercend T Analysis of T- cell receptor variability in transplanted patients with acute graft- versus-host disease. Blood 80:2419, 1992

8. Yamanaka K, Kwok W, Mickelson EM, Masewicz S, Smith

F, Nepom GT: Selective T-cell receptor gene usage in allorecogni-

tion and graft-versus-host disease. Transplantation 55:1167, 1993

9. Villers D, Milpied N. Gaschet J, Davodeau F, Hallet M-M,

Bonneville M, Vi6 H: Alteration of the T-cell repertoire after bone

marrow transplantation. Bone Marrow Transplant 13:19, 1994 10. Dietrich PY, Caignard A, Lim A, Chung V, Pic0 JL, Pannetier C, Kourilsky P, Hercend T, Even J, Triebel E: In vivo T-cell clonal amplification at time of acute graft versus host disease. Blood 84:2815, 1994

1 1. Gorochov G, Debre5 V, Sadat-Sowti B, Sigaux F, Autran B:

Oligoclonal expansion of CD8+ CD57' T cells with restricted T-

cell receptor

p

chain variability after bone marrow transplantation.

Blood 83:587, 1994

12. Bruley-Rosset M, Miconnet I, Roger T, Seman M, Halle-

Pannenko 0: Comparison of the repertoire of T-cell lines and clones specific for minor histocompatibility antigens derived from immu- nized mice and from mice developing a graft-versus-host reaction. Transplant Proc 5:94, 1993

13. Hawes GE, Struyk L, Van den Elsen PJ: Differential usage

of T cell receptor V gene segments in CD4' and CD8' subsets of

T lymphocytes in monozygotic twins. J Immunol 150:2033, 1993

14. Struyk L, Kurnick JT, Hawes GE, van Laar JM, Schipper R,

Oksenberg JR, Steinman L, de Vries RRP, Breedveld FC, Van den Elsen PJ: T cell receptor V-gene usage in synovial fluid lymphocytes of patients with chronic arthritis. Hum Immunol 37:237, 1993

15. Falk K, Rotzschke 0, Stevanovic S , Jung G, Rammensee HG:

Allele-specific motifs revealed by sequencing of self-peptides eluted from MHC molecules. Nature 351:296, 1991

16. Hill AVS, Elvin J, Willis AC, Aidoo M, Allsopp CEM, Gotch

FM, Gao XM, Takiguchi M, Greenwood BM, Townsend ARM,

McMichael A 3 , Whittle HC: Molecular analysis of the association

of HLA-B53 and resistance to severe malaria. Nature 360:434, 1992 17. Rotzschke 0, Falk K, Stevanovic S, Jung G, Rammensee HG:

Peptide motifs of closely related HLA class I molecules encompass

substantial differences. Eur J Immunol 22:2453, 1992

18. Sutton J, Rowland-Jones S, Rosenberg W, Nixon D, Gotch

F, Gao X-M, Murray N, Spoonas A, Driscoll P, Smith M, Willis A,

McMichael A. A sequence p a e m for peptides presented to cytotoxic

T lymphocytes by HLA-B8 revealed by the analysis of epitopes and eluted peptides. Eur J Immunol 23:447, 1993

19. Falk K, Rotzschke 0, Grahovac B, Schendel DJ, Stevanovic S , Jung

G,

Rammensee HG: peptide motifs of HLA-B35 and B37 molecules. Immunogenetics 38:161, 1993

20. Kalams SA, Johnson RP, Trocha AK, Dynan MJ, Ngo HS, D'Aquila RT, Kurnick JT, Walker BD: Longitudinal analysis of T cell receptor (TCR) gene usage by human immunodeficiency virus

1 envelope-specific cytotoxic T lymphocyte clones reveals a limited

TCR repertoire. J Exp Med 179:1261, 1994

21. Pantaleo G, Demarest JF, Soudeyns H, Graziosi C, Denis F,

Adelsberger JW, Borrow P, Saag MS, Shaw GM, Sekaly RP, Fauci

AS: Major expansion of CD8' T cells with a predominant V/3 usage during the primary immune response to HIV. Nature 370:463, 1994

22. Lauzurica P, Bragado R, L6pez D, Galocha B, L6pez de

Castro JA: Asymmetric selection of T cell antigen receptor a and

P

chains in HLA-B27 alloreactivity. J Immunol 148:3624, 1992

23. De Bueger M, Bakker A, Bontkes H, van Rood JJ, Goulmy E: High frequencies of cytotoxic T cell precursors against minor histocompatibility antigens after HLA identical BMT Absence of correlation with GvHD. Bone Marrow Transplant 11:363, 1993