dystrophy
Morrée, A. de
Citation
Morrée, A. de. (2011, January 12). Functional protein networks unifying limb girdle muscular dystrophy. Retrieved from https://hdl.handle.net/1887/16329
Version: Corrected Publisher’s Version
License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden
Downloaded from: https://hdl.handle.net/1887/16329
Note: To cite this publication please use the final published version (if
applicable).
AHNAK redistributes upon Integrin inhibition in cultured myoblasts
Antoine de Morree1, Christian AJ Vogel1, Rune R Frants1, Silvère M van der Maarel1
1 Department of human genetics, Leiden university medical center, Leiden, The Netherlands
-Manuscript in preparation-
Abstract
AHNAK is a ubiquitously expressed 700 kDa protein. It is important in cell architecture/structure and calcium signalling. AHNAK knockout mice have a T-cell defect and L-AHNAK was shown to be important for calcium-dependent T-cell activation. In MDCK cells L-AHNAK is important for remodeling of the Actin cytoskeleton, in response to cell-cell contact formation. Moreover, in myelating Schwann cells L-AHNAK is involved in cell-matrix adhesion. We previously found that in skeletal muscle L-AHNAK directly interacts with the sarcolemmal maintenance protein Dysferlin, and this interaction is modulated by CAPN3. We hypothesized that L-AHNAK is important for muscle cyto- architecture. To investigate a potential role for L-AHNAK in cell adhesion we constructed a miniAHNAK protein, consisting of the N- and C-terminus connected by six repeat units. We show that miniAHNAK is a stable protein that retains described L-AHNAK functionalities. We used clonal IM2-miniAHNAK cells to test for a role in Integrin-mediated cell adhesion. We show that miniAHNAK rapidly redistributes in response to Integrin inhibition, supporting the hypothesis that in muscle cells AHNAK functions as a structural sensor.
Introduction
AHNAK (AHNAK nucleoprotein, MIM*103390) is a ubiquitously expressed giant protein of 700 kDa. It is expressed from mouse embryonic day 13 [140]. AHNAK is part of a larger family of repeat proteins that includes AHNAK2 (AHNAK nucleoprotein 2, MIM*608570) and Periaxin (PRX, MIM*605725) (Chapter 5). The AHNAK gene gives rise to multiple isoforms, the main ones resulting in proteins of 700 (L-AHNAK) or 17 kDa (S-AHNAK), which have largely overlapping localization (Chapter 5). L-AHNAK is a repeat protein that has the proposed domain structure of an N-terminal head (498 aa) and a C-terminal tail (1002 aa), separated by a large body of repeats (4300 aa, the standard repeat unit being 128 aa) [227]. The repeats are predicted to form a beta-propeller fold [146].
The functions of AHNAK are highly diverse and still under study. The protein is found in the cell nucleus [226], the cytosol [19,239], the cell membrane [19], at desmosomes [105] and in the lumen of a type of secretory vesicle, the enlargosome [26]. AHNAK responds to calcium signalling [19,52,91]. In addition, AHNAK appears to be important for cytoskeletal architecture [19,89,220,222]. In myelating Schwann cells AHNAK is involved in laminin-dependent cell adhesion [220], and in epithelial cells it is involved in formation of calcium- and e-cadherin- dependent cell-cell contacts [19]. AHNAK associates with filamentous Actin in epithelial, Schwann and cardiac cells [101]. Moreover, downregulation of AHNAK reduces cell-cell or cell-matrix adhesion, and impairs remodeling of the cortical Actin cytoskeleton [19]. Accordingly, AHNAK is strongly expressed in tissues and cells that suffer from a high degree of mechanical stress [220], such as epidermis and muscle [89,90].
Thus far no pathogenic mutations have been recorded for AHNAK, or its family members. However, two disease associations have been mentioned in the literature, which link AHNAK function to the muscle: 1) an interaction with Dysferlin and CAPN3 [118,119], two skeletal muscle proteins that individually cause Limb Girdle Muscular Dystrophy type 2 (LGMD2) [28], and 2) a polymorphism that affects the interaction between AHNAK and the L-type voltage gated calcium channel (LVGCC) and which is found in cardiomyopathy patients, but also in healthy controls [100].
Both associations indicate a pivotal role for AHNAK in muscle tissue.
In skeletal muscle cells L-AHNAK interacts with Dysferlin [119], a protein that is essential for calcium-dependent muscle membrane repair [13]. L-AHNAK and Dysferlin colocalize at the plasma membrane and in the absence of Dysferlin AHNAK is decreased at the sarcolemma [119]. The interaction between Dysferlin and L-AHNAK is direct and mediated via the C-terminus of L-AHNAK and the first C2 domain of Dysferlin [119]. The interaction is calcium independent [119], and regulated by CAPN3 proteolysis [118]. CAPN3 is a calcium-sensitive muscle-
specific protease, which cleaves L-AHNAK at its termini and thereby regulates the interaction between AHNAK and Dysferlin (Chapter 3) [118]. Loss of CAPN3 coincides with an increase of L-AHNAK at the sarcolemma (Chapter 3) [118]. This suggests that L-AHNAK is localized to the sarcolemma via Dysferlin, where it can be proteolyzed by CAPN3.
L-AHNAK was shown to directly interact with the intracellular β2 subunit of the LVGCC in cardiomyocytes [100]. L-AHNAK interacts with the LVGCC through its C-terminal domain, and has two interaction sites on the β2 subunit [99,100,102].
One site increases channel activity while the other results in a decrease of channel activity. It was hypothesized that L-AHNAK can fine-tune LGVCC activity in cardiomyocytes. In line with this, it was shown that L-AHNAK participates in recruitment and stabilization of LVGCC in T-cells [175,176]. This is important for T-cell activation as AHNAK deficient mice were shown to have impaired T-cell activation and have increased susceptibility to certain infectious pathogens [175,176].
Thus far no muscle phenotype was reported for AHNAK knockout mice [146,148]. It was hypothesized that the highly similar AHNAK2, which is also expressed in skeletal muscle (Chapter 5), can take over AHNAK function [146].
Indeed, recombinant AHNAK2 can also directly interact with Dysferlin C2A, albeit with less affinity [119]. And like AHNAK, AHNAK2 has cleavage motifs for CAPN3 (Chapter 4). However, nothing is known of AHNAK2 localization, for no AHNAK2 specific detection tool has been described yet [146]. In fact the commonly used AHNAK antibodies recognize both AHNAKs [146].
In skeletal muscle tissue AHNAK not only localizes to vesicles and the sarcolemma [119], but also to costameres (Vinculin and CAPN3 [118]) and T-tubules (DHPR and Dysferlin [119]). Where the costameres are important structural anchors, the T-tubules are membrane invaginations that are essential for excitation contraction coupling. This is mediated via calcium. It has been hypothesized that AHNAK governs excitation-contraction coupling [3], possibly by integrating diverse signals such as calcium and structure.
In skeletal muscle a connection between the Actin cytoskeleton and the extracellular matrix is maintained by the dystrophin glycoprotein complex.
In addition multiple Integrin isoforms are expressed that have been linked to muscular dystrophy. We have previously shown that AHNAK localizes to costameres [118], where Integrin molecules ensure adherence of the muscle fiber to the extracellular matrix (Chapter 3). We were therefore interested whether AHNAK is directly involved in muscle adhesion.
In this study we aimed to test whether there is a possible role for AHNAK in muscle cell adhesion. We used the modular organization of AHNAK to clone
a miniAHNAK, by analogy with mini-dystrophin. We show that miniAHNAK is a stable protein that behaves similar to endogenous AHNAK in described AHNAK cell models and in myogenic cells. Using IM2-miniAHNAK clonal cells we observed that miniAHNAK is rapidly recruited to the plasma membrane upon Integrin stimulation, whereupon the majority of the protein is lost from the cells.
Results
A recombinant miniAHNAK protein
Skeletal muscle expresses both AHNAK and AHNAK2 (Chapter 5). As there is currently no good AHNAK-specific antibody, we decided to clone AHNAK. It was shown for the repeat protein Dystrophin (DMD), which is mutated in Duchenne Muscular Dystrophy that reducing the number of repeats results in a largely functional protein in cell models [163]. Moreover mutations in the DMD gene that keep the open reading frame intact, most notably those that delete a large proportion of the repeated domains of dystrophin usually result in the milder Becker Muscular Dystrophy [145]. We therefore hypothesized that reducing the number of repeat units in AHNAK would also largely maintain protein function. Therefore we created a mini-AHNAK protein with a reduced number of repeats, sufficient to form a single beta-propeller unit (Figure 1A). We included an N-terminal FLAG- tag and a C-terminal triple HA-tag to allow for specific protein detection (Figure 1A). In addition we constructed protein variants with a fluorescent Cherry protein at the N-terminus. In order to enable stable but low cellular expression levels, a Ubiquitous Chromatin Opening Element (UCOE) [259] was cloned directly upstream of the CMV promoter. We transiently and stably expressed miniAHNAK in MCF7 cells (a reported AHNAK cell model [19]) and detected the protein on western blot. Both HA and FLAG specific antibodies recognize a single band of the predicted size (250kDa, Figure 1B), indicating that miniAHNAK is expressed as a stable protein. Moreover, clonal cells which contain the UCOE element show reduced silencing of the transgene, and simultaneously decreased miniAHNAK expression levels (not shown). The KIS antibody [19], which was raised against an epitope from the repeat units (Figure 1A), has less affinity for the miniAHNAK protein due to the reduced number of repeats (43 vs 6) and this suggests that KIS can be used as a detection tool specific for endogenous L-AHNAK. Immunostaining experiments on minAHNAK expressing MCF7 cells show that FLAG and HA signal colocalize, indicating again that the miniprotein is stable (Figure 1D). MiniAHNAK is found at the cell membrane and in a puncate cytosolic pattern reminiscent of vesicles. Additionally, HA and KIS signal colocalize (Figure 1E), suggesting that miniAHNAK is at the same sites as endogenous L-AHNAK. We conclude that
L-AHNAK
miniAHNAK
A B
250 kDa
120 kDa 250 kDa
120 kDa
UCOE + - - +
FLAG
HA
Loading control Stable Transient
C
HA - miniAHNAK KIS Merge
AHNAK-R
AHNAK-N AHNAK-C
FLAG HA
KIS E4/5
TAP
E4/5
FLAG HA
D
MCF7-miniAHNAK
H A (C O O H )
D API Flag (NH2)
MCF7-miniAHNAK
Figure 1: MiniAHNAK as a molecular tool to study L-AHNAK function. A) Schematic representation of the miniAHNAK construct, which includes the complete N- and C-terminal domains and the 4 most C-terminal repeat units. Included are available L-AHNAK and miniAHNAK protein detection tools. MiniAHNAK contains an N-terminal FLAG-tag and a C-terminal triple HA- tag. Additional variants contain a Cherry-tag. B) MCF7 cells were transiently or stably transfected with miniAHNAK with or without Ubiquitous Chromatin Opening Element (UCOE) and analyzed on western blot for HA and FLAG signal. C+D) MCF7 cells were transfected with miniAHNAK and analyzed by indirect immunfluorescence for HA and FLAG (C) and HA and KIS (D).
miniAHNAK is expressed as a stable protein and shows localization reminiscent of L-AHNAK.
MiniAHNAK retains L-AHNAK functionalities
To confirm that miniAHNAK retains endogenous L-AHNAK functionalities we seeded clonal MCF7-miniAHNAK cells at low and high confluency and detected miniAHNAK protein by indirect immunfluorescence (Figure 2A). At low confluency miniAHNAK is mostly cytosolic. It localizes to the cytoplasm in puntate structures reminiscent of vesicles and additionally shows a fibrous staining. Contrarily, at high confluency miniAHNAK is shifted to the cell membrane and accumulates at cell-cell contacts (Figure 2A), which is in complete agreement with previous observations for endogenous L-AHNAK ([19] and data not shown). Interestingly, both at low and high confluency the HA and FLAG signal show strong localization, indicating that the full-length protein changes location. L-AHNAK was previously described to interact with F-Actin and Actin-binding proteins. Therefore we hypothesized that the fibrous staining observed in low confluent cells refers to the Actin cytoskeleton.
To test this we performed costaining experiements for miniAHNAK and Actin, and observed complete colocalization (Figure 2B). This suggests that, like L-AHNAK, miniAHNAK is at the Actin cytoskeleton. Our previous studies showed that CAPN3 can proteolyse L-AHNAK at four distinct cleavage sites [118]. To verify that miniAHNAK can act as a substrate for CAPN3, we coexpressed miniAHNAK with CAPN3 and analyzed the protein lysates on western blot for cleavage (Figure 2C).
We observed a loss of full-length miniAHNAK upon CAPN3 co-expression, and a concomitant increase in cleavage fragments of the predicted size. This shows that, like endogenous L-AHNAK, miniAHNAK can be recognized and cleaved by CAPN3.
We therefore conclude that miniAHNAK shows behaviour reminiscent of L-AHNAK.
MiniAHNAK stability and localization in myogenic IM2 cells
We are mainly interested in the role of AHNAK in skeletal muscle. Therefore we used the IM2 myogenic model system [189] to create clonal miniAHNAK expressing IM2 cells. We first verified miniAHNAK expression levels by quantitative RT-PCR (Figure 3A-C), with primersets specific for endogenous mouse L-AHNAK and the human miniAHNAK. Like L-AHNAK, miniAHNAK expression levels are stable throughout myogenic differentiation. We next verified that introduction of the miniAHNAK construct did not affect the myogenic capacity of the IM2 cells. Indeed, the RNA levels of Desmin, which is an early marker of differentiation, are similarly increased in wild-type IM2 and IM2-miniAHNAK cells during differentiation (Figure 3A+B). MiniAHNAK RNA expression levels are ~30-fold lower that endogenous L-AHNAK. This might be explained the UCOE, which controls the CMV promoter
*
* 250 kDa
120 kDa 100 kDa 250 kDa 120 kDa 100 kDa
250 kDa 120 kDa 100 kDa 72 kDa 55 kDa
230 kDa
60 kDa 40 kDa 250 kDa
90 kDa
miniAHNAK
Flag HA
CAPN3 - - ++ + ++
miniAHNAK
CAPN3 + - + - + -
C A
B
DAPI HA FLAG Merge
DAPI HA Actin Merge
Low ConfluencyLow ConfluencyHigh ConfluencyHigh Confluency
nt
Figure 2: MiniAHNAK retains L-AHNAK functionalities. A+B) MCF7 cells expressing miniAHNAK were analyzed by indirect immunofluorescence at low and high confluency for HA and FLAG (A) or HA and Actin (B). C) HEK293T cells were transiently transfected with miniAHNAK and CAPN3. Cells were analyzed on western blot for cleavage with FLAG (left panel) and HA (right panel) specific antibodies. The cleavage sites are schematically represented in the cartoon. Arrows denote miniAHNAK (-fragments), asterisks denote background bands.
activity (Figure 3C).
We next incubated IM2-miniAHNAK myoblasts and myotubes (Figure 3D) with the translation inhibitor cyclosporine, to study stability and turnover of the miniAHNAK protein. Like endogenous L-AHNAK, miniAHNAK protein levels decrease after 4h, indicating a similar half-life and turnover. In myotubes, the half-life of both proteins is increased to 24h. MyoD and Tubulin have a reported short and a long half-life respectively [141], and were used as controls. In addition we measured the half-life of the AHNAK interaction partner Dysferlin, showing a similar decay in myoblasts and increased stability in myotubes.
To study miniAHNAK localization we performed immunofluorescent staining experiments on IM2-miniAHNAK myoblasts and myotubes (Figure 3E-F).
In myotubes miniAHNAK is found in the cytosol and at the cell membrane, and it colocalizes with KIS signal (Figure 3E). MiniAHNAK localization does not change with differentiation. In differentiated myotubes miniAHNAK localizes to membrane protrusions and shows accumulation at cell membrane patches. We conclude that also in muscle cells miniAHNAK has similar localization as endogenous L-AHNAK.
This indicates that also in muscle cells miniAHNAK has similar behaviour as L-AHNAK.
MiniAHNAK shows rapid redistribution in response to Integrin inhibition It was shown by others that AHNAK is involved in organizing cytoskeleton architecture at cellular adhesion contacts [19,220]. We predicted that AHNAK serves a similar role in muscle cells. Important cell-matrix attachment sites in skeletal muscle (costameres) are based on the Dystrophin glycoprotein complex and on Integrins. We previously observed colocalization between L-AHNAK and the focal adhesion protein Vinculin at constameres in skeletal muscle cryosections [118]. This indicated that AHNAK localizes to muscle adhesion sites. We used our miniAHNAK IM2 cell model to test whether AHNAK is involved in Integrin- based Focal Complexes. We incubated IM2-miniAHNAK myoblasts with RGD peptide, which competes for the Fibronectin binding site on Integrins (Figure 4A). Incubation at concentrations above 1mM resulted in a complete loss of cell adhesion both in myoblasts as myotubes (not shown), whereas a control peptide (DGR) had no effect. We therefore titrated the peptide and determined that at a concentration of 1-10 µM the cells remained adherent for 48h. We subsequently incubated the cells with 1µM RGD and visualized miniAHNAK at different time points by means of the fluorescent Cherry protein-tag (Figure 4A). Prior to the RGD stimulus miniAHNAK is found in the cytosol and at the cell membrane, as before (Figure 3D). However, 10 minutes incubation with RGD peptide resulted in an accumulation of miniAHNAK in cytoplasmic bodies. This process continued over
A
C
B
IM2 IM2-miniAHNAK
FLAG HA
miniAHNAK
AHNAK Dysferlin 0 2h 4h 8h 24h 0 3 8 24
M yoblast M yotube
250 250
250 250 130 10050 40
Tubulin M yoD
D
E
AHNAK H A (C O O H )
D A P I
F
MyotubeMyoblast D API FLAG (NH2)Dysferlin
IM2
0 5 10 15 20 25 30
miniAHNAK AHNAK miniAHNAK AHNAK N/A
0 1 2 3 4 5 6 7 8 9 10
Desmin miniAHNAK AHNAK AHNAK2 0 1 2 3 4 5 6 7 8 9 10
Desmin miniAHNAK AHNAK AHNAK2 IM2-miniAHNAK
day1day2 day3day4
day1day2 day3day4
day1day2 day3day4
Ct-value Relative abundance
Relative abundance
Figure 3: MiniAHNAK in IM2 myoblasts and myotubes. A+B+C) Quantitative RT-PCR on clonal IM2-miniAHNAK cells at various stages (day 0, 1, 3 and 5) of myogenic differentiation with primer sets specific for miniAHNAK, endogenous L-AHNAK (AH1C/1C1?) and Desmin. Hprt was
used as a reference gene. A+B) Expression levels during myogenic differentiation are similar for Desmin, AHNAK and miniAHNAK in IM2 (A) and IM2-miniAHNAK (B) cells. C) AHNAK expression was compared in IM2 and IM2-miniAHNAK cells. Non-corrected Ct-values are on the Y axis. D) IM2-miniAHNAK myoblasts and myotubes were treated with the translation inhibitor cyclosporin for indicated times and analyzed on western blot for endogenous L-AHNAK and Dysferlin and miniAHNAK. Tubulin and MyoD were used as control proteins with long and short half-life, respectively. E) IM-miniAHNAK myotubes show colocalization of miniAHNAK and AHNAK. F) IM2- miniAHNAK myoblasts and myotubes were analyzed for miniAHNAK and Dysferlin.
DAPIminiAHNAKDysferlin
0 10’ 2h 4h 24h
A
B
250 kDa
250 kDa
Loading control
HA FLAG -
RGD
10’ 30’ 2h 4h 24h 24h 0
Figure 4: MiniAHNAK redistribution in response Integrin inhibition. A) IM2-miniAHNAK myoblasts were treated with RGD peptide for indicated times and analyzed for Cherry-
miniAHNAK signal and Dysferlin (green). Nuclei are indicated in blue (DAPI). B) As in A, but cells were analyzed on western blot for HA and FLAG signals.
time and reached its peak at 8h. Concomitant with the recruitment of miniAHNAK is the loss of signal at other sites. After 24 hours the resting situation is restored, though the overall miniAHNAK signal intensity appears to be decreased. This suggested that miniAHNAK was secreted or proteolitically degraded. It has been shown that L-AHNAK is found in enlargosome vesicles which are secreted upon calcium signaling [52,53]. To provide additional support for RGD-induced secretion of miniAHNAK we repeated the experiment and measured miniAHNAK protein content on western blot (Figure 4B). Full-length miniAHNAK decreases over time, with a bottom at 8h. At 24 normal levels are restored, in agreement with the immunofluorescence data. No cleavage fragments could be visualized on western blot (not shown). This indicates that AHNAK rapidly responds to Integrin inhibition and is lost from the cells.
Discussion
We have shown that a recombinant miniAHNAK protein shows similar localization and behaviour as endogenous L-AHNAK. Using this recombinant miniprotein as a tool we investigated the response of AHNAK to Integrin inhibition and observed that AHNAK rapidly shifts localization, and is lost from the cells.
Previous data from others showed that AHNAK can translocate to the cell membrane upon the formation of cell-cell contacts [19]. We observed a similar response for miniAHNAK, indicating that miniAHNAK retains AHNAK function.
Interestingly, at both high and low confluency strong colocalization between the FLAG and HA signal was apparent. This shows for the first time that the full-length protein shifts location and not a proteolytic AHNAK fragment.
Previous studies showed that AHNAK is important for cell adhesion. It organizes the intracellular Actin cytoskeleton. In skeletal muscle the internal Actin cytoskeleton is connected to the extracellular matrix through the Dystrophin Glycoprotein complex, and via Integrin-based focal adhesion complexes. We previously showed that AHNAK directly interacts with the muscle proteins Dysferlin [119] and CAPN3 [118] (Chapter 3). Both of these proteins were implicated in muscle adhesion (Chapters 2 and 4). In immuoprecipitation experiments Dysferlin was shown to interact with the focal adhesion component Vinculin (Chapter 2). Moreover, additional Focal Complex proteins were identified in the Dysferlin protein complex by mass spectrometry. CAPN3 was shown to direct local cytoskeleton remodeling (Chapter 4) and its activity results in proteolytic turnover of focal adhesion proteins and Integrin-based Focal Complexes [242]. Given that L-AHNAK colocalizes with Dysferlin at the sarcolemma [119] and with CAPN3 at the costameres and that it can act as a substrate for CAPN3 [118] we hypothesized that it is important at
Integrin based cell contacts.
Upon Integrin inhibition by extracellular RGD peptides the formation of cell-matrix contacts is blocked, and endocytosis of Integrins is enhanced. We hypothesize that cellular adhesion through Integrins is sensed by AHNAK and results in the recruitment of AHNAK into enlargosomes. We therefore believe that also at costameres and focal adhesions AHNAK is important for linking the Actin cytoskeleton. Enlargosome vesicles undergo exocytosis in response to calcium and as a result AHNAK is secreted. The function of extracellular AHNAK is unclear [26,52,53,206]. AHNAK autoantibodies have been reported in patients suffering from SLE [230].
In myelating Schwann cells, AHNAK is involved in the organization of the cortical Actin cytoskeleton [220]. Moreover, the protein is important for laminin- based cell adhesion [220]. These data are consistent with our findings and suggest a common function of AHNAK in regulating the intracellular cytoskeleton around cell-matrix and possibly cell-cell based interactions.
Methods and Materials
Cell culture
Mouse IM2 myoblast were maintained under permissive conditions at 33°C and 10% CO2 in DMEM (61965, GIBCO) supplemented with L-Glutamine, 1% Pen/
Strep (Gibco-BRL), 20% FCS, IFN-γ, and Chick embryo extract. For differentiation cells were grown to 70% confluency and switched to DMEM (61965) supplemented with 10% HS, L-Glutamine, and 1% Pen/Strep. MCF7 cells were maintained in Dulbecco's modified Eagle's medium (Gibco-BRL) supplemented with 10% FCS, 1% Pen/Strep.
RGD peptides (SRGDG penta-peptide, Sigma) was dissolved in water and added to the cells at 1µg/µl.
Antibodies
The following antibodies were used in this study: RaAHNAK (KIS 1;5,000), MaAHNAK (Abnova, 1;500), MaHA (cell signalling 1;2,000), RaFLAG (Sigma 1;5,000), GaMousealexa488 (Molecular Probes), GaRabbitalexa594 (Molecular Probes) at 1;1,000 and 1;2,000, respectively. GaRabbitIRDye800 and GaMouseIRDye680 (Westburg) were used at 1;5,000 for western blotting.
RNA extraction and cDNA synthesis
RNA was extracted from homogenized tissue or cultured cells with a kit (Machery- Nagel) according to manufacturers protocol. 1µg RNA was used as input for a
cDNA reaction (Fermentas) according to manufacturers protocol. Genomic DNA was digested on the column and cDNA was purified with a gel-extraction kit (Machery-Nagel).
Polymerase Chain Reaction
All primers were designed with the webtool Primer3 (frodo.wi.mit.edu/primer3/), with mispriming against human or rodent databases. Quantitative PCR reactions were performed with SYBRgreen, in 15µl reaction volume with 3ng cDNA input.
Cloning
MiniAHNAK was constructed by a three step PCR. First the C-terminus was amplified from human genomic DNA, and cloned into pCTAPa (Invitrogen) with restriction sites for XhoI and EcoRI. A silent mutation was introduced to create an internal EcoRI site. Next the C-terminal repeats were amplified and cloned into the vector with EcoRI and BamHI. Finally, the N-terminus was amplified from human skeletal muscle cDNA and cloned with enzymes BamHI and NotI. FLAG and HA- tags were introduced in the primers. Additional Cherry sequence was amplified from pCherry plasmid (Invitrogen) and introduced at the NotI site. MiniAHNAK sequence was confirmed by direct sequencing (LGTC, Leiden, the Netherlands).
Primer sequences were: NH2FW1 CTGATTGCCCGGGCATGGACTACAAGGATGAC GACGATAAGGGCGAGAAGGAGGAGACAACC, NH2RV1: AGTCAGATGGATCCAGGTT TCTGAATAATCATTTCAG, RepeatsFW2: ACGTACCGGATCCAAGATCTCCATGCCTGACT
TT, RepeatsRV2: TGGACGTGAATTCGGCCTTCGAAATCCAGACG,
COOHFW3: ACGTCATGAATTCCGTCTGGATTTCGAAGGCC, COOHRV3:
GATCATGCTCGAGAGCGTAGTCTGGGACGTCGTATGGGCTCTTTCTTTGTGGAAACTGA
Transfection
Cells were plated in 6 well plates and grown to 50% subconfluence. Cells were transfected with FuGENE-6 (Roche Applied Science), according to manufacturer’s protocol. To create clonal cell lines, transfected cells were grown in culture medium supplemented with Neomycin (Invitrogen).
Western blot
Cells were lysed directly in Llaemli sample buffer, boiled and loaded onto SDS- PAGE gels. Proteins were separated and blotted onto PVDF membranes. For L-AHNAK, gels were blotted onto nitrocellulose. Blots were washed, blocked in 4%
mPBS for 30 min, and incubated with primary antibody diluted in blocking buffer for 2h at RT. Subsequent washes in PBS-tween were followed with a 1h incubation with secondary antibody in the dark. MaAHNAK was detected with HRP. Blots were
washed and scanned with an odyssey scanner (Licor, Lincoln, Nebraska, USA).
Immunostaining
Cells were fixed in formalin solution for 10 min, following by permeabilization in 0.3% Triton (Sigma) for 5 min. Cells were washed, blocked in 1% BSA (Sigma) for 10 min, and incubated with 1st antibody 2h RT. Cells were subsequently washed 3x and incubated with 2nd antibody for 1h RT. Cells were washed in PBS and mounted onto slides with AquaPolymount supplemented with DAPI).
Acknowledgements
We thank Dr M. Antoniou for sharing the UCOE plasmids
