The handle http://hdl.handle.net/1887/47933 holds various files of this Leiden University dissertation
Author: Janson, David
Title: Development of human skin equivalents mimicking skin aging : contrast between papillary and reticular fibroblasts as a lead
Issue Date: 2017-04-19
Marine derived nutrient improves epidermal and dermal structure and prolongs the lifespan of
reconstructed human skin equivalents
Marion Rietveld
1, David Janson
1, Rachida Siamari
1, Jana Vicanova
2, Maja Troest Andersen
3, Abdoelwaheb El Ghalbzouri
11
Department of Dermatology, Leiden University Medical Center, Leiden, The Netherlands
2
DermData, Prague, Czech Republic
3
Ferrosan A / S, Soeborg, Denmark
Journal of Cosmetic Dermatology, 2012, 11, 213-222
Abstract
Imedeen is a cosmeceutical that provides nutrients to the skin. One of its active ingredi- ents is the Marine Complex (MC). The aim of this study was to evaluate whether MC affects skin morphogenesis differently in female and male human skin equivalents (HSEs).
HSEs were established with cells obtained from female or male donors between 30 and 45 years of age and cultured for 7 or 11 weeks in the presence or absence of MC.
Using immunohistochemistry, we examined early differentiation by keratin 10 expression, (hyper)proliferation by keratin 17 and Ki67, and basement membrane composition by laminin 332 and collagen type VII. In addition, the expression of collagen type I and the secretion of pro-collagen I were measured.
MC strongly increased the number of Ki67 positive epidermal cells in female HSEs.
In the dermis, MC significantly stimulated the amount of secreted pro-collagen I and in- creased the deposition of laminin 332 and collagen type VII. Furthermore, MC prolonged the viable phase of HSEs by slowing down its natural degradation. After 11 weeks of culturing, the MC treated HSEs showed higher numbers of viable epidermal cell layers and a thicker dermal extracellular matrix compared to controls. In contrast, these effects were less pronounced in male HSEs.
The MC nutrient positively stimulated overall HSE tissue formation and prolonged the longevity of both female and male HSEs. The ability of MC to stimulate the deposition of basement membrane and dermal components can be used to combat human skin aging in vivo.
Introduction
On macroscopic level, human skin is the best available biomarker of aging. During this process, the skin loses its structural and functional characteristics. The most pronounced modifications occur in the dermis, where a decrease in the deposition of extracellular matrix (ECM) components has been reported (1). This lower production leads to a disorganized and imbalanced ratio of ECM components that affects the dermal-epidermal junction (DEJ) and eventually the epidermal compartment. At the basement membrane zone, the DEJ flattens with aging, which results in a decreased synthesis of basement membrane proteins such as laminins and collagens, leading to weaker attachment of the epidermis to the dermis (2). In turn, this leads to lower keratinocyte cell activity reflected by thinning of the epidermis by 10–50% between the age of 30 and 80 years (3, 4). In addition to keratinocytes, the numbers of melanocytes and Langerhans cells also diminish in the epidermis (2). Furthermore, studies have shown that during aging, the number of dermal papillae decreases per surface area (5). These dermal-epidermal alterations lead to wrinkles, discoloration, telangiectasia and elastosis (6).
As the skin is a hormone sensitive organ, different hormones play a major role in the structure and function of both male and female skin (7). For example, male skin is thicker than female skin and contains more collagen and elastin. Furthermore, the structure and maintenance of male skin differs from female skin due to larger pores and a higher production of sebum (8). Despite these differences, the outcome of intrinsic aging processes is similar between women and men.
The cellular processes that contribute to skin aging (e.g. cell senescence) can be studied in mouse models or in conventional two-dimensional monolayer cell cultures.
In the latter model, the communication between the dermal and epidermal compartment cannot be studied, while this interaction is of crucial importance in controlling processes leading to proper skin homeostasis. Mouse models do not represent the human skin environment and are therefore less suitable to study human skin aging. In contrast to mouse models and monolayer cell cultures, reconstructed human skin equivalents (HSEs) contain a microenvironment that is highly similar to that of in vivo human skin, which makes them an attractive tool to study human skin aging in vitro. HSEs are three- dimensional culture systems engineered by seeding human keratinocytes onto a three- dimensional dermal matrix populated with human fibroblasts. After cell attachment, the culture is first kept under submerged conditions to allow keratinocyte proliferation.
Thereafter, the HSE is cultured at the air-liquid (A/L) interface to air-expose the epidermal compartment and to further induce keratinocyte proliferation and differentiation. Under these conditions, a HSE is formed that shows high similarity with the native tissue from which it was derived (9, 10). The HSEs are also easy to modulate, which allows generation
of skin models consisting of epidermal and dermal cells isolated from different types of donors.
Over the last decade, our understanding of skin aging has increased and a large num- ber of cosmeceuticals has been documented, claiming to prevent, counteract or reverse degenerative alterations in skin aging (11). One of such cosmeceuticals is ImedeenTM, an oral skin care product. The aim of this skincare product is to provide a combination of nutrients to the skin from within to improve the overall structure, appearance and the quality of the skin. Imedeen’s main ingredients include vitamin C, zinc and, the subject of this study, Marine Complex (MC). MC consists of fish protein polysaccharides similar to skin ECM (12). Several studies have proven the effects of ImedeenTM ingredients at a cellular level (13, 14). Human studies have also demonstrated clinically visible and objectively measurable effects on aging female skin (12, 15). The present study was designed to investigate the effects of MC, one of the active ingredients of ImedeenTM, in HSEs generated with cells obtained from either middle aged female or male skin donors. We examined whether MC affects epidermal morphology, basement membrane composition, pro-collagen type I secretion and whether observations from earlier in-vivo studies in middle aged females could be mimicked in these skin models (14, 15). Finally, we also evaluated whether MC improves the quality of HSEs after a prolonged culture period.
Materials and Methods
Cell culture
Cultures of primary normal human epidermal keratinocytes (NHEK) and primary normal human dermal fibroblasts (NHDF) were established from human mammary skin cells obtained from female donors aged 35, 40 and 45 years, and from human abdominal skin surgery from male donors aged 31, 35, 42 and 45 years old. Keratinocytes and fibroblasts were isolated as described earlier (16). In short, human dermis and epi- dermis were separated through overnight incubation of the skin with dispase II (Roche Diagnostics Nederland B.V., Almere, The Netherlands). Epidermis was incubated with trypsin (BD Biosciences, Breda, The Netherlands) at 37°C for 15 minutes. After trypsin inactivation, the cells were filtered with a 70µm cell strainer (BD Biosciences, Breda, The Netherlands), and cultured in keratinocyte medium at 37°C and 7.3% CO2 until subcon- fluency. Keratinocyte medium consisted of 3 parts Dulbecco’s modified Eagle’s medium (DMEM, Gibco/Invitrogen, Breda, The Netherlands) and 1 part Ham’s F12 medium (Gibco/Invitrogen) supplemented with 5% fetal bovine serum (FBS, HyClone/Greiner, Nürtingen, Germany), 0.5µM hydrocortisone, 1µM isoproterenol, 0.1µM insulin (Sigma-
Aldrich, Zwijndrecht, The Netherlands), 100 U/mL penicillin and 100µg/mL streptomycin (Invitrogen). Fibroblasts were isolated from the dermis with collagenase II (Invitrogen) and dispase II (ratio 3:1 and 3 ml/g dermis) at 37°C for 2 hours. The cells were filtered with a 70µm cell strainer, and cultured in fibroblast medium at 37°C and 5 % CO2 until subconfluency. Fibroblast medium consisted of DMEM supplemented with 5% FBS, 100 U/mL penicillin and 100µg/mL streptomycin. Early passage (passages 2–3) were used for experiments.
Fibroblast-derived matrix
Fibroblast-derived matrices (FDMs) were generated as described earlier (16). In short, 400.000 fibroblasts obtained from either male or female donors were seeded into a polyester permeable support (6 well plates with 0.4 µM pore size Transwell inserts, Corning Incorporated, Schiphol-Rijk, The Netherlands) in the presence or absence of MC (figure 1). The FDMs were supplemented with 5% FBS, penicillin (100 IU/mL) and streptomycin (100 µg/mL), 50 µM ascorbic acid phosphate (Sigma-Aldrich). Culture medium was refreshed twice a week. FDMs were generated with fibroblasts obtained from either female or male donors.
Reconstructed humans skin equivalent
FDMs were seeded with 500.000 NHEKs (passage 1-2) per HSE obtained from either female (f-HSE) or male (m-HSE) donors. Cultures were incubated overnight in keratinocyte medium as described above, but with reduced FBS (1%), 53µM selenious acid, 10mM L-serine, 10µM L-carnitine, 1µM dL-α-tocopherol-acetate, 250µM ascorbic acid phos- phate, 12µM bovine serum albumin and a lipid supplement containing 25µM palmitic acid, 15µM linoleic acid and 7µM arachidonic acid (Sigma-Aldrich). The HSEs were then cultured at the air-liquid interface in supplemented keratinocyte medium as described above, but without FBS. Culture medium was refreshed twice a week. After 7 and 11 weeks of air-exposed culture, the HSEs were processed for analysis. To one part of the 7-week old HSEs, MC was added and these HSEs were cultured for an additional 4 weeks at the air-liquid interface (Figure 1).
Supplementation of Imedeen Marine Complex
HSEs were supplemented twice a week with MC at a final concentration of 70 µg/mL starting at two different time points: at the start of the air-exposed culture phase or after 7 weeks of culturing (Biomarine Complex batch number: 199888).
RNA isolation
RNA was isolated from monolayer fibroblast cultures, treated with MC (70 ug/mL) or untreated controls, using the RNEasy kit (Qiagen, Venlo, The Netherlands), according to the manufacturer’s instructions. RNA was extracted after 60 minutes and 24 hours.
Q-PCR analyses
cDNA was generated of 1µg RNA using the iScript cDNA synthesis kit (BioRad, Veenen- daal, The Netherlands) according to manufacturer’s instructions. PCR reactions were based on the SYBR Green method (BioRad) and consisted of 2x Sybr Green Mastermix, 1ng cDNA template and 500 nM of forward and reverse primers. The PCRs were run on the CFX384 system (BioRad). The PCR cycles were: 3,5 minutes at 95 C to activate the polymerase, 45 cycles of 10 sec 95 C and 30 sec 60 C, followed by the generation of a melt curve. Primers were checked before on dilution series of normal fibroblasts cDNA.
Reference genes were analyzed with the GeNorm method (17). Expression analysis was performed with the BioRad Software (CFX Manager) and was based on the delta delta Ct method with the reference genes that were stably expressed in the GeNorm analysis. The primers are listed in Table 1.
Target Sequence Forward Sequence Reverse
Col1A1 ATGTTCAGCTTTGTGGACCTCCGG CGCAGGTGATTGGTGGGATGTCT
EI24 TTCACCGCATCCGTCGCCTG GAGCGGGTCCTGCCTTCCCT
SND1 CGTGCAGCGGGGCATCATCA TGCCCAGGGCTCATCAGGGG
Table 1: Primers used in this study. SND1 was used as reference gene.
Morphological and immunohistochemical analysis
HSE cultures were washed in PBS, one half was snap-frozen in liquid nitrogen while the other half was fixed in 4% formaldehyde and paraffin embedded (FFPE). Global morphological analysis was performed on 5 µM FFPE sections through staining with haematoxylin and eosin. Immunohistochemical analysis was either performed on FFPE sections or cryosections. 5µm FFPE sections were rehydrated through xylene and ethanol.
5µm cryosections were fixed with acetone. Primary antibodies used are shown in Table 2.
Following incubation with the primary antibody, sections were stained with avidin-biotin- peroxidase system (GE Healthcare, Buckinghamshire, UK), as described by manufacturer’s instructions. Staining was visualized with 3-amino-9-ethylcarbazole (AEC). All sections were counterstained with haematoxylin.
Antigen (antibody clone) Supplier
Collagen Type I Sigma
Keratin 17 (KS6.KA12)/( CK-E3) Sanbio, Novus
Keratin 10 (DE-K10) Abcam
Collagen VII (PHM12)/(LH7.2) Chemicon
Laminin 332 (BM165) Kind gift from Dr. A. Aumailly
Ki67 (MIB1) DAKO
Table 2: Primary antibodies used in this study
Protein determination by enzyme-linked immunosorbent assay
Secreted human pro-collagen type I in the culture medium of HSEs was quantified by enzyme-linked immunosorbent assay (MetraCICP ELISA kit; Quidel Corporations, CA, USA). Culture medium of the HSEs was collected at weeks 1, 3, 5, 7, 9 and 11. Measure- ments and data analysis were performed according to the manufacturer’s procedure.
Estimation of proliferation index
The proliferation index was calculated as the number of Ki67 positive basal keratinocytes divided by the total number of basal keratinocytes counted. A minimum of 50 basal cells was counted in three areas of sections of two different samples at a magnification of 200x.
The resulting data are expressed as the mean of the two independent experiments ± SD.
Statistics
Each culture was performed in duplicate. Statistical significance was determined using the two-tailed Student’s t-test.
Results
Marine Complex increased expression of collagen type I in human fibroblasts
To evaluate whether MC affects FDM formation and epidermal morphogenesis, we first evaluated its effect on monolayer cultures of fibroblasts isolated from two different female and male donors. After 1 and 24 hrs of supplementation we determined the expression of collagen type I by quantitative PCR. As shown in figure 2, addition of 70µg/ml MC to human female fibroblasts resulted in a significant, two-fold increase of collagen type I mRNA after 24 hrs. This increase was less pronounced in male fibroblasts (data not shown).
Figure 1: Scheme illustration supplementation of MC at the start of the cultures and addition to 7 week old skin cultures. The cultures were processed for analyses on week 7 and 11. The FDMs serving as control are not included in this scheme.
Figure 2: Q-PCR analyses showing increased average expression of collagen type I mRNA in female fibroblasts (two donors) after stimulation with MC (white bars) compared to untreated controls (black bars). The normalized fold expression is based on the reference genes SND1and EI24. Error bars show SEM. *p<0.05.
Marine Complex increased number of viable cell layers
Next, we determined the effect of MC on epidermal morphology in f-FDMs and m- FDMs (figure 3). For this purpose, HSEs were cultured for either 7 weeks (figure 3a, b) or 11 weeks (figure 3c, d), in the presence or absence of MC. To evaluate whether MC is able to reactivate the epidermis after 7 weeks, we supplemented MC to 7-week old HSEs and cultured them for an additional 4 weeks (figure 1). As shown in figure 3, HSEs supplemented with MC and cultured for 7 or 11 weeks showed significantly more viable cell layers in f-HSEs (around 8 layers ± 1), compared to untreated f HSEs.
In m-HSEs, this effect was also significant in 7-week old cultures but less pronounced in 11-week old m-HSEs (figure 3A, 3B), (around 7 layers ± 1). When the results of the different donors were combined, the effect of MC was more pronounced (figure 3C, 3D).
Irrespective of the conditions, in all experiments a nicely differentiated epidermis was formed containing all strata including stratum basale, stratum spinosum and stratum corneum. Supplementation of MC to HSEs significantly increased the number of cell layers in 7-week old cultures (figure 3C). The effect of MC was still significant in 11-week old f-HSEs but was less pronounced in m-HSEs (figure 3D). Addition of MC in week 7 also significantly increased the number of cell layers in both f-HSEs and m-HSEs.
Epidermal morphogenesis was not altered by Marine Complex
To examine whether MC influences the differentiation program we evaluated the expres- sion of early differentiation marker keratin 10 (K10) in HSEs using immunohistochemistry.
K10 was expressed in all suprabasal cell layers irrespective of the presence or absence of MC, indicating that the early differentiation program occurs normally as in native tissue.
The activation and hyperproliferation associated marker keratin 17 (K17) was absent in all HSEs, indicating that MC does not induce epidermal stress. Epidermal cell proliferation was clearly affected by the presence of MC as demonstrated by the ki67 marker. In f-HSEs, supplementation of MC resulted in an increased number (± 8 cells/ 100 basal cells) of proliferating cells compared to the controls (figure 4A). In m-HSEs this effect was also significant, but less pronounced (figure 4B). However, the number of proliferating basal cells in m-HSEs was significantly increased in 7-week old cultures supplemented with MC (figure 5, black bars). A similar effect was observed in the 11-week old cultures (figure 5, white bars). In addition, when MC was added from week 7 on and cultured for an additional 4 weeks, the increase of proliferating cells was still significant compared to the control (figure 5, dashed bar). In f-HSEs, the effect of MC on cell proliferation was more pronounced (data not shown).
Figure 3: Shown are cross sections of one representative donor of HSEs generated with female (A) or male (B) cells that have been cultured in the absence (-) or presence (+) of BioMarine Complex (MC). Irrespective of the gender of the donors, HSEs that have been cultured for 7 weeks (a, b) show more viable cell layers when they are supplemented with MC at the beginning of the culture. Similar results were found when HSEs were cultured for 11 weeks (c, d) in the absence or presence of MC. Supplementation of MC to HSEs from the seventh week on and cultured for an additional 4 weeks (e) resulted in more viable cell layers compared to a and c; (Scale bar: 20 µm). The numbers of viable cell layers are reflected in panels C (f-HSE) and D (m-HSE). Cell layers were counted randomly in three different areas of the cross sections. Black bars represent the average of four female donors while white bars represent the average of four male donors. Supplementation of MC to HSEs significantly increased the number of cell layers in 7 week old cultures (C); * p<0.05. The effect of MC was still significant in 11-week old female cultures but was less pronounced in male HSEs (D). However, when adding MC from week 7 on, it also significantly increased the number of cell layers in both female and male HSEs; *p<0.05.
Figure 4: Shown are cross sections of one representative donor of HSEs generated with female (f-HSE)(A) or male (m-HSE) (B) cells that have been cultured in the absence (- ) or presence (+) of BioMarine Complex (MC). Irrespective of the gender of the donors or MC supplementation, HSEs that have been cultured for 11 weeks express the early differentiation marker K10 in all suprabasal layers. The hyperproliferation associated marker K17 was absent irrespective of absence or presence of MC. In HSEs supplemented with MC, the number of proliferative cells (Ki67 positive cells) in the basal layer was increased. This increase was more pronounced in f-HSEs. (Scale bar: 50µm).
Figure 5: Graph shows the effect of MC on cell proliferation in m-HSE. The number of Ki67 positive cells present per 100 basal cells were counted in three different areas of the cross sections. Black bars represent the average number of Ki67 positive cells after 7 weeks of culture while white bars represent the 11-week old cultures. Supplementation of MC to f-HSEs significantly increased the number of Ki67 positive cells both in 7- and 11-week old cultures. * p<0.05. The effect of MC was still significant when MC was added from week 7 on (dashed bar):*p<0.05. Results represent the average of 4 donors.
Figure 6: Shown are cross sections of one representative donor of HSEs generated with female (f-HSE)(A) or male (m-HSE) (B) cells that have been cultured in the absence (-) or presence (+) of BioMarine Complex (MC) for 11 weeks. In f-HSEs, supplementation of MC clearly increased the deposition of laminin 332 and collagen type VII at the dermal-epidermal junction, while in m-HSEs, supplementation of MC only increased the deposition of collagen type VII. Collagen type I deposition was present in all dermal compartments irrespective of the absence or presence of MC. (Scale bar: 20µm).
Marine Complex affects basement membrane formation
Next, we evaluated the effect of MC on basement membrane formation in HSEs. For this purpose, we analyzed the two basement membrane proteins laminin 332 and collagen type VII. Immunohistochemical analyses demonstrated nice deposition of these proteins at the dermal-epidermal junction. In addition, a clear effect of MC on the expression of both proteins was observed (figure 6). In f-HSEs cultured for 11 weeks in the presence of MC, the deposition of laminin 332 and collagen type VII was higher compared to the controls. When MC was supplemented from week 7 on and cultured for an additional 4 weeks, a similar effect was seen for both proteins. Interestingly, in m-HSEs, this increased deposition was only observed for collagen type VII and not for laminin 332.
Marine Complex increases pro-collagen type I deposition in f-FDMs
Collagen type I was expressed throughout the dermal compartment of both f-HSEs and m-HSEs (figure 6). As direct quantification of the collagen type I cannot be performed within the context of the dermis, we chose to measure the collagen type I precursor pro- collagen type I in the culture medium of HSEs as a measure of ECM formation. The effect of MC on the dermal compartment was evaluated by measuring the released pro-collagen
Figure 7: Graph shows the effect of BioMarine Complex (MC) on pro-collagen type I deposition in f-HSE (A) and m-HSE (B). White bars represent the HSEs without MC and black bars represent HSEs supplemented with MC. Pro-collagen type I was measured in medium collected from the HSEs during the culture period (weeks 1 to 11). As shown in graph A, addition of MC significantly increased the deposition of pro-collagen type I in f-HSEs, while in m-HSEs no difference was observed. * p<0.05. Results represent the average of two donors.
type I by the fibroblasts in the culture medium of the HSEs collected in weeks 1, 3, 5, 7, 9 and 11 (figure 7A). Supplementation of MC significantly increased the deposition of pro- collagen type I in f-HSEs. This increase peaked in week 7 (866 ng/mL ± 121). In 11-week cultures, the secretion of pro-collagen decreased to almost 368 ng/mL (± 68). In m-HSEs, this observation was not found, as the basal secretion already started at 829 ng/mL (± 30) in week 1 and decreased to around 548 ng/mL (±70) in week 11 (figure 7B).
Discussion
Most human skin aging research has been performed either in vivo) (animal models or skin biopsies) or in monolayer cell cultures. Animal models are not only constrained by obvious ethical limitations and high costs, but also misrepresent the human skin microenvironment. Monolayer cultures allow more experimental flexibility but do not reflect the human in vivo) situation. Human skin equivalents (HSEs) fill the gap between these two different research models by allowing great experimental flexibility and placing experiments in the context of human skin tissue. Several studies have already showed that epithelial-mesenchymal interactions are of crucial importance for the overall homeostasis of the skin (18, 19). In addition, studies also showed that the microenvironment in which the fibroblasts are embedded affects epidermal morphogenesis (19, 20).
In our present study, we investigated whether supplementation of Marine Complex (MC), the active ingredient of ImedeenTM, affects the overall architecture of human skin including epidermis, basement membrane and dermis in both female and male
generated HSEs. An earlier in-vivo study on ImedeenTM demonstrated positive effects (e.g. the decrease of fine lines, increased dermal volume and a smoother skin) in female subjects (14). In this study we have used fibroblast-derived matrix (FDM) as a dermal equivalent instead of classical rat-tail collagen based HSEs. FDMs are more suitable for studies in which factors secreted by fibroblasts are crucial for the overall skin morphology.
Furthermore, they can be cultured for longer periods of time compared to the rat-tail collagen based HSEs (16).
HSEs generated with keratinocytes and fibroblasts obtained from female skin (f-HSE) or male skin (m-HSE) were supplemented with MC by two different approaches. In the first approach, MC was added from the start of the cultures and analyzed after 7 and 11 weeks. In the second approach, we evaluated whether MC can reactivate epidermal proliferation of "mature" 7-week old HSEs. For this purpose, MC was added from week 7 on and cultured for an additional 4 weeks, resulting in a total air-exposed culture period of 11 weeks. Histological analyses showed that regardless of the approach and gender of the donors, MC improved epidermal morphology by increasing the number of viable cell layers. This was observed in 7- and 11-week old cultures but also in cultures that had been supplemented with MC from week 7 on, which had only been cultured in the presence of MC for 4 weeks. This suggests that MC reactivates epidermal turnover in long-term cultured HSEs. These observations were supported by the fact that the early differentiation program (assessed by Keratin 10 staining) was not altered by MC, regardless of the approach, donor gender and culture period. Addition of MC also did not induce the expression of the hyper-proliferation associated marker K17. This indicates the presence of a normalized epidermis, as the "epidermal stress protein" K17 is not expressed in healthy skin but present in skin that has been wounded or activated (e.g. after UV- irradiation, addition of growth factors) (21). Obviously, increased epidermal thickness in MC treated HSEs could be explained by the presence of proliferating cells in the basal cell layers. Therefore, we examined the expression of Ki67-postive cells in all cultures. In m-HSEs, a significant increase in cell proliferation was observed in 7-week old cultures but also in 11-week old cultures that have been supplemented with MC for 4 weeks. In f-HSEs, the presence of MC significantly increased basal cell proliferation in all cultures compared to their controls. This clearly indicates that MC acts on the proliferation program while leaving the differentiation program unaffected. One might hypothesize that MC may function as a specific growth factor that keeps epidermal turnover in balance and maintaining epidermal homeostasis. Especially when we compared 7-week with 11- week old HSEs, a constant epidermal thickness was observed in the presence of MC. These observations also raise the question whether MC could serve as a compound maintaining stem cells in the epidermal cell layers. It is known that most HSEs cultured up to 8 weeks consist of only 1 or 2 viable cell layers. This might be explained by a very rich environment
containing growth factors and serum, in which the keratinocytes hyperproliferate and deplete their proliferative capacity within 8 weeks, or that the microenvironment lacks ingredients that maintain the stem cell compartment in the epidermal layers (20). Further research is necessary to elucidate whether MC has a role in these complex processes.
As stated earlier, interactions between the dermal and epidermal compartment are important for overall homeostasis of the skin. At the dermal epidermal junction (DEJ) of the basement membrane, various proteins are involved in signal transduction from one compartment to another. Collagen type VII is the principal constituent of the anchoring fibrils, attachment structures that play a major part in stabilizing the association of the basement membrane zone to the underlying papillary dermis. Laminin 332 is a major component of the actin filaments, and has been found to directly bind collagen type VII (22). Hence, both collagen type VII and laminin 332 are important for the tight connection of the epidermis and dermis. Besides their importance for the integrity of the DEJ, both laminin 332 and collagen type VII provide a special trans-basement-membrane route for the transmission of information from the dermis to the basal keratinocytes and vice versa, indirectly regulating keratinocyte proliferation and supporting cell migration during wound healing (23). The effect of MC on the expression of these proteins was quite remarkable, especially in f-HSEs, as the deposition of both laminin 332 and collagen type VII was increased at the DEJ of these models. This was observed in MC supplemented cultures of both 7 and 11 weeks. Interestingly, in m-HSEs similar observations were only found for the deposition of collagen type VII, while the deposition of laminin 332 remained unaffected by MC. This curious difference might be explained by the fact that fibroblasts and keratinocytes isolated from male and female skin likely differ in their sensitivity to hormone or hormone-like factors present in their microenvironment. Further analyses on the deposition of other DEJ proteins such as collagen type IV or integrin-subunits α6ß4 might shed new light on the role of MC in basement membrane formation. Finally, we evaluated whether MC activated fibroblasts to secrete collagen. Since the dermal matrix of FDMs consists solely of fibroblasts that secrete their own extracellular matrix, we evaluated the secretion of pro-collagen type I in medium collected throughout the culture period of HSEs. In f-HSEs, pro-collagen type I was increased during the whole culture period of 11 weeks, but was only significantly increased in weeks 3, 5 and 11 compared to the control samples. In m-HSEs, pro-collagen type I secretion remained unaltered by the presence of MC. The differences obtained in f-HSEs and m-HSEs might be explained by the fact that male skin differs in some aspects from female skin. Male skin is known to have thicker epidermis and dermis, the fibroblasts secret more collagen and elastin, it contains larger pores and produces more sebum. These parameters are partly directed by the hormones present in the skin. In addition, one can assume that the concentration of MC added to m-HSEs was too low to overcome its effect. Possibly, the fibroblasts had
already a basal level of collagen production/activation that could not be improved by MC at a concentration of 70µg/mL.
In conclusion, the present study shows that the active ingredient of Imedeen, Marine Complex (MC) acts on the overall organization of HSEs. The basement membrane and the dermis of f-HSEs were more affected by MC than in m-HSEs. However, this might be explained by differences in male and female skin in vivo). The epidermis of both f-HSEs and m-HSEs were stimulated by MC, without activating the stress and hyperproliferation pathways. A remarkable observation was that MC was able to reactivate 7-week old HSEs that were already in a "mature" state. MC also increased the deposition of the basement membrane proteins collagen type VII in f-HSEs and m-HSEs and laminin 332 in f-HSEs.
Furthermore, this study clearly showed that MC increased pro-collagen type I secretion in f-HSEs. Although some differences between f-HSEs and m-HSEs were observed, this work demonstrates the "anti-aging" potential of MC. The nutricosmetic ingredient MC seems to fight natural aging by counteracting on cellular aging-associated processes observed in human skin.
Acknowledgements
We would like to thank Ir. Suzan Commandeur and Dr. Maria Ponec of the Department of Dermatology, Leiden University Medical Center (LUMC), Leiden, The Netherlands for carefully reading the manuscript. The work was sponsored by Ferrosan A/S Denmark.
References
1. Gilchrest BA, Yaar M. Ageing and photoageing of the skin: observations at the cellular and molecular level. Br J Dermatol 1992: 127 Suppl 41:25-30.
2. Fenske NA, Lober CW. Structural and functional changes of normal aging skin. J Am Acad Dermatol 1986: 15:571-585.
3. Moragas A, Castells C, Sans M. Mathematical morphologic analysis of aging-related epidermal changes. Anal Quant Cytol Histol 1993: 15:75-82.
4. Webb A, Kaur P. Epidermal stem cells. Front Biosci 2006: 11:1031-1041.
5. Giangreco A, Goldie SJ, Failla V, Saintigny G, Watt FM. Human Skin Aging Is Associated with Reduced Expression of the Stem Cell Markers beta1 Integrin and MCSP. J Invest Dermatol 2009:
130:604-608.
6. Callaghan TM, Wilhelm KP. A review of ageing and an examination of clinical methods in the assessment of ageing skin. Part 2: Clinical perspectives and clinical methods in the evaluation of ageing skin. Int J Cosmet Sci 2008: 30:323-332.
7. Zouboulis CC, Chen WC, Thornton MJ, Qin K, Rosenfield R. Sexual hormones in human skin.
Horm Metab Res 2007: 39:85-95.
8. Giacomoni PU, Mammone T, Teri M. Gender-linked differences in human skin. J Dermatol Sci 2009: 55:144-149.
9. Bell E, Ehrlich HP, Sher S et al. Development and use of a living skin equivalent. Plast Reconstr Surg 1981: 67:386-392.
10. El Ghalbzouri A, Gibbs S, Lamme E, van Blitterswijk CA, Ponec M. Effect of fibroblasts on epidermal regeneration. Br J Dermatol 2002: 147:230-243.
11. Glaser DA. Anti-aging products and cosmeceuticals. Facial Plast Surg Clin North Am 2004:
12:363-72, vii.
12. Kieffer ME, Efsen J. Imedeen in the treatment of photoaged skin: an efficacy and safety trial over 12 months. J Eur Acad Dermatol Venereol 1998: 11:129-136.
13. Lacroix S, Bouez C, Vidal S et al. Supplementation with a complex of active nutrients improved dermal and epidermal characteristics in skin equivalents generated from fibroblasts from young or aged donors. Biogerontology 2007: 8:97-109.
14. Vicanova J, Bouez C, Lacroix S, Lindmark L, Damour O. Epidermal and dermal characteristics in skin equivalent after systemic and topical application of skin care ingredients. Ann N Y Acad Sci 2006: 1067:337-342.
15. Skovgaard GR, Jensen AS, Sigler ML. Effect of a novel dietary supplement on skin aging in post- menopausal women. Eur J Clin Nutr 2006: 60:1201-1206.
16. El Ghalbzouri A, Commandeur S, Rietveld MH, Mulder AA, Willemze R. Replacement of animal- derived collagen matrix by human fibroblast-derived dermal matrix for human skin equivalent products. Biomaterials 2008: 30:71-78.
17. Vandesompele J, De PK, Pattyn F et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002:
3:RESEARCH0034.
18. Maas-Szabowski N, Shimotoyodome A, Fusenig NE. Keratinocyte growth regulation in fibrob- last cocultures via a double paracrine mechanism. J Cell Sci 1999: 112 ( Pt 12):1843-1853.
19. Stark HJ, Willhauck MJ, Mirancea N et al. Authentic fibroblast matrix in dermal equivalents normalises epidermal histogenesis and dermoepidermal junction in organotypic co-culture.
Eur J Cell Biol 2004: 83:631-645.
20. Muffler S, Stark HJ, Amoros M et al. A stable niche supports long-term maintenance of human epidermal stem cells in organotypic cultures. Stem Cells 2008: 26:2506-2515.
21. McGowan KM, Coulombe PA. Onset of keratin 17 expression coincides with the definition of major epithelial lineages during skin development. J Cell Biol 1998: 143:469-486.
22. Amano S. Possible involvement of basement membrane damage in skin photoaging. J Investig Dermatol Symp Proc 2009: 14:2-7.
23. Sugawara K, Tsuruta D, Ishii M, Jones JC, Kobayashi H. Laminin-332 and -511 in skin. Exp Dermatol 2008: 17:473-480.
