Cover Page
The handle http://hdl.handle.net/1887/20958 holds various files of this Leiden University dissertation.
Author: Sakalis, Philippe Alexandre
Title: Visualizing virulence proteins and their translocation into the host during agrobacterium-mediated transformation
Issue Date: 2013-06-12
4
Chapter 4
Imaging subcellular localization, interactions and delivery of Agrobacterium tumefaciens virulence proteins in planta
P. A. Sakalis, D. Mateus, G.P.H. van Heusden and P.J.J. Hooykaas
Molecular and Developmental Genetics, Institute of Biology, Leiden University, Leiden, The Netherlands.
4
ABSTRACT
Agrobacterium tumefaciens can genetically transform plants by transferring a piece of DNA into the host cell. To facilitate the transformation process, in addition the virulence proteins VirD2, VirD5, VirE2, VirE3 and VirF are translocated into the plant cell. In this Chapter several characteristics of these virulence proteins were studied in planta to complement the observations made in yeast as described in Chapters 2 and 3. Upon expression of YFP- VirE2 in Arabidopsis protoplasts we observed filaments similar to those found in yeast. These filaments were disrupted by addition of the microtubule depolymerization reagent oryzalin. It has been shown that in a yeast two hybrid assay VirE3 interacts with the plant specific general transcription factor pBrp and the importin Impα-4 (García-Rodríguez et al., Nucleic Acids Res. 2006, 34:6496). With a Bimolecular Fluorescence Complementation (BiFC) assay we validated this interaction by showing that, similarly as in yeast, in Arabidopsis protoplasts VirE3 interacts with pBrp and Impα-4. In Chapter 3 the translocation of virulence proteins from Agrobacterium to yeast was visualized. Using the split GFP system, we visualized the delivery of virulence proteins VirD2, VirD5, VirE2 and VirF into the cells of tobacco leaves.
INTRODUCTION
The soil bacterium Agrobacterium tumefaciens is able to genetically transform plant cells by introducing a piece of DNA, called the T-DNA.
After transfer and entry into the nucleus the T-DNA integrates into the host chromosomal DNA. T-DNA is translocated in a single stranded form, called the T-strand, by a Type IV Secretion System (T4SS) from the bacterium into the plant cell. Genes located on the T-DNA code for enzymes involved in the synthesis of phytohormones (auxin and cytokinin) and opines. Opines produced by the tumorous growing transformed cells can be used by A. tumefaciens as a source of carbon and nitrogen. During the transformation process, at least five different virulence proteins, i.e. VirD2, VirD5, VirE2, VirE3 and VirF, are transferred from the bacterium into the host cell. This method of infection is known as Agrobacterium-Mediated Transformation (AMT).
The virulence protein VirD2 plays key roles during the infection process
4
and Right Borders flanking the T-region through its relaxase domain [1][2].
Concurrently, VirD2 becomes covalently attached to the 5’-end of these nicks [3][4][5] and it is as a nucleoprotein complex that the T-strand travels through the T4SS into the host cell. In the absence of T-DNA the VirD2 protein is still translocated to the host, albeit at very low levels [6].The virulence protein VirE2 is a single strand DNA binding protein and upon translocation it oligomerizes and coats the T-strand in a sequence nonspecific manner forming a T-complex to protect the T-strand from host nuclease attacks [7][14][15]. VirE3 might play a role in facilitating nuclear uptake of the T-complex as it binds to VirE2 [10].
A yeast two-hybrid screen revealed interaction with four plant host factors [11]:
two members of the importin α family, the COP9 signalosome component Csn5 and a plant specific general transcription factor pBrp. The interaction with pBrp advocates a role for VirE3 as plant transcriptional activator. The virulence protein VirF is thought to be involved in ubiquitin-mediated proteolysis to uncoat the T-strand enabling its integration into the host chromosomal DNA [12]. VirD5 has two bipartite NLSs and computational analysis suggests that it may act as a transcription factor inside the host cell [13]. Instead, in a recent paper by Magori et al. [14], it has been suggested that VirD5 might bind to and stabilize VirF by counteracting host cell induced degradation of this F-box protein.
Chapters 2 and 3 describe several characteristics of the virulence proteins found in studies with yeast cells. In this study, some of these features were analyzed further in planta. In Chapter 2 we showed that upon expression in yeast a fluorescent VirE2 fusion protein is visible as a filament between the spindle poles of dividing cells and that these filamentous structures co-localize with microtubules. Here the localization of VirE2 in Arabidopsis protoplasts is analyzed. In Chapter 3 interactions between VirE3 and pBrp were confirmed using a Bimolecular Fluorescence Complementation (BiFC) approach in yeast.
Here we further analyzed this interaction in Arabidopsis protoplasts. Using a split GFP system [15] we were able to visualize the delivery of tagged virulence proteins from A. tumefaciens into yeast cells (Chapter 3). Here, we used the Split GFP-system to visualize the translocation of VirD2, VirD5, VirE2 and VirF into tobacco leaf cells.
4
MATERIALS AND METHODS
Tobacco plant lines and media. Nicotiana tabacum SR1 plants were genetically transformed by means of leaf disc transformation according to the protocol of Sparkes et al. [16]. To obtain SR1 lines expressing GFP 1-10 we performed the leaf disc transformation with A. tumefaciens strain AGL1(pCambia1302- GFP1-10) and selected for Hygromycin (50 µg/ml) resistance. Transformation rendered 39 calli growing from the leaf discs. After transfer of the calli to shoot induction medium, 4 shoots were selected and grown to full plants. Genomic DNA was isolated from the plants and integration of the T-DNA with the coding DNA sequence of GFP 1-10 was checked by PCR using primers XbaI-GFP1-10- Fw and XbaI-GFP1-10-Rev. Expression of GFP 1-10 was confirmed by Western blotting. Homozygous plants were selected for Agroinfiltration experiments.
Western blotting. To isolate protein from transformed N. tabacum plants, 2 ml Eppendorf tubes were filled with plant tissue, frozen in liquid nitrogen and grinded in a tissue lyzer (Retch). Subsequently 500 µl of cold lysis buffer (50 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1 mM PMSF, 2 mM DTT and 1x protease inhibitor cocktail from Roche Diagnostics GmbH) was added. Samples were gently mixed and incubated on ice for 5 minutes. After centrifugation for 30 min at 16,100 xg at 4°C the supernatant was transferred to new Eppendorf tubes.
This process was repeated and 20 µl of the protein samples were electrophoresed on a polyacrylamide gel and transferred to a PVDF Western blotting membrane (Roche Diagnostics GmbH). Proteins were detected using anti-GFP antibody conjugated to horse radish peroxidase (sc-8334, Santa Cruz Biotechnology®, Inc.), and Western Lightning® Plus-ECL substrate (PerkinElmer, Inc.). Imaging was done with the Geliance 600 Imager. The Precision Plus ProteinTM Dual Color standard (Bio-Rad Laboratories, Inc.) was used as molecular weight marker.
Agrobacterium strains and media. A. tumefaciens strains used in this study are listed in Table 1. All A. tumefaciens strains were grown in LC medium containing (if required) the appropriate antibiotics at 29°C and shaking at 175 rpm.
Agroinfiltration. A. tumefaciens strains were grown overnight at 29°C. After dilution to an OD600 ≈ 0.8 in induction medium (IM) + 200 µM acetosyringone (AS) [17], 10 ml cultures were grown for three hours at 28°C. Subsequently the cultures were transferred into a blunt-tipped plastic 10 ml syringe (Nissho NIPRO Europe N.V.) and injected into the leaves of the transgenic N. tabacum SR1 line
4
lower surface of the leaves and injecting with gentle pressure. Young leaves of three to four week old plants were used for agroinfiltrations. After 20 to 24 hours the lower side of the injected leaf was imaged by confocal microscopy.
Protoplast transformation. Arabidopsis thaliana Columbia protoplasts were obtained from cell suspension cultures that were propagated as described by Schirawski et al. [18]. Polyethyleneglycol (PEG)-mediated transformations of protoplasts with 10 µg of plasmid DNA were performed as reported by Schirawski et al. [18]. Protoplasts were imaged by confocal microscopy 24 hours after transfection.
Plasmid constructions. All plasmids used and constructed in this study are listed in Table 2. Cloning steps were performed in E. coli strain DH5α. PCR amplifications were done with Phusion™ High-Fidelity DNA Polymerase and Table 3 lists all primers used for PCR amplifications.
To express YFP-VirE3, YFP-Impα-4 and YFP-pBrp in protoplasts, we made the vectors pART7YFP[VirE3], pART7YFP[Impα-4] and pART7YFP[pBrp]. To obtain fragment SpeI-VirE3-XbaI PCR amplification was performed with SpeI-VirE3-Fw and XbaI-VirE3-Rev, using pUG36YFP[VirE3]
(P.A. Sakalis, Chapter 2) as template. The SpeI-Impα-4-SpeI fragment was acquired by PCR amplification using SpeI-Impα-4-Fw and SpeI-Impα-4-Rev with pUG35VN[Impα-4] template DNA. This pUG35VN[Impα-4] was constructed in the following manner: a SpeI-Impα-4∆TGA-XmaI fragment was obtained by PCR with primers SpeI-Impα-4-Fw and XmaI-Impα-4∆TGA-Rev using a cDNA library from A. thaliana (obtained from B. J. van der Zaal) as template;
the fragment was cloned into pJET1.2 resulting in pJET1.2[Impα-4∆TGA]; the SpeI-XmaI digested fragment from pJET1.2[Impα-4∆TGA] was then ligated into pUG35VN (P. A. Sakalis, Chapter 2) resulting in pUG35VN[Impα-4]. The SpeI- pBrp-SpeI fragment was obtained by PCR amplification with SpeI-pBrp-Fw and SpeI-pBrp-Rev using pUG35VC[pBrp] (P.A. Sakalis, Chapter 3) as template.
Fragments SpeI-VirE3-XbaI, SpeI-Impα-4-SpeI and SpeI-pBrp-SpeI were cloned into pJET1.2, generating pJET1.2[VirE3], pJET1.2[Impα-4] and pJET1.2[pBrp], respectively. From these three plasmids the SpeI-VirE3-XbaI, SpeI-Impα-4-SpeI and SpeI-pBrp-SpeI fragments were cloned into XbaI digested pART7-YFP to generate pART7YFP[VirE3], pART7YFP[Impα-4] and pART7YFP[pBrp], respectively.
4
For BiFC experiments in protoplasts we used vectors pSY728, pSY735, pSY736 and pSY738 [19]. pSY735 and pSY736 are used to express proteins of interest which are N-terminally tagged with fragments of YFP. The vectors pSY728 and pSY738 are used to express proteins of interest fused at their C-termini to fragments of YFP. To obtain plasmids pSY735[pBrp] and pSY736[pBrp] expressing YC-pBrp and YN-pBrp, respectively, the following cloning procedures were carried out: plasmids pSY735 and pSY736 were both digested with BamHI followed by incubation with Mung Bean Nuclease (New England BioLabs®Inc.) to blunt the overhangs. Consequently the plasmids were digested with SpeI. pUG36VC[pBrp] (P.A. Sakalis, Chapter 3) was digested with SpeI and SmaI and a SpeI-SmaI fragment containing the coding sequence of pBrp was then ligated into the digested pSY735 and pSY736 vectors to obtain pSY735[pBrp] and pSY736[pBrp], respectively.
Vectors pSY728[pBrp] and pSY738[pBrp] expressing pBrp-YN and pBrp-YC, respectively, were constructed in the following manner: a PCR amplification was performed with EagI-pBrp-Fw and EagI-pBrp∆TAG- Rev using pUG35VC[pBrp] (P.A. Sakalis, Chapter 3) as template to obtain fragment EagI-pBrp-EagI. This fragment was cloned into pJET1.2 to produce pJET1.2[pBrp∆TAG]. Subsequently an EagI-EagI fragment from pJET1.2[pBrp∆TAG] coding for pBrp was ligated into EagI digested vectors pSY728 and pSY738 to create pSY728[pBrp] and pSY738[pBrp], respectively.
Vectors pSY735[VirE3] and pSY736[VirE3] expressing YC-VirE3 and YN-VirE3, respectively, were made as follows: a PCR amplification with SpeI- VirE3-Fw and BamHI-VirE3-Rev was performed using pUG36YFP[VirE3] as template to obtain fragment SpeI-VirE3-BamHI. The fragment was ligated into pJET1.2 to create pJET1.2[VirE3]2. pJET1.2[VirE3]2 was digested with SpeI and BamHI and the resulting fragment coding for VirE3 was cloned into SpeI and BamHI digested pSY735 and pSY736 vectors to create pSY735[VirE3] and pSY736[VirE3], respectively.
In order to express VirE3-YN and VirE3-YC, vectors pSY728[VirE3]
and pSY738[VirE3] were constructed. PCR amplification with NcoI-VirE3-Fw and NotI-VirE3∆TGA-Rev and template pUG36YFP[VirE3] was carried out to acquire a NcoI-VirE3-NotI fragment. This fragment was subsequently ligated into pJET1.2 to create pJET1.2[VirE3∆TAA]. pJET1.2[VirE3∆TAA] was digested with NcoI and NotI releasing an NcoI-NotI fragment coding for VirE3 which was ligated into NcoI and NotI digested pSY728 and pSY738. In this way vectors pSY728[VirE3] and pSY738[VirE3] were created.
4
For BiFC experiments with Impα-4 in protoplasts, vectors pSY728[Impα-4], pSY735[Impα-4], pSY736[Impα-4] and pSY738[Impα-4]
were created. To express YC-Impα-4 and YN-Impα-4, vectors pSY735[Impα-4]
and pSY736[Impα-4] were constructed. PCR amplification with SpeI-Impα- 4-Fw and BamHI-Impα-4-Rev and template pUG35VN[Impα-4] was carried out to obtain a SpeI-Impα-4-BamHI fragment. This fragment was ligated into SpeI and BamHI digested pSY735 and pSY736 to make pSY735[Impα-4] and pSY736[Impα-4], respectively. Vectors pSY728[Impα-4] and pSY738[Impα-4]
were constructed to express Impα-4-YN and Impα-4-YC. An NcoI-Impα-4-NotI fragment was amplified by PCR using primers NcoI-Impα-4-Fw and NotI-Impα- 4∆TGA-Rev and template pUG35VN[Impα-4]. This fragment was ligated into NcoI and NotI digested pSY728 and pSY738 to obtain pSY728[Impα-4] and pSY738[Impα-4], respectively.
To make transgenic tobacco SR-1 lines expressing GFP 1-10, plasmid pCambia1302-GFP1-10 was constructed. PCR amplification with NcoI-GFP1-10- Fw and BstEII-GFP1-10-Rev and template pUG34GFP1-10 (P. A. Sakalis, Chapter 3) was carried out to obtain an NcoI-GFP1-10-BstEII fragment. This fragment was cloned into pJET1.2 to produce pJET1.2[GFP1-10]2. Subsequently an NcoI- BstEII fragment from pJET1.2[GFP1-10]2 coding for GFP 1-10 was ligated into pCambia1302 (Cambia Australia®), digested with NcoI and BstEII, replacing the mGFP coding sequence by GFP 1-10 to create pCambia1302-GFP1-10.
Confocal Microscopy. All microscopic analyses were done by confocal laser scanning microscopy (CLSM) with a Zeiss Imager or Zeiss observer (Zeiss, Oberkochen, Germany), both equipped with an LSM 5 Exciter, using a 40x magnifying objective (numerical aperture 1.4). Reconstituted split GFP signal was detected using an argon 488 nm laser and a 505-530 nm band pass emission filter. To detect YFP signal and reconstituted BiFC signal an argon 514 nm laser and a 530-600 nm band pass emission filter were used. Chlorophyll fluorescence was captured using a long pass 650 nm emission filter after excitation at 488 nm (in case of GFP detection) or 514 nm (in case of YFP detection). Microscopic images were analyzed using ImageJ software [20] and assembled using Adobe Photoshop CS4 and Adobe Illustrator CS4.
4
Table 1: Agrobacterium strains used in this study
Agrobacterium strain Specificationsa Source /
reference LB1100 C58 containing pTiB6∆ (∆T-DNA, ∆occ, ∆tra), Rif,
Spc Beijersbergen et al.
LBA2556(3163GFP11- [21]
D2) LBA2556 with pSDM3163[GFP11-VirD2], expressing the GFP 11-VirD2 fusion protein under control of the virD promoter, Rif, Spc, Gm
P.A. Sakalis, Chapter 3 LBA2569(3163GFP11-
D2) LBA2569 with pSDM3163[GFP11-VirD2],
expressing the GFP 11-VirD2 fusion protein under control of the virD promoter, Rif, Gm
P.A. Sakalis, Chapter 3 LBA3550(3076GFP11-
D5) LBA3550 with pSDM3076[GFP11-VirD5]. Expression of the GFP 11-VirD5 fusion protein under control of the virD promoter, Rif, Spc, Gm
P.A. Sakalis, Chapter 3 LBA3551(3076GFP11-
D5) LBA3551 with pSDM3076[GFP11-VirD5]. Expression of the GFP 11-VirD5 fusion protein under control of the virD promoter, Rif, Spc, Gm
P.A. Sakalis, Chapter 3 LBA2572(3163GFP11-
E2) LBA2572 with pSDM3163[GFP11-VirE2]. Expression of the GFP 11-VirE2 fusion protein under control of the virE promoter, Rif, Gm
P.A. Sakalis, Chapter 3 LBA2573(3163GFP11-
E2) LBA2573 with pSDM3163[GFP11-VirE2]. Expression of the GFP 11-VirE2 fusion protein under control of the virE promoter, Rif, Spc, Gm
P.A. Sakalis, Chapter 3 LBA2560(3163GFP11-F) LBA2560 with pSDM3163[GFP11-F]. Expression of
the GFP 11-VirF fusion protein under control of the virF promoter, Rif, Spc, Gm
P.A. Sakalis, Chapter 3 LBA2561(3163GFP11-F) LBA2561 with pSDM3163[GFP11-F]. Expression of
the GFP 11-VirF fusion protein under control of the virF promoter, Rif, Spc, Gm
P.A. Sakalis, Chapter 3 AGL1(YFP-AGC3.4) AGL1 with pGreen0179[YFP-AGC3.4]. Expression
of YFP-AGC3.4 fusion protein under control of the CaMV 35S promoter and terminator, Km
K. van Gelderen, unpublished
a tra: transfer region, occ: octopine catabolism, Rif: rifampicin, Spc: spectinomycin, Km: kanamycin, Gm: gentamicin, ∆:
deletion, LBA2556: ∆T-DNA and ∆VirD2, LBA2569: ∆VirD2, LBA3550: ∆VirD5, LBA3551: ∆T-DNA and ∆VirD5, LBA2572:
∆VirE2, LBA2573: ∆T-DNA and ∆VirE2, LBA2560: ∆VirF, LBA2561: ∆T-DNA and ∆VirF
4
Table 2: Plasmids used in this study
Name Properties Source /
reference pJET1.2 CloneJET™ PCR Cloning pUC19 based vector for
blunt cloning Fermentas UAB
pJET1.2[GFP1-10]2
(pRUL1299) pJET1.2 with GFP 1-10 flanked by NcoI and BstEII
restriction sites. This study
pCambia1302 High copy vector with mGFP under control of the 35S promoter and the CaMV terminator. (bacterial kanamycin resitance, plant hygromycin selection)
Cambia, Australia pCambia1302-GFP1-10
(pSDM3764) pCambia1302 with GFP 1-10 under control of the
35S promoter and the CaMV terminator. This study pART7-YFP
(pRUL1269) pART7 based vector with YFP under control of the 35S promoter and the octopine synthase (OCS) terminator.
C.S. Galvan Ampudia, unpublished pUG36YFP[VirE3]
(pRUL1245) Centromeric plasmid with YFP-VirE3 under control of MET25 promoter and CYC1 terminator. URA3 marker.
P.A. Sakalis, Chapter 2 pUG35VN
(pRUL1181) Centromeric plasmid to make C-terminal fusions with the N-terminal Venus part under control of the MET25 promoter and CYC1 terminator. URA3 marker.
P.A. Sakalis, Chapter 2
pUG35VN[Impα-4]
(pRUL1300) Centromeric plasmid with Impα-4-VN under control of the MET25 promoter and ADH1 terminator.
URA3 marker.
This study
pUG35VC[pBrp]
(pRUL1288) Centromeric plasmid with pBrp-VC under control of the MET25 promoter and ADH1 terminator. URA3 marker.
P.A. Sakalis, Chapter 3 pJET1.2[VirE3]
(pRUL1301) pJET1.2 with virE3 flanked by SpeI and XbaI
restriction sites. This study
pJET1.2[Impα-4∆TGA]
(pRUL1302) pJET1.2 with Impα-4 without stop codon flanked by
SpeI and XmaI restriction sites. This study pJET1.2[Impα-4]
(pRUL1303) pJET1.2 with Impα-4 flanked by SpeI restriction
sites. This study
pJET1.2[pBrp]
(pRUL1304) pJET1.2 with pBrp flanked by SpeI restriction sites. This study pART7-YFP[VirE3]
(pRUL1305) pART7 based vector with YFP-VirE3 under control of the 35S promoter and the octopine synthase (OCS) terminator.
This study
pART7-YFP[Impα-4]
(pRUL1306) pART7 based vector with YFP-Impα-4 under control of the 35S promoter and the octopine synthase (OCS) terminator.
This study
pART7-YFP[pBrp]
(pRUL1307) pART7 based vector with YFP-pBrp under control of the 35S promoter and the octopine synthase (OCS) terminator.
This study
pSY728 pGEMbased vector to make C-terminal fusions with the N-terminal part of YFP (YN) under control of the 35S promoter and the NOS terminator.
Bracha-Dori et al.
[19]
pSY735 pGEMbased vector to make N-terminal fusions with the C-terminal part of YFP (YC) under control of the 35S promoter and the NOS terminator.
Bracha-Dori et al.
[19]
pSY736 pGEMbased vector to make N-terminal fusions with the N-terminal part of YFP (YN) under control of the 35S promoter and the NOS terminator.
Bracha-Dori et al.
[19]
4
pUG36VC[pBrp]
(pRUL1290) Centromeric plasmid with VC-pBrp under control of the MET25 promoter and CYC1 terminator. HIS3 marker.
P.A. Sakalis, Chapter 3 pSY735[pBrp]
(pRUL1308) pSY735 based vector with YC-pBrp under control of
the 35S promoter and the NOS terminator. This study pSY736[pBrp]
(pRUL1309) pSY736 based vector with YN-pBrp under control of
the 35S promoter and the NOS terminator. This study pJET1.2[pBrp∆TAG]
(pRUL1310) pJET1.2 with pBrp without stop codon flanked by
EagI restriction sites. This study
pSY728[pBrp]
(pRUL1311) pSY728 based vector with pBrp-YN under control of
the 35S promoter and the NOS terminator. This study pSY738[pBrp]
(pRUL1312) pSY738 based vector with pBrp-YC under control of
the 35S promoter and the NOS terminator. This study pJET1.2[VirE3]2
(pRUL1313) pJET1.2 with virE3 flanked by SpeI and BamHI
restriction sites. This study
pSY735[VirE3]
(pRUL1314) pSY735 based vector with YC-VirE3 under control
of the 35S promoter and the NOS terminator. This study pSY736[VirE3]
(pRUL1315) pSY736 based vector with YN-VirE3 under control
of the 35S promoter and the NOS terminator. This study pJET1.2[VirE3∆TAA]
(pRUL1316) pJET1.2 with VirE3 without stop codon flanked by
NcoI and NotI restriction sites. This study pSY728[VirE3]
(pRUL1317) pSY728 based vector with VirE3-YN under control
of the 35S promoter and the NOS terminator. This study pSY738[VirE3]
(pRUL1318) pSY738 based vector with VirE3-YC under control
of the 35S promoter and the NOS terminator. This study pSY728[Impα-4]
(pRUL1319) pSY728 based vector with Impα-4-YN under control
of the 35S promoter and the NOS terminator. This study pSY735[Impα-4]
(pRUL1320) pSY735 based vector with YC-Impα-4 under control
of the 35S promoter and the NOS terminator. This study pSY736[Impα-4]
(pRUL1321) pSY736 based vector with YN-Impα-4 under control
of the 35S promoter and the NOS terminator. This study pSY738[Impα-4]
(pRUL1322) pSY738 based vector with Impα-4-YC under control
of the 35S promoter and the NOS terminator. This study pSDM3163[GFP11-VirD2]
(pSDM3755) pSDM3163 backbone with the coding sequence of
GFP 11-VirD2 under control of the virD promoter P.A. Sakalis, Chapter 3 pSDM3076[GFP11-VirD5]
(pSDM3759) pSDM3076 backbone with coding sequence of GFP
11-VirD5 under control of the virD promoter. P.A. Sakalis, Chapter 3 pSDM3163[GFP11-VirE2]
(pSDM3756) pSDM3163 backbone with the coding sequence of
GFP 11-VirE2 under control of the virE promoter P.A. Sakalis, Chapter 3 pSDM3163[GFP11-F]
(pSDM3760) pSDM3163 backbone with coding sequence of GFP
11-virF under control of the virF promoter. P.A. Sakalis, Chapter 3
4
Table 3: Primers used in this study.
Primer name Sequence (5’ → 3’)a
XbaI-GFP1-10-Fw GCTCTAGAATGGTTTCGAAAGGCGA XbaI-GFP1-10-Rev CCCTCGAGTTATTTCTCGTTTGGGT
SpeI-VirE3-Fw GGACTAGTATGGTGAGCACTAC
XbaI-VirE3-Rev GCTCTAGATTAGAAACCTCTGGAGGTG
SpeI-Impα-4-Fw GGACTAGTATGATGGTACAAGGTGT
SpeI-Impα-4-Rev GGACTAGTTCAGGCAAATTTGAATC
XmaI-Impα-4∆TGA-Rev CCCCCGGGGGCAAATTTGAATCCAC
SpeI-pBrp-Fw GGACTAGTATGAAGTGTCCGTACTG
SpeI-pBrp-Rev GGACTAGTTCAGAAGTCTCCATGGG
EagI-pBrp-Fw CCGGCCGATGAAGTGTCCGTACTGTTC
EagI-pBrp∆TAG-Rev CCGGCCGGAAGTCTCCATGGGGATTAT
BamHI-VirE3-Rev CGGGATCCTTAGAAACCTCTGGAGGTG
NcoI-VirE3-Fw CCCATGGTGAGCACTACGAAGAAAAGT
NotI-VirE3∆TGA-Rev GCGGCCGCTTGAAACCTCTGGAGGTGG BamHI-Impα-4-Rev CGGGATCCTCAGGCAAATTTGAATC
NcoI- Impα-4-Fw CCCATGGGTATGATGGTACAAGGTGTT
NotI-Impα-4∆TGA-Rev GCGGCCGCTTGGCAAATTTGAATCCAC
NcoI-GFP1-10-Fw GCCCATGGTTTCGAAAGGCGAGGA
BstEII-GFP1-10-Rev GGGTCACCTTATTTCTCGTTTGGGTCTT
a, restriction sites are underlined.
4
RESULTS
VirE2 localization in Arabidopsis protoplasts
As shown in Chapter 2, VirE2 self-associates and forms filamentous structures that co-localize and physically interact with microtubules in yeast.
To investigate the localization of this virulence protein in a plant background, we transiently expressed YFP-VirE2 in A. thaliana Columbia protoplasts.
Comparable to yeast, in protoplasts expressing YFP-VirE2 thread-like fluorescent structures inside the cell became visible (Figure 1A and B). To study the effect of microtubule disruption on VirE2 localization, protoplasts were treated with oryzalin, a herbicide that destabilizes microtubules [22]. As shown in Figure 1C and D, the localization of VirE2 changed significantly one hour after oryzalin treatment: the thread-like structures were either completely abolished (Figure 1C) or substantially shortened (Figure 1D).
A B C D
- oryzalin + oryzalin
Figure 1: CLS microscopy of A. thaliana protoplasts expressing YFP-VirE2 and the effect of oryzalin treatment. YFP-VirE2 was expressed from a pART7 based vector [23] under control of the 35S promoter and OCS terminator. (A) and (B) YFP fluorescence showing YFP-VirE2 localization in protoplasts (merge of YFP fluorescence and visible field). Scale bar, 12µm. (C) and (D) YFP-VirE2 localization in protoplasts after treatment for 60 minutes with 50 µM oryzalin.
YFP-VirE2 is visible as filaments within the plant protoplast. Upon 60 min. oryzalin treatment VirE2 filaments were either completely abolished (C) or severely shortened (D). The images shown are representative images; a similar localization was observed in more than 30 protoplasts.
Visualization of VirE3 and the interaction with Impα-4 and pBrp in Arabidopsis protoplasts.
In Chapter 2 (Figure 10) we have shown that in yeast cells YFP-VirE3 localizes as discrete dots. These dots co-localize with the spindle pole body marker Spc42-RFP. Previous reports showed that VirE3 has a nuclear localization signal
4
transiently expressed YFP-VirE3 in Arabidopsis protoplasts. As shown in Figure 2A, CLS microscopy showed that YFP-VirE3 mainly localized in the nucleus, but a fraction was also detected in the cytoplasm.
A YFP-VirE3 B YFP-AtImpα-4 C YFP-pBrp
Figure 2: CLS microscopy of Arabidopsis Col-0 protoplasts expressing YFP-VirE3 (A), YFP- AtImpα-4 (B) or YFP-pBrp (C). Red: chlorophyll fluorescence detected using a long pass 650 nm emission filter; yellow, YFP fluorescence. Scale bar, 12 µm. The images shown are representative images; a similar localization was observed in more than 20 protoplasts.
Using a yeast two-hybrid screen García-Rodríguez et al. [11] identified four plant proteins that interact with the virulence protein VirE3: Impα-4 and Kapα (members of the importin-α family), Csn5 (a constituent of the COP9 signalosome) and pBrp (a plant specific protein related to Transcription Factor II-B). In order to validate the interaction with Impα-4 and pBrp, we visualized the localization of these proteins in Arabidopsis protoplasts and investigated their interaction with VirE3 using BiFC. As shown in Figure 2 transiently expressed YFP-Impα-4 has a nuclear localization, whereas YFP-pBrp was detected as dots all over the protoplast.
In order to study the interaction between VirE3 and Impα-4 with the BiFC technique, protoplasts were transformed with the following tagged protein pairs: YN-VirE3 and YC-Impα-4, YN-VirE3 and Impα-4-YC, VirE3-YN and YC-Impα-4, VirE3-YN and Impα-4-YC, YC-VirE3 and YN-Impα-4, YC- VirE3 and Impα-4-YN, VirE3-YC and YN-Impα-4, VirE3-YC and Impα-4-YN (YN, N-terminal part of YFP; YC, C-terminal part of YFP). One day following PEG-mediated transformation, reconstituted YFP signal was detected in the nucleus of protoplasts transformed with pSY735[VirE3] and pSY36[Impα-4]
(expressing YC-VirE3 and YN-Impα-4) (Figure 3). Reconstituted YFP signal could not be detected in protoplasts expressing other BiFC fusion protein pairs.
Negative control experiments were performed with cells transformed with either pSY735[VirE3] and pSY36 or pSY735 and pSY36[Impα-4]. No fluorescence
4
YFP CF DIC Merged
Figure 3: Visualization of the interaction between VirE3 and Impα-4 in protoplasts by BiFC.
Arabidopsis Col-0 protoplasts were transformed with pSY735[VirE3] and pSY736[Impα-4]
expressing YC-VirE3 and YN- Impα-4, respectively, and analyzed by CLS microscopy. CF, chloroplast autofluorescence. Scale bar, 12 µm
Lagrange et al. [24] reported that the bulk of pBrp proteins are present at the cytoplasmic face of the chloroplast envelope and may play a role in signaling pathways between chloroplast and the nucleus. To visualize chloroplasts we determined chlorophyll fluorescence using the long pass 650 nm emission filter (Figure 2C, red signal). This corroborated that chloroplasts and YFP-pBrp have a similar localization. To investigate whether there is co-localization, we used the colocalization highlighter plug-in for ImageJ (Pierre Bourdoncle, Service Imagerie, Institut Jacques Monod, France). As shown in Figure 4, a partial co- localization was detected. Using the plug-in it was calculated that 44% of the chloroplast fluorescence co-localizes with the YFP-pBrp signal. Alternatively, 22% of the YFP-pBrp signal co-localized with the chloroplast fluorescence.
YFP CF Merged Co-localized
Figure 4: Localization of YFP-pBrp in chloroplasts. CLS microscopy of Arabidopsis Col-0 protoplasts expressing YFP-pBrp. Co-localization of pBrp and chloroplasts is shown in right image as green signals. CF, chloroplast autofluorescence. Co-localized, co-localization of YFP and CF, detected by the colocalization highlighter plugin.
To validate the reported interaction between VirE3 and pBrp BiFC
4
VirE3 and pBrp-YC, VirE3-YN and YC-pBrp, VirE3-YN and pBrp-YC, YC- VirE3 and YN-pBrp, YC-VirE3 and pBrp-YN, VirE3-YC and YN-pBrp, VirE3- YC and pBrp-YN. One day after PEG-mediated transformation of protoplasts with pSY735[VirE3] and pSY728[pBrp] (expressing YC-VirE3 and pBrp-YN), fluorescent reconstituted YFP signal was observed (Figure 5). Compared to the brightness of reconstituted YFP signal resulting from the interaction of VirE3 and Impα-4 (Figure 4), the VirE3 - pBrp interaction resulted in a significantly stronger signal. Other BiFC fusion protein combinations did not lead to detectable fluorescent signals. Negative control experiments were performed with either pSY735[VirE3] and pSY728 or pSY735 and pSY728[pBrp] and did not result in fluorescent signals. The localization of the BiFC fluorescence resulting from the interaction of YC-VirE3 and pBrp-YN was similar to that observed after expression of YFP-pBrp in protoplasts (Figure 5). Using the colocalization highlighter plugin for ImageJ we calculated that 28 percent of the BiFC signal co-localizes with the chlorophyll signal suggesting that the interaction between VirE3 and pBrp occurs on the chloroplasts.
YFP CF Merged Co-localized
Figure 5: Visualization of the interaction between VirE3 and pBrp in protoplasts by BiFC.
Arabidopsis Col-0 protoplasts were transformed with pSY735[VirE3] and pSY728[pBrp]
expressing YC-VirE3 and pBrp-YN, respectively, and analyzed by CLS microscopy. CF, chloroplast autofluorescence. Co-localized, co-localization of YFP and CF, detected by the colocalization highlighter plugin. Scale bar, 12 µm
Visualization of the translocation of GFP 11-tagged virulence proteins from A.
tumefaciens to N. tabacum SR1 plants expressing GFP 1-10
In Chapter 3 we made use of the split GFP system to visualize and time the delivery of virulence proteins into recipient cells during AMT, using yeast as a model host organism. Here, we adopt the split GFP system to visualize virulence protein transmittal using a plant (tobacco) as a recipient. To this end we first genetically transformed N. tabacum SR1 plants using an A. tumefaciens strain
4
terminator. After selection for hygromycin resistance, four transformed plants were obtained. One of the transformed lines was selected and proper integration of the T-DNA was shown by PCR (see Materials and Methods). By Western blotting using an anti-GFP antibody we were able to detect GFP1-10 (Figure 6, lane 1). As expected this protein was not detected in a protein extract of a non- transformed SR1 line (Figure 6, lane 2).
1 2 3
250 150 100 75 50 37
25
15 10
To visualize virulence protein translocation 4 to 5 weeks old SR1 plants expressing GFP1-10 were infiltrated with A. tumefaciens strains expressing GFP 11-tagged virulence proteins. After 17 to 24 hours the infiltrated leaves were analyzed for GFP fluorescence by CSL microscopy. Due to fluorescence originating from chlorophyll, even in untransformed plants fluorescence was detected in the GFP channel, making the detection of reconstituted GFP in plants more difficult than in yeast. As shown in Figure 7A (arrow), in tobacco leaves infiltrated with A. tumefaciens strain LBA2569(3163GFP11-D2) expressing GFP11-VirD2 a nuclear localized GFP signal became visible. This signal did not originate from chlorophyll fluorescence (see Figure 7A, merged). Infiltration of tobacco leaves with A. tumefaciens strain LBA3551(GFP11-D5) expressing GFP11-VirD5 resulted in a GFP signal with a cytoplasmic localization (Figure 7B). After infiltration of the transgenic tobacco leaves with A. tumefaciens strains LBA2573(GFP11-E2) or LBA2561(GFP11-F) expressing GFP11-VirE2 and GFP11-VirF, respectively, both nuclear and cytoplasmic localized GFP signals could be detected in leaf epidermal cells (Figure 7C and 7D). For all
Figure 6: Detection of GFP1-10 by Western Blotting in one of the transformed SR1 lines using an anti- GFP antibody.
Lane: (1) proteins (5µg) from transformed SR1 line 1; (2) proteins (9 µg) from a non-transformed SR1 line;
(3) molecular weight standard (Bio- Rad). Size of reference bands (in kDa) in lane 3 are indicated next to lane 3.
C
4
A
D
GFP CF DIC Merged
B
VirD2VirD5VirE2VirF
Figure 7: Visualization of translocation of GFP 11-VirD2 (A), GFP11-VirD5 (B), GFP 11-VirE2 (C) and GFP11-VirF (D) from A. tumefaciens to N. tabacum SR1 expressing GFP1-10, 17 to 24 hours after agroinfiltration CF, chloroplast autofluorescence. DIC, differential interference contrast microscopy. Scale bar, 12µm. Arrows indicate reconstituted GFP signals in the plant cells.
Sparkes et al. [16] reported that transiently expressed fluorescent proteins become visible between 2 and 4 days after agroinfiltration of tobacco. Using the split GFP system we observed protein translocation within 24 hours. To determine whether expression of genes on the T-DNA occurs in this same time frame, we injected tobacco leaves with A. tumefaciens AGL1 harbouring a construct expressing YFP-AGC3-4 under control of the 35S promoter and terminator on its
4
the protein kinase AGC3-4 [25] localizes in discrete dots as well as in the nucleus of plant cells. Exactly 24 hours after injection with AGL1(YFP-AGC3.4) strong nuclear fluorescent signals as well as discrete fluorescent dots were observed in the injected leaf segments. Figure 8 shows YFP fluorescence in discrete dots and in the nucleus (arrowhead) of cells of agroinfiltrated leaves. This indicates that genes on the T-DNA are expressed in recipient host cells within 24 hours after agroinfiltration.
YFP CF DIC Merged
Figure 8: Visualization of T-DNA expression 24 hours after agroinfiltration of N. tabacum SR1 leaves with A. tumefaciens AGL1(YFP-AGC3.4) harbouring a T-DNA with a gene encoding YFP-AGC3-4 expressed by the 35S promoter and terminator. CF, chloroplast autofluorescence.
DIC, differential interference contrast microscopy. Scale bar, 35 µm. Arrowhead: nuclear YFP fluorescence as a result of T-DNA expression.
4
DISCUSSION
In Chapter 2 we have shown that the virulence protein VirE2 co-localizes and physically interacts with microtubules in yeast. Here, we investigated whether a similar localization of VirE2 could be detected in a plant background.
For this purpose, YFP-VirE2 was expressed in A. thaliana Columbia protoplasts and its localization was studied by CLS microscopy. It was found that YFP-VirE2 is also visible as filamentous structures in plant protoplasts (Figure 1A and 1B).
Subsequent disruption of microtubule structures by treatment with oryzalin led to a shortening (Figure 1D) or in some cases complete abolishment (Figure 1C) of these filamentous YFP-VirE2 structures. This finding suggests, that as in yeast, VirE2 localizes to the microtubule network in plant cells. This localization is not in line with reports indicating that N-terminally tagged VirE2 expressed in tobacco protoplasts and onion cells localizes in the nucleus [26][27], but matches better with a study by Bhattacharjee et al. [28], who detected YFP-VirE2in the cytoplasm of Arabidopsis root cells and tobacco protoplasts. The latter authors reasoned that the different localizations reported could be due to different protein tags used in these studies which may alter the properties of the VirE2 protein.
As we have observed similar localizations of CFP-, GFP-, BiFC- and GFP 11- tagged VirE2 proteins in yeast (Chapter 2 and 3) this reasoning seems less likely.
In our opinion it is more likely that nuclear uptake of VirE2 is conditional and be more efficient in the tobacco used than in Arabidopsis and yeast cells used.
To our knowledge, nuclear localization of tagged VirE2 has currently not been reported in Arabidopsis cells expressing this virulence protein.
García-Rodríguez et al. [11] reported that the virulence protein VirE3 interacts with the importin alpha isoform Impα-4 and the plant specific general transcription factor pBrp which was revealed by means of a yeast two-hybrid screen. To confirm these interactions and to determine their localization, in this study we used a BiFC approach in A. thaliana protoplasts. In yeast cells YFP- VirE3 localizes at the spindle pole bodies (Chapter 2, Figure 8). However, in protoplasts expression of YFP-VirE3 led to a mainly nuclear fluorescent signal, while some fluorescence was also detected in the cytoplasm (Figure 2). This is in accordance with reports of Lacroix et al. [10], who detected a nuclear localization of GFP-VirE3 in tobacco and COS-1 cells and García-Rodríguez et al. [11], who found a nuclear localization of GFP-VirE3 in onion cells. These findings suggest that a specific nuclear import pathway is used in plant (and mammalian) cells for the nuclear uptake of VirE3 that is not used in yeast cells or that VirE3 has
4
4 protein is an importin alpha isoform and prior studies have shown a nuclear localization of the A. thaliana importin alpha proteins upon expression in tobacco protoplasts [29]. As expected, YFP-Impα-4 expressed in A. thaliana protoplasts has also a nuclear localization (Figure 2B). To confirm the reported interaction of this importin with VirE3 in vivo, we expressed YC-VirE3 and YN-Impα-4 in protoplasts. The reconstituted YFP signal was observed in the nucleus (Figure 3).
In negative control experiments, expressing either protein pairs YC-VirE3 and YN or YC and YN-Impα-4, no fluorescence could be detected, indicating a true interaction between VirE3 and Impα-4.
As shown in Figure 4, the localization of YFP-pBrp is similar as that of chloroplasts. This observation is in agreement with that made by Lagrange et al.
[24] in A. thaliana plants stably expressing pBrp-eYFP. Using the colocalization highlighter plug-in for ImageJ (Pierre Bourdoncle, Service Imagerie, Institut Jacques Monod, France, http://rsbweb.nih.gov/ij/plugins/colocalization.html) we found that 44% of the chloroplast fluorescence co-localized with the YFP-pBrp signal (Figure 4). It is possible that not all chloroplast fluorescence was captured which could lead to the observed partial colocalization. The colocalization highlighter plug-in operates on a pixel-by-pixel basis and the relatively stronger YFP fluorescence (compared to chloroplast fluorescence) may have led to an underestimation of the co-localization. It is, however, clear that YFP-pBrp localizes in a similar way as chloroplasts. To study the interaction between VirE3 and pBrp we expressed YC-VirE3 and pBrp-YN in protoplasts. As shown in Figure 5 a relatively strong reconstituted YFP signal was observed with a localization similar as that of YFP-pBrp (Figure 1 and 2). Lagrange et al. [24]
have shown that pBrp is able to travel from the cytoplasmic face of chloroplasts to the nucleus. As suggested by García-Rodríguez et al. upon binding of VirE3 to pBrp, both proteins may travel together to the nucleus where pBrp can activate transcription of specific genes which may benefit AMT. The observed localization of this interaction (Figure 5) is in line with this idea.
In Chapter 3 we visualized the translocation of virulence proteins from A.
tumefaciens to recipient yeast cells. We found that the virulence proteins VirD2, VirD5, VirE2 and VirF were translocated in a time frame of 22 to 25 hours after the start of cocultivations. In this study we used the split GFP system to visualize translocated GFP 11-VirD2, GFP 11-VirD5, GFP 11-VirE2 and GFP 11-VirF in N. tabacum leaf epidermal cells expressing GFP 1-10. Tobacco leaves were injected with A. tumefaciens strains expressing GFP 11-tagged virulence proteins
4
Translocation of all virulence proteins studied could be detected within 24 hours after infiltration (Figure 7). Translocated GFP 11-tagged VirD2 was observed in the nucleus of leaf epidermal cells (Figure 7A). This nuclear localization is in accordance with our observations in yeast (Chapter 3). In addition, Citovsky et al. [26] showed that the GUS-VirD2 reporter protein expressed in N. tabacum protoplasts is localized in the nucleus.
In our agroinfiltration experiments we could detect translocated GFP 11-tagged VirE2 in the nucleus and to some extent in the cytoplasm of epidermal cells of the injected leafs (Figure 7C). The found nuclear localization is in line with reports indicating that N-terminally tagged VirE2 expressed in tobacco protoplasts and onion cells localizes in the nucleus [26][27]. In contrast, translocated GFP 11-tagged VirE2 proteins were observed as filaments in recipient yeast cells (Chapter 3).
Agroinfiltration of tobacco leaves with A. tumefaciens strains expressing GFP 11-tagged VirF resulted in both cytoplasmic and nuclear fluorescence (Figure 7D). In contrast, in yeast translocated GFP 11-VirF was found in dot- shaped structures (Chapter 3). It has been suggested that VirF is involved in targeted protein degradation during AMT [12]. In agreement with this possible function, the observed cytoplasmic and nuclear localization of translocated GFP 11-VirF in tobacco cells is similar to that of core subunits of the SCF-complex involved in targeted proteolysis [30].
As shown in Figure 7B, translocated GFP 11-VirD5 was found in the cytoplasm. This is in contrast to what we observed in yeast. As shown in Chapter 3, translocated GFP 11-Vir5 was detected as discrete dots in yeast cells. At the moment, we do not have an explanation for these different localizations.
It has to be noted that, compared to yeast cells, it was technically (more) difficult to perform time-lapse experiments with leaf segments of infiltrated tobacco plants to visualize protein translocation in real time. The plant epidermal cell is significantly larger than a yeast cell which makes it impossible to study many cells at the same time. Moreover, cells from a cut leaf segment might dehydrate or die during a time-lapse experiment, giving rise to autofluorescence which makes microscopic interpretation even more difficult.
4
To obtain information on the time of cocultivation required to observe the expression of genes on the T-DNA in N. tabacum, we injected tobacco leaves with A. tumefaciens AGL1(YFP-AGC3.4) harbouring YFP-AGC3-4 under control of the 35S promoter and terminator on its T-DNA. As shown in Figure 8 a strong nuclear signal of YFP-AGC3-4 could be detected 24 hours after agroinfiltration.
In addition, YFP fluorescence was observed in dots all over the cell. This localization is typical for AGC3-4 (K. Van Gelderen, unpublished results). The results demonstrate that protein translocation and expression of T-DNA derived genes can all occur within a time frame of 24 hours.
ACKNOWLEDGEMENTS
We thank Bert van der Zaal for the A. thaliana cDNA library; Amke den Dulk-Ras for assistance with leaf disc transformations; Shaul Yalovsky (Tel Aviv University, Isreal) for providing the pSY728, pSY735, pSY736 and pSY738 vectors; Duarte Mateus for help with the BiFC experiments in protoplasts, Carlos Galván Ampudia for the AGL1(YFP3-4) strain and Kasper van Gelderen for his technical assistance with microscopy of plant cells. This research has been funded by the division Chemical Sciences (CW) of the Netherlands Organisation of Research (NWO), TOP-grant number 700.56.303.
4
REFERENCES
1. Yanofsky MF, Porter SG, Young C, Albright LM, Gordon MP, Nester EW: The virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease. Cell 1986, 47:471–477.
2. Jayaswal RK, Veluthambi K, Gelvin SB, Slightom JL: Double-stranded cleavage of T-DNA and generation of single-stranded T-DNA molecules in Escherichia coli by a virD-en- coded border-specific endonuclease from Agrobacterium tumefaciens. J. Bacteriol. 1987, 169:5035–45.
3. Young C, Nester EW: Association of the VirD2 protein with the 5’ end of T strands in Agrobacterium tumefaciens. J. Bacteriol. 1988, 170:3367–74.
4. Dürrenberger F, Crameri A, Hohn B, Koukolíková-Nicola Z: Covalently bound VirD2 pro- tein of Agrobacterium tumefaciens protects the T-DNA from exonucleolytic degradation.
Proc. Natl. Acad. Sci. U.S.A. 1989, 86:9154–8.
5. Pansegrau W, Schoumacher F, Hohn B, Lanka E: Site-specific cleavage and joining of sin- gle-stranded DNA by VirD2 protein of Agrobacterium tumefaciens Ti plasmids: analogy to bacterial conjugation. Proc. Natl. Acad. Sci. U.S.A. 1993, 90:11538–42.
6. Vergunst AC, Van Lier MCM, Den Dulk-Ras A, Stüve T a G, Ouwehand A, Hooykaas PJJ:
Positive charge is an important feature of the C-terminal transport signal of the VirB/
D4-translocated proteins of Agrobacterium. Proc. Natl. Acad. Sci. U.S.A. 2005, 102:832–7.
7. Gietl C, Koukoulíková-Nicola Z, Hohn B: Mobilization of T-DNA from Agrobacterium to plant cells involves a protein that binds single-stranded DNA. Proc. Natl. Acad. Sci. U.S.A.
1987, 84:9006–9010.
8. Citovsky V, Wong ML, Zambryski P: Cooperative interaction of Agrobacterium VirE2 protein with single-stranded DNA: implications for the T-DNA transfer process. Proc. Natl.
Acad. Sci. U.S.A. 1989, 86:1193–7.
9. Sen P, Pazour GJ, Anderson D, Das A: Cooperative binding of Agrobacterium tumefaciens VirE2 protein to single-stranded DNA. J. Bacteriol. 1989, 171:2573–2580.
10. Lacroix B, Vaidya M, Tzfira T, Citovsky V: The VirE3 protein of Agrobacterium mimics a host cell function required for plant genetic transformation. EMBO J. 2005, 24:428–37.
11. García-Rodríguez FM, Schrammeijer B, Hooykaas PJJ: The Agrobacterium VirE3 effector protein: a potential plant transcriptional activator. Nucleic Acids Res. 2006, 34:6496–504.
12. Schrammeijer B, Risseeuw E, Pansegrau W, Regensburg-Tuïnk TJ, Crosby WL, Hooykaas PJ: Interaction of the virulence protein VirF of Agrobacterium tumefaciens with plant ho- mologs of the yeast Skp1 protein. Curr. Biol. 2001, 11:258–262.
13. Schrammeijer B, Beijersbergen A, Idler KB, Melchers LS, Thompson D V, Hooykaas PJ:
4
14. Magori S, Citovsky V: Agrobacterium counteracts host-induced degradation of its effec- tor F-box protein. Sci. Signal. 2011, 4:ra69.
15. Cabantous S, Terwilliger TC, Waldo GS: Protein tagging and detection with engineered self-assembling fragments of green fluorescent protein. Nat. Biotechnol. 2005, 23:102–7.
16. Sparkes I a, Runions J, Kearns A, Hawes C: Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat Protoc 2006, 1:2019–25.
17. Bundock P, Den Dulk-Ras A, Beijersbergen A, Hooykaas PJ: Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. EMBO J. 1995, 14:3206–14.
18. Schirawski J, Planchais S, Haenni AL: An improved protocol for the preparation of pro- toplasts from an established Arabidopsis thaliana cell suspension culture and infection with RNA of turnip yellow mosaic tymovirus: a simple and reliable method. Journal of Virologi- cal Methods 2000, 86:85–94.
19. Bracha-Drori K, Shichrur K, Katz A, Oliva M, Angelovici R, Yalovsky S, Ohad N: Detec- tion of protein-protein interactions in plants using bimolecular fluorescence complementa- tion. Plant J. 2004, 40:419–27.
20. Abràmoff MD, Hospitals I, Magalhães PJ, Abràmoff M: Image Processing with ImageJ.
Biophotonics Int 2004, 11:36–42.
21. Beijersbergen a, Dulk-Ras a D, Schilperoort R a, Hooykaas PJ: Conjugative transfer by the virulence system of Agrobacterium tumefaciens. Science 1992, 256:1324–7.
22. Baskin TI, Wilson JE, Cork A, Williamson RE: Morphology and microtubule organiza- tion in Arabidopsis roots exposed to oryzalin or taxol. Plant cell physiology 1994, 35:935–
942.
23. Gleave AP: A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Molecular Biology 1992, 20:1203–1207.
24. Lagrange T, Hakimi M, Pontier D, Courtois F, Alcaraz JP, Grunwald D, Lam E, Le- rbs-mache S: Transcription Factor IIB ( TFIIB ) -related protein ( pBrp ), a plant-spe- cific member of the TFIIB-related protein family. Molecular and Cellular Biology 2003, 23:3274–3286.
25. Galván-Ampudia CS, Offringa R: Plant evolution: AGC kinases tell the auxin tale.
Trends Plant Sci. 2007, 12:541–7.
26. Citovsky V, Zupan J, Warnick D, Zambryski P: Nuclear localization of Agrobacterium VirE2 protein in plant cells. Science 1992, 256:1802–5.
4
27. Tzfira T, Vaidya M, Citovsky V: Involvement of targeted proteolysis in plant genetic transformation by Agrobacterium. Nature 2004, 431:87–92.
28. Bhattacharjee S, Lee L-Y, Oltmanns H, Cao H, Veena, Cuperus J, Gelvin SB: IMPa-4, an Arabidopsis importin alpha isoform, is preferentially involved in Agrobacterium-mediated plant transformation. Plant Cell 2008, 20:2661–80.
29. Smith HM, Hicks GR, Raikhel N V: Importin alpha from Arabidopsis thaliana is a nu- clear import receptor that recognizes three classes of import signals. Plant Physiol. 1997, 114:411–7.
30. Blondel M, Galan JM, Chi Y, Lafourcade C, Longaretti C, Deshaies RJ, Peter M: Nucle- ar-specific degradation of Far1 is controlled by the localization of the F-box protein Cdc4.
EMBO J. 2000, 19:6085–97.
