pGEM-cPSY1 The 1317 bp full-length VvPSY1 was PCR-amplified from cDNA (using the primers VvPSY5’-ATG and VvPSY3’-STOP) and cloned into pGEM
1
0
0
Hele tekst
GERELATEERDE DOCUMENTEN
We compute the statistics of thermal emission from systems in which the radiation is scattered chaotically, by relating the photocount distribution to the scattering matrix —
We compute the statistics of thermal emission from Systems in which the radiation is scattered chaotically, by relating the photocount distribution lo the scattering
The question seems particularly relevant if you are a bird and you are heading for Chicago, where the annual spring migration is just reaching its peak.. Perched on the edge of
After this, the focus will shift to a framework developed in this research, based on information from literature, information from the Eosta case and the
These data indicate that the two-step barcoding scheme can suc- cessfully be used for sample multiplex barcoding and sequencing of multiple long-range PCR amplicons on a single
Transcranial direct current stimulation of the anterior cingulate cortex impairs sustained attention
Specifically, with a single-blind, sham-controlled, between-subjects design, we tested whether anodal stimulation of the right dorsolateral prefrontal cortex (DLPFC) or of
This again, concluded from talking to older ‘native’ Dutch residents, the majority of whom have been living in the neighborhood for some years, may not necessarily display
VvPSY1_5’-ATG ATGTCTGTTGCTCTGTTGTGGATTG 60 Amplifies the full-length phytoene synthase 1 encoding gene (VvPSY1) from cDNA (1317 bp). VvPSY1_3’-STOP
