In vitro assays to determine chronotype

(1)

In vitro assays to determine

chronotype

THESIS

Rotterdam, June 16

th

₂₀₁₆

D. Mulders 2059606/590015 dgjc.mulders@student.avans.nl /d.mulders@erasmusmc.nl

Institution

Avans University of Applied Sciences,

School of Life Sciences and Environmental

Technology

Lovensdijkstraat 61

4818 AJ Breda

Graduation firm

Erasmus MC, Department of Molecular

genetics

Wytemaweg 80

3015 CN Rotterdam

Supervisors Erasmus MC

Prof. Dr. Bert van der Horst

g.vanderhorst@erasmusmc.nl

Dr. Inês Chaves

i.chaves@erasmusmc.nl

Supervisor Avans

Walter van Gils

w.vangils@avans.nl

Educational program

Biological and Medical Laboratory

Research

Major Forensic Science

Graduation period

1

st

_{February 2016 – 1}

st

_{July 2016}

(2)

Summary

The circadian clock is an endogenous biological timing system which is present in all organisms. In mammals, the circadian clock is located in the suprachiasmatic nucleus (SCN) in the hypothalamus. This master clock generates self-sustained rhythm with a period of about 242 hours. The SCN clock is daily reset by light in order to keep pace with the day/night cycle. The SCN sends signals (hormones and neuronal signals) to peripheral clocks in almost all cells and tissues. The circadian clock can also be monitored in cluttered cells, and the amplitude and period of the oscillation can be determined. However, to determine the chronotype, which represents the behavior and desired time of sleep in a 24-hour light/dark cycle, the phase of entrainment needs to be determined. It is important to develop tools to determine the chronotype in vitro, this information can be used to further analyze the relation between chronotype and health.

By introducing melanopsin into cells grown in vitro, these can be entrained by light which makes it possible to determine the phase of entrainment (this is not detectable with a one-time synchronization cue). This information can help verifying the chronotype, which can possibly help in diagnosing people who have extreme chronotypes and might therefore suffer from Delayed Sleep Phase Syndrome (DSPS) or Advanced Sleep Phase Syndrome (ASPS). The verification of the chronotype from a very early stage (newborns) can be used in the Generation R studies (focus on growth, development and health from fetal life to young adult), here the chronotype can be monitored over the years and the relation between chronotype and illnesses can be determined. Melanopsin was transiently introduced into MRC5 human fibroblasts and MCF7 human tumor cells after which clones were made, to obtain cell lines stably expressing melanopsin. Western Blot analysis on the population of MRC5 cells did not show expression of the melanopsin protein, while MCF7 cells did express the melanopsin protein. The populations were entrained by light, the MRC5 cells showed an oscillation when kept in dark conditions but no oscillation was observed when entrained by daily light pulses. The MCF7 cells showed an oscillation when kept in dark conditions and when entrained by daily light pulses.

Next, clones of the MRC5 and MCF7 cell line stably expressing melanopsin will be analyzed for the presence of the melanopsin protein with Western Blot analysis. Cells will be entrained by light and kept in dark conditions (negative control) to determine the possible presence of an oscillation. Also more research into hMSCs needs to be conducted by analyzing more antibodies and the possibility of these cells to differentiate, which will attribute to the evidence that mesenchymal stem cells are derived from the Wharton’s Jelly. Melanopsin will be introduced into these cells and entrained by light to possibly obtain an oscillation.

Human mesenchymal stem cells (hMSCs) can be reproducibly derived from the Wharton’s jelly of umbilical cords. These cells express matrix receptor CD44 and integrin CD29 while these lack expression of hematopoietic lineage marker CD45, which represent the expression pattern for mesenchymal stem cells. When these Bmal1::luc was transiently introduced into these cells and synchronized with either 0.1µM dexamethasone, 10µM forskolin or 50% FCS shock no oscillation was observed.

(4)

Samenvatting

De circadiane klok is een endogeen biologisch tijdsysteem aanwezig is alle organismes. In zoogdieren, de circadiane klok is gelokaliseerd in de suprachiasmatische nucleus (SCN) in de hypothalamus. Deze centrale klok genereert een zelf-onderhoudend ritme met een periode van ongeveer 24 uur. De SCN klok is dagelijks reset door licht om de dag/nacht cyclus bij te houden. De SCN stuurt signalen (hormonale en neuronale signalen) naar perifere klokken in bijna alle cellen en weefsels. De

circadiane klok kan ook gecontroleerd worden in cellen, en de amplitude en periode van de oscillatie kan bepaald worden. Maar, om het chronotype te bepalen, deze representeert het gedrag en

voorkeur van tijd om te gaan slapen in een 24-uur licht/donker cyclus, moet de fase van entrainment bepaald worden. Het is belangrijk om methodes te ontwikkelen waarbij het chronotype in vitro bepaald kan worden, deze informatie kan gebruik worden in verdere analyses in de relatie tussen chronotype en gezondheid.

Wanneer melanopsine geïntroduceerd wordt in cellen in vitro, kunnen deze cellen gereset worden met behulp van licht zodat de fase van entrainment bepaald kan worden (dit kan niet bepaald worden door middel van een eenmalige synchronisatie signaal). Deze informatie kan helpen bij het verifiëren van het chronotype, wat kan helpen in het stellen van een diagnose bij mensen met extreme chronotypes en hierdoor mogelijk lijden aan ‘Delayed Sleep Phase syndrome (DSPS)’ of ‘Advanced Sleep Phase syndrome (ASPS)’. Wanneer het chronotype vroeg bepaald kan worden (bij pasgeborene), kan dit gebruikt worden in de Generation R studie (focus op groei, ontwikkeling en gezondheid van geboorte tot adolescentie), hierbij kan het chronotype gemonitord worden door de jaren heen en de relatie tussen chronotype en ziektes bepaald worden.

Melanopsine was transient geïntroduceerd in MRC5 menselijke fibroblasten en MCF7 menselijke tumor cellen, waarna klonen gemaakt zijn zodat cellijnen verkregen konden worden die stabiel melanopsine tot expressie brengen. Western Blot analyse op de populatie van MRC5 cellen gaf geen expressie van het melanopsine eiwit, terwijl MCF7 cellen dit eiwit wel tot expressie brachten. De populaties waren gereset met behulp van licht, MRC5 cellen hadden een oscillatie in donkere condities, maar niet wanneer deze gereset waren met behulp van dagelijkse licht pulsen. De MCF7 cellen hadden een oscillatie zowel in donkere condities als wanneer deze gereset waren met dagelijkse light pulsen.

Hierna zullen de klonen van de MRC5 en MCF7 cellen die stabiel melanopsine tot expressie brengen geanalyseerd worden voor de aanwezigheid van het melanopsine eiwit met behulp van Western blot analyse. De cellen zullen gereset worden met behulp van licht en als negatieve controle ook in donkere condities gehouden worden om mogelijk een oscillatie aan te tonen. Ook zal er meer onderzoek gedaan worden naar menselijke mesenchymale stamcellen (hMSC) waarbij meer antilichamen geanalyseerd zullen worden en de mogelijkheid van deze cellen om te differentiëren. Dit zal bijdragen aan het bewijs dat de cellen uit het Wharton’s Jelly daadwerkelijk mesenchymale stamcellen zijn. Melanopsine zal ook hierbij geïntroduceerd worden in de cellen en gereset door light waarbij mogelijk een oscillatie verkregen kan worden.

Menselijke mesenchymale stamcellen (hMSC) kunnen reproduceerbaar verkregen worden uit het Wharton’s Jelly van navelstrengen. Deze cellen brengen matrix receptor CD44 en integrine CD29 tot expressie, waarbij de expressie van de hematopoietische marker CD45 niet aanwezig is wat het expressie patroon van mesenchymale stamcellen representeert. Bij het transient introduceren van Bmal1::luc in deze cellen en synchroniseren met behulp van ofwel 0.1µM dexamethason, 10µM forskoline of een 50% FCS shock wordt er geen oscillatie geobserveerd.

(5)

Author: D. Mulders

Introduction

All organisms have an endogenous biological timing system which is called the circadian clock, it regulates metabolism, physiological processes and behavior [ CITATION Pan02 \l 1043 \m Placeholder1]. Since the light/dark cycle of the earth is exactly 24 hours, the internal circadian clock needs to adapt to the earth’s rhythmic cycle by entrainment. This entrainment can be achieved mainly with light, but also other inputs from the environment such as temperature. When the input from light is received, the molecular clock is reset which is present in the suprachiasmatic nucleus (SCN) in the hypothalamus. This information can be transmitted by the SCN to reset the cells in the peripheral organs [ CITATION Rep02 \l 1043 ]. Understanding the circadian clock can help diagnose and possibly treat people who suffer from sleep-phase syndromes, but can also be used to understand the consequences of performing shift work or having a jet-lag [ CITATION Yos08 \l 1043 \m Wit06].

Chronotype refers to the behavior and timing of sleep within the 24-hour light/dark cycle [ CITATION OSh001 \l 1043 ]. Extreme chronotypes (very late or very early) can result in Delayed Sleep Phase Syndrome (DSPS) or Advanced Sleep Phase Syndrome (ASPS). People who suffer from ASPS have a shorter tau (period) than the intermediate chronotype, while people who suffer from DSPS seem to show the same tau but possibly a different phase . A persons chronotype cannot yet be determined with in vitro assays, here only the tau (time interval between phase reference points) and amplitude (difference in level between peak and trough values) can be obtained where the phase (timing of reference point in the peak relative to a fixed event) is needed for chronotype determination [ CITATION Vit01 \l 1043 ]. In vitro light entrainment could be a tool to obtain the phase of an oscillation, which could lead to the identification of differences in the phase of entrainment. When the phase of entrainment can be identified, a persons’ chronotype could be determined. While this can be used for diagnosis of sleep-phase syndromes, it could also apply to the Generation R-study in which children are followed from birth until 18 for analysis of growth, health and development [ CITATION Hof04 \l 1043 ]. When a child’s chronotype can be determined at birth, the changes in chronotype can be monitored as well as the relation between chronotype and health.

The main aim of this research project was to develop assays to determine chronotype and circadian clock period in vitro. The first objective was to identify a circadian clock defect in fibroblast cell from DSPS patients using ectopic expression of melanopsin and light entrainment. This will be examined with use of the Lumicycler-32 and gene expression analysis. We expect to identify a delayed phase on entrainment in cells from DSPS patients in comparison to control subjects and MRC5 fibroblasts, used as a proof of principle.

The second objective was to use umbilical cord derived human mesenchymal stem cells (hMSC) to determine circadian clock period and chronotype of newborns, as a tool to determine health risk later in life. We expect to isolate hMSC and identify a circadian rhythm in synchronized cell cultures.

(6)

Figure 1 Light signals are detected by photoreceptor cells such as rods, cons and ganglion cells in the retina and transmitted to neurons of the suprachiasmatic nucleus (SCN) via the retinohypothalamic tract (Koch, Nagtegaal, Kerkhof, & ter Wee, 2009). Melatonin is a hormone produced in the pineal gland and released when the body is getting ready for the night, to sleep (Lerner, Case, Takahashi, Lee, & Mori, 1958).

Theoretical background

Circadian rhythm

The rotation of the earth creates multiple changes within its environment which create the different seasons, but these changes are also present within the 24 hour day/night cycle such as light and temperature. To anticipate and prepare for these signals or ‘zeitgebers’ (external stimuli), organisms have evolved several endogenous synchronized timing systems which was firstly noticed by Jean-Jacques d’Ortous de Mairan in 1729 [ CITATION Pit93 \l 1043 ]. These timing systems have similarities throughout the organisms, also at molecular level [ CITATION Tia97 \l 1043 ]. The central quality of the clock and to be called circadian (circa = about a; diem = day), it has the ability to oscillate with a self-sustained rhythm, in constant conditions [CITATION Roe03 \t \l 1043 ].

The master clock or pacemaker is located within the brain. Lesion experiments were performed on rodents and squirrel monkeys, where parts of the brain were damaged. Lesions made within parts of the suprachiasmatic nucleus (SCN), showed arrhythmic behavior of the animals and failed to be entrained to light-dark cycles [ CITATION Ste72 \l 1043 \m Edg93].

Suprachiasmatic nucleus

The suprachiasmatic nucleus (SCN) is located above the crossing of the optic nerves and contains around 20,000 neurons [ CITATION Rep02 \l 1043 ], figure 1. It receives light input via the retino-hypothalamic tract. Light is detected by photoreceptor cells such as rods, cones and ganglion cells in the retina and transmitted to neurons of the SCN via the retinohypothalamic tract [CITATION Bal98 \t \m Ber02 \m Bja00 \t \l 1043 ]. While the SCN receives input signals through the photoreceptors in the retina, other oscillators which are operative in cells of most organs and tissues receive signals from the output of the SCN. The synchronization of peripheral organs and tissues goes through neuronal and hormonal signaling from the SCN and is delayed from the SCN for about 4 hours [ CITATION Dib10 \l 1043 \m Lop97]. When no SCN is present or it does not function the way it should to send these signals, the organs and tissues desynchronize. In in vitro studies, external stimuli such as serum shock, forskolin or dexamethasone can be used to reset the clock of individual cells [CITATION Yag001 \t \l 1043 ].

(7)

Figure 2 Schematic view of mammalian retina. Rod and cone photoreceptors are densely packed in the outer retina and are the primary photoreceptors supporting image forming (IF) vision. Light-activated signals originating from the rod/cone cells are processed in the horizontal (H), bipolar (B) and amacrine cells (A) before reaching the RGCs of the inner retina. 2.5% of RGCs express melanopsin named intrinsically photosensitive (ipRGCs). These also receive signals originating from the outer retina rod/cone photoreceptors. RPE: retinal pigment epithelium; OPL: outer plexiform layer; INL: inner nuclear layer; IPL: inner plexiform layer; GCL: ganglion cell layer(Hatori & Panda, 2010).

Author: D. Mulders

expressed, the transcriptional-translational feedback loop [ CITATION Hat02 \l 1043 ]. The second is an input component that allows the clock to be entrained to zeitgebers, which would synchronize the circadian time with the environment (i.e. light). The third and last component is the output, this is required to use information for controlling circadian gene expression (clock controlled genes, CCGs), physiology and behavior. A clock controlled gene is a gene ‘’whose product is required for the generation and/or maintenance of the circadian clock’’ [CITATION Bal02 \t \l 1043 ].

Melanopsin

As explained above, the SCN receives it signals through the retinohypothalamic tract. In the retina, special ganglion cells express the photopigment melanopsin. Melanopsin or OPN4 is an opsin class of G-protein-coupled receptor (GPCR) which was first discovered in the photosensitive skin melanophores of Xenopus laevis (clawed frog). It has a spectral sensitivity at 480nm, which is distinct from those of classical rode/cone opsins. The defining properties of the melanopsin system are 1) spectral sensitivity, 2) retinoid use, 3) signal transduction and 4) the unusual cellular architectures of the intrinsically photosensitive retinal ganglion cells (ipRGCs), see figure 2. Melanopsin uses 11-cis retinaldehyde as a chromophore, which is a light-sensing ligand. This chromophore photo isomerizes to all-trans retinal by light activation and causes a conformational change in the protein activating down-stream signaling proteins. The initial source of 11-cis retinal and steps leading to melanopsin pigment regeneration after photo-activation are not well known[ CITATION Hat10 \l 1043 ].

Melanopsin is an important photoreceptive molecule for the circadian system in mammals, but is not essential for the circadian clock to receive photic input. Knock-out mice were used to test the importance of melanopsin, these mice were entrained to a light/dark cycle. The clock of these mice phase-shifted after a light pulse and increased the circadian period (tau, Τ) when light intensity increased [ CITATION Rub021 \l 1043 ]. There are two isoforms of melanopsin present in adult mouse retina, long isoform (Opn4L) and short isoform (Opn4S) (see figure 3), due to alternative splicing. Both isoforms are expressed in the ganglion cell layer of the retina, but Opn4S is 40 times more present than Opn4L. The long isoform codes for predicted proteins of 521 aa and the short isoform encodes for 466 aa, where the first 454 aa are identical. The only difference is found in the length of the C-terminal tails. Within the RGCs, several cells co-express Opn4L and Opn4S and several cells only express Opn4S. This last isoform from mice, relates to the human Opn4 [ CITATION Pir09 \l 1043 ].

(8)

Figure 3 Schematic diagram of genomic structure of Opn4 long and short. Opn4S has 10 exons that are about 9.6 kb of genomic DNA, Opn4L has 9 exons that are about 7.8 kb of genomic DNA (Pires, et al., 2009).

Melanopsin is part the non-image-forming system (NIF). It controls pupil size, acute suppression of locomotor behavior and melatonin release. It is present in approximately 2.5% of all retinal ganglion cells in rat eyes and the axons of these ganglion cells directly target the SCN.

Transcriptional-translational feedback loop

The molecular mechanism of the circadian oscillator is based on transcriptional-translational feedback loops, figure 4, and has been unraveled by genetic analysis in Drosophila (fruit fly) and mammals. Two transcriptional activators, CLOCK (Circadian Locomotor Output Cycle Kaput) and

Bmal1 (Brain and Muscle Arnt-like protein-1) heterodimerize and regulate gene expression by

interacting with enhancer elements, E boxes (Enhancer box, positive feedback). Target genes of the

Clock and Bmal1 activators incluce several repressor proteins, including Period (Per1 and Per2), Cryptochrome (Cry1 and Cry2) and Rev-Erbα (NR1D1, nuclear receptor subfamily 1, group D, member

1). These proteins function to inhibit the CLOCK/Bmal1 complex, thereby generating a circadian oscillation in transcription (negative feedback). A second loop is formed by Rev-Erbα which represses the transcription of Bmal1.

(9)

Figure 4 Schematic view of transcriptional-translational feedback loop stimulated by melatonin (MEL). Bmal1-clock complex stimulates the positive transcription of Rev-Erbα, Cry and Per genes. The Rev-Erbα, Cry and Per proteins stimulate the negative regulation of the Bmal1-clock complex. This process takes about 24 hours and Bmal1 is 12 hours out of phase with Per/Cry (Fu & Chi Lee, 2003; Reilly, Westgate, & FitzGerald, 2007; Reilly, Westgate, & FitzGerald, 2007; Gerstner & Yin, 2010)

Figure 5 Chronotype-relations between sex and age (Roenneberg, et al., 2004)

Author: D. Mulders

Clock and health

The circadian clock and health are related through chronotype. Chronotype relates to the desired time of sleep during the day, which can be influenced by multiple factors such as age, sex and environment (figure 5) [ CITATION Roe042 \l 1043 ].

Chronotype

The importance of the molecular is demonstrated when Bmal1 is inactivated. This results in a loss of molecular and behavorial rhythmicity. This fenomen also occurs when Per1 and Per2 or Cry1 and

Cry2 are inactivated [CITATION bae01 \l 1043 \m Bun00 \m van99]. The circadian clock properpties

of laboratory animals are almost identical for each indivudual of the same strain, due to identical genetic background, housing and food. With humans, the genetic background is different, but also housing, food and lifestyle differ from person to person. These differences contribute to the heterogeneaty of chronotypes among people. Chronotypes are normally distributed from extreme early types to extreme late types [CITATION Placeholder1 \t \l 1043 ]. An extreme late type that doesn’t fit in the ‘normal’ range of chronotypes, is a syndrome called Delayed Sleep Phase syndrome. The Delayed Sleep Phase syndrome (DSPS) is characterized by sleep-onset insomnia with difficulty in morning awakening[CITATION Cze98 \t \l 1043 ].

(10)

Figure 6 Relation between chronotype and health habits. Overall, the later the chronotype the more bad habits appear (Wittman, Dinich, Merrow, & Roenneberg, 2006)

Different chronotypes are expressed in the behavior, to when an individual’s endogenous circadian clock synchronizes to the 24hour day. Since chronotypes are predominantly defined by behavior, the Munich Chronotype Questionnaire can be used to define an individual’s chronotype by asking about sleep habits on work and free days. Hormone secretion can also be used as a determination method for chronotype, for example melatonin (‘sleep’ hormone) and cortisol (‘stress’ hormone).

Chronotype can have a lot of influence on a person’s health and clock genes have been implicated in different chronic diseases (two SNPs in Bmal1 associated with increased risk for diabetes mellitus,

Per2-3 and Cry2 downregulation associated with type 2 diabetes [ CITATION Ric13 \l 1043 ]). Overall,

the later the chronotype, the more ‘bad habits’ a person tends to have (figure 6) [ CITATION Wit06 \l 1043 ]. When these chronotypes are very extreme, people sometimes cannot work during ‘normal’ hours or attend social activities.

Sleep phase syndromes

Examples of these extreme chronotypes are Advanced Sleep Phase Syndrome (ASPS) and Delayed Sleep phase Syndrome (DSPS). In ASPS, melatonin secretion starts too early (around 8pm instead of 10pm) and the cortisol secretion also starts earlier (around 4am instead of 7am) [ CITATION Jon991 \l 1043 ]. In the case of DSPS this happens the other way around and melatonin secretion starts too late (around 4am instead of 10pm) and the cortisol secretion also starts later (around 1pm instead of 7am) [ CITATION Cze98 \l 1043 ]. These extreme chronotypes have been investigated for a long time and mutations have been found in clock genes that are possibly the cause of these syndromes. A mutation in Per2 has been associated with Advanced Sleep Phase Syndrome (ASPS), in which a target site for phosphorylation by casein kinase 1 ε is disrupted [ CITATION Toh01 \l 1043 ]. A longer allele for Per3 resulted in morningness (early chronotype, ASPS) and a shorter allele (common to be homozygous) for Per3 resulted in eveningness (late chronotype, DSPS) [ CITATION Arc03 \l 1043 ]. However, no genetic defect has yet been identified in relation to DSPS and cells from DSPS patients have a normal circadian period. This suggests that DSPS could occur as a consequence of a delayed phase on entrainment.

Mesenchymal stem cells

The umbilical cord (UC) has been found to be a rich source for stem cells, using the umbilical cord to obtain stem cells can replace the use of bone marrow stem cells. These stem cells can be derived from the blood [ CITATION Lee041 \l 1043 \m Eri001 \m Goo01] and the Wharton’s Jelly [ CITATION Kad081 \l 1043 \m Che14 \m Han13]. In this study, the Wharton’s Jelly will be used for isolation of mesenchymal stem cells (MSC). The Wharton’s Jelly (figure 7) is a mucoid connective tissue which surrounds the vein and two arteries in the UC and provides support.

(11)

Figure 7 3D image of a human umbilical cord. Mesenchymal stem cells are derived from the Wharton’s Jelly (or cord tissue), which provides support to the vein and two arteries.

Author: D. Mulders

Different methods have been used to obtain the MSCs from the Wharton’s Jelly by different research groups. Controversial results have been obtained, where some groups succeeded in isolating and maintaining these cells [ CITATION Eri001 \l 1043 \m Lee041 \m Kad081 \m Han13], where others weren’t able to isolate these cells or obtained very low yields [ CITATION Rom031 \l 1043 ].

When the cells are isolated from the Wharton’s Jelly, staining can confirm that the right cells are being cultured. MSCs express the markers CD44, CD90 and CD73, but do not express the hematopoietic lineage markers CD34 and CD45 [CITATION Wan04 \m Mal14 \m Jin09 \m Che141 \t \l 1043 ].

(12)

Materials and Methods

The following methods where used to obtain mesenchymal stem cells from the Wharton’s Jelly of umbilical cords and to stably express melanopsin by MRC5 fibroblasts and MCF7 tumor cells. The materials that were used are included.

Cell culture

Cell line MRC5 (obtained from ATCC, US) was cultured in 50% DMEM (BioWhittaker, Lonza; cat. no. BE12-604F/U1; lot no. 5MB014) + 50% Ham’s F10 (BioWhittaker, Lonza; cat. no. BE02-014F; lot no. 4MB037) medium, supplemented with 10% fetal calf serum (FCS) and 100U/ml penicillin and 100µg/ml streptomycin (Sigma). MCF7 cells, already transduced with Per2::luc, (obtained from Erasmus MC, Rotterdam) were cultured in RPMI 1640 medium, supplemented with 10% fetal calf serum and 100U/ml penicillin and 100µg/ml streptomycin (Sigma). Human mesenchymal stem cells (hMSCs) were cultured in DMEM (BioWhittaker, Lonza; cat. no. BE12-604F/U1; lot no. 5MB014) with 10% FCS and 100U/ml penicillin and 100µg/ml streptomycin (Sigma). Cells were grown in an incubator (Sanyo, MCO-18AIC) of 37°C in humidified air containing 5% carbon dioxide (CO2).

Maintenance of cells was performed by splitting the cells. First, two or three washes were performed of 5ml each with PBS (Dulbecco’s, Sigma). To break the bonds cells have made with the bottom of the dish and with each other, 1ml Trypsin-EDTA (TE) was added and left in the incubator for 3-5 minutes. When cells were loose, the required dilutions were made into new Ø100mm CELLSTAR Tissue Culture Dishes (Greiner bio-One, Kremsmünster, DE). To store cultured cells, a 20% freezing solution was made with 1ml DMSO and 4ml DMEM/F10 medium (supplemented with 10% FCS and 100U/ml penicillin and 100µg/ml streptomycin). When 1ml of this freezing solution was added to the loose cells in 1ml TE, a 10% freezing solution was obtained. This was distributed in 1ml freezer tubes and put in a container which allows the cells to freeze slowly (around one degree per hour, faster may cause cell death) in the -80° freezer.

Isolation of mesenchymal stem cells from umbilical cord Wharton’s jelly

Fresh umbilical cords (UC) were obtained after birth and transferred to the lab within one hour. UC was first washed in PBS supplemented with and 100U/ml penicillin and 100µg/ml streptomycin (Sigma) and then washed twice in 70% ethanol. Again the UC was washed in PBS supplemented with 100U/ml penicillin and 100µg/ml streptomycin (Sigma) and cut into ~1cm pieces. These pieces were again cut into ~0.5cm3_{explants and placed into 10cm dishes with 5ml medium (DMEM, 10% FCS,}

100U/ml penicillin and 100µg/ml streptomycin). After 7-10 days, the explants were removed from the dish and the next day trypsinated and left to grow to confluency in a Ø60mm CELLSTAR Tissue Culture dish. The expression of MSC related cell-surface antigens was assessed by flow cytometry.

Creating stable melanopsin expressing cell lines

Melanopsin (mOpn4) was introduced into two different non-confluent cell lines, MCF7 (breast tumor cells, stable cell line expressing Per2::luc) and MRC5 (human fibroblasts). A transfection complex was mixed, containing per dish 2ml medium, 200µl optiMEM and 4µl X-tremeGene HP DNA Transfection Reagent (Roche Life Sciences, Basel, Switzerland) per 1µg DNA. 48 hours after transfection, the medium was supplemented with 250µg/µl G418 (Genetecin) antibiotic for MRC5 cells and 800µg/µl G418 for MCF7 cells. From this point on, cells were cultured in medium supplemented with G418. When grown to 80-100% confluence, the cells were plated in a 96-well plate in a gradient of 256 to 1 cell per well. Wells that contained 1 cell per well were provided with fresh G418 supplemented medium every 2-3 days. Cells were grown to 80-100% confluence and plated onto 48-well plate. This procedure was repeated until cells were grown onto Ø100mm culture dishes.

(13)

Author: D. Mulders

Flow cytometry

hMSCs were seeded in Ø35mm CELLSTAR Tissue Culture dishes and left to grow in an incubator of 37°C and 5% CO2, until 80-100% confluence. The cells were lysed with TE and washed with PBS

containing 0.5% BSA and 0.05% NaAc. Hereafter, the antibody was added (dilution of 1:400 in PBS) and incubated on ice for 30 minutes sealed from light. The cells were again washed with PBS containing 0.5% BSA and 0.05% NaN3 and then taken to the FACS (Fluorescent-activated cell sorting).

The antibodies used were CD44-APC (eBioscience Inc, San Diego, CA; lot no. E08452-1635; adhesion molecule through binding to hyaluronate; 780nm) and CD29-FITC (eBioscience Inc, San Diego, CA; lot no. E11761-1630; Beta 1). Positive staining for these antibodies is an indication of the presence of mesenchymal stem cells. When the antibody CD45-PE (Biolegend; lot no. B199461; glycoprotein) is negatively stained, this is a second indicator for the presence of mesenchymal stem cells.

Recombinant DNA technique and restriction enzyme digestion

Bmal1::luc was generated with a Midiprep. With the PureYieldTM_{Plasmid Midiprep System}

100-200µg of plasmid DNA with A260/A280 > 1.7 can be obtained, from a 50-100ml overnight culture of

bacteria which is transformed with a high-copy-number plasmid [CITATION Pro16 \l 1043 ]. In this case, the plasmid used for transformation was the pGL4.11 vector which encodes the luciferase reporter gene and the promotor Bmal1 [CITATION Pro15 \l 1043 ].

With use of restriction enzyme digestion, the presence of Bmal1::luc was determined with the restriction enzymes Eco RI, Hind III and and Xho I. The molecular ladder λ+PstI was used to identify the right size of the fragments. Real time imaging was used to determine if the generated Bmal1::luc could be used for experiments.

Transfection, synchronization and photoentrainment

Before transfection, cells were distributed in Ø35mm CELLSTAR Tissue Culture dishes and allowed to grow in an incubator of 37°C and 5% CO2 for 24 hours. A transfection complex was mixed, containing

per dish 2ml medium, 200µl optiMEM and 4µl X-tremeGene HP DNA Transfection Reagent (Roche Life Sciences, Basel, Switzerland) per 1µg DNA. Medium was supplemented with Bmal1::luc (0.01µg DNA/µl medium) and 10% transfection complex. 48 hours after transfection, the cells were synchronized. This was performed following different methods:

Forskolin

With 10µm Forskolin (Sigma) in 25mM Hepes (Gibco, lot no. 4MB037) and 1mM Luciferin (Caliper Life Sciences, Hopkinton, MA, USA). Forskolin, a natural bicyclic diterpene (organic compound), is known to elevate cAMP levels by activating adenylyl cyclase [CITATION ONe08 \t \l 1043 ]. Through the protein kinase A (PKA) signaling pathway, phosphorylation is enhanced and Ca2+_/cAMP

responsive element binding (CREB) protein is activated. This activation leads to transcription of Per1, which resets the clock [CITATION Yag00 \t \l 1043 \m Ger10].

Dexamethasone

With a 0.1µM Dexamethasone pulse of one hour with 25mM Hepes and 1mM Luciferin already in the old medium (old medium was placed back after one hour pulse). Dexamethasone is a synthetic glucocorticoid, which is a steroid. It has been reported to induce circadian gene expression and change the phase of peripheral clocks, without changing the phase of the central clock [ CITATION Bal00 \l 1043 ]. By ‘shocking’ cells with dexamethasone, SIRT1 (an NAD+_{-dependent protein}

deacetylase required for circadian transcription of several clock genes, including Bmal1 and Per2) binds CLOCK-BMAL1 in a circadian way and promotes the deacetylation and degradation of Per2 [CITATION Ash08 \t \l 1043 ].

(14)

Photoentrainment

Light entrainment was used for synchronization of cells expressing melanopsin. Dishes were kept in darkness after transfection and sealed under red light conditions in an otherwise dark room. Daily light pulses of one hour with a 810 lumen/11.5W LED lamp of 2800K at approximately 20cm were given inside an incubator of 37°C and 5% CO2. The light was switched on and off by a timer, so no

human error could be made in this part. After the desired amount of time (5 days, 6 light pulses) the dishes were put into the Lumicycle to monitor the oscillation of Bmal1::luc for MRC5 cells or Per2::luc for MCF7 cells. Moving of the dishes was done under red light conditions in an otherwise dark room. Or after 4days where dishes were 12 hours out of phase with each other to monitor a 24 hour cycle for clock gene expression during the day.

Immunoblot

MRC5 and MCF7 cells expressing either mOpn4S, mOpn4L or an empty vector were plated in six well plates (duplo per condition) and grown to 80-100% confluence. The protein was extracted from cells with 300µl RIPA lysis buffer incubated for half hour and combined 1:1 with sample buffer (2x) with heat treatment (95°C for 5min). Samples were charge separated by electrophoresis. This was transferred onto PVDF membrane with a transfersolution (700µl H2O + 200µl 100% methanol + 100µl

10x transferbuffer) and blocked in 4% milk powder in PBS containing 0.05% Tween. The membrane was incubated overnight with a primary antibody (melanopsin (goat polyclonal IgG; Lot F1807; Santa Cruz Biotechnology), 1:400 in PBS) and washed twice with PBS containing 0.05% Tween. After a 1 hour incubation at room temperature with a secondary antibody (Polyclonal rabbit, anti-goat (Lot 00045307; DAKO), 1:2000 in PBS) the membrane was again washed twice with PBS containing 0.05% Tween. The blots were visualized with 1:1 ECL plus (EMD Millipore; WBKLS0500; Fisher Scientific) for chemiluminescent detection.

Real time imaging

The circadian rhythm was monitored with the Lumicycle-32 (ActiMetrics). Plates were sealed with glass coverslips (VWR International, Radnor, PE, USA) and parafilm. The Lumicycle-32 was placed in an incubator at 37°C and monitored for the desired time in complete darkness. Data was analyzed with the Lumicycle Analysis software (ActiMetrics software) and the oscillation of the circadian rhythm was plotted in Microsoft Excel (2010).

RNA isolation and cDNA synthesis

Cells were grown on 6-wells plates and synchronized with either a one hour light pulse per day (4 consecutive days) at 11am and 11pm or 0.1µM Dexamethasone (one hour pulse of dexamethasone) at 8pm and 8am. This 12hours difference created a time window (anti-parallel circadian phase) in which different time stamps (every three hours) could be analyzed during the day but remained a 24-hour cycle. Isolation of RNA for the determination of gene expression was performed using TRIzol reagent (Life Technologies, Sigma, lot. no. BCBP3294V) and the protocol supplied by the manufacturer of the TRIzol reagent. RNA was quantified using the Nanodrop 2000c Spectrophotometer (Thermo Scientific).

To create cDNA for further analysis, 1000ng/sample RNA was synthesized with the iScript cDNA synthesis kit (Bio-Rad) and the protocol supplied by the manufacturer of the kit. cDNA was kept at -20°C until further analyses was required.

(15)

Author: D. Mulders

qPCR

Gene expression was analyzed with the qPCR (CFX96 or CFX384 Touch Real-Time PCR Detection System). 25ng RNA for a 96-well plate or 10ng RNA for a 384-well plate converted into cDNA was used for every reaction and further prepared with the iQ SYBR Green Supermix (Bio-Rad), according to the protocol supplied by the manufacturer of the SYBR Green Supermix. The primer sets that were used for the cell lines MRC5, MCF7 and hMSCs, consisted of Bmal1 (Fw: 5’ TCTTCTATTCTTGGTGAGAACCC 3’; Rv: 5’ TCCTTATCCAGTAAGCTTCACAG 3’) (Invitrogen), Per2 (Fw: 5’ TCATGATGACGTACCAGCTGCCTT 3’; Rv: 5’ TGCTGGCACTTTCCCTCCTTTCCT 3’) (Invitrogen), Cry1 (Fw: 5’ TTGGAAAGGAACGAGACGCAG 3’; Rv: 5’ CGGTTGTCCACCATTGAGTT 3’) (Biolegio) and HSGAPD as a housekeeping gene (Fw: 5’ AAGGTGAAGGTCGAGTCAA 3’ ; Rv: 5’ACCATGTAGTTGAGGTCAATG 3’) (Invitrogen). The primer sets used for the cell line NIH3T3, consisted of mBmal1 (Fw 5' GACATAGGACACCTCGCAGA 3'; Rv 5' GCCTTCCAGGACATTGGCTAA 3') (Invitrogen), mPer2 (Fw 5' AGGATCTTGATGCCAATCTACGA 3'; Rv 5' TTGGCAGACTGCTCACTACTG 3') (Biolegio), mCry1 (Fw 5' CTCCAGCGGAAACGAGAACTG 3'; Rv 5' GCTGTCCCCGAATCACAAACA 3') (Biolegio) and mB2M as a housekeeping gene (Fw 5' ACCGGCCTGTATGCTATCCAGAAA 3'; Rv 5' ATTTCAATGTGAGGCGGGTGGAAC 3') (Biolegio). Data was collected with the Bio-Rad CFX Manager Software and analyzed with Microsoft Excel (2010).

(16)

Results

Following are the results obtained in this research project, concerning MRC5 and MCF7 cells expressing melanopsin and the isolation and characterization of mesenchymal stem cells.

MRC5 cells expressing melanopsin

The MRC5 cell line is used to as proof of concept for several experiments, where the hMSC experiment is one of. When MRC5 cells are able to express melanopsin, no chemicals (forskolin or dexamethasone) are needed anymore to synchronize the cells and the experiments will be more relatable to ‘real circumstances’. When the circadian clock of a person is synchronized, the light is used as a zeitgeber and no chemicals are used. Therefore, MRC5 and in addition MCF7 cells are used as proof of concept for real time imaging and gene expression levels.

After melanopsin was introduced into the cell lines MRC5 and MCF7, synchronization of all conditions was performed as a light pulse per day for 5 consecutive days and as a negative control, dishes were kept in complete darkness. When transported in between steps, a red light was used in otherwise total dark conditions. MRC5 showed oscillations for all conditions (mOpn4S, mOpn4L and an empty vector in both light pulses and dark) (see figure 8). The same results were obtained for the MCF7 cell line with all conditions (see figure 9). This indicates that another factor might synchronize these cells, for instance temperature.

(17)

Author: D. Mulders

As shown in figure 8 and 9, all conditions show an oscillation whether the cells were kept in dark (negative control) or when synchronized by light pulses for 5 consecutive days. Due to the fact that light synchronization gave the same results as to when cells were kept in dark, the presence of melanopsin in the cells was confirmed with use of a Western Blot for MCF7 cells (figure 10), while MRC5 cells did not express melanopsin (data not shown). The samples were stained for melanopsin as the first antibody and the secondary antibody consisted of anti-goat, IgG. The presence of melanopsin was proven when a protein band of 53 kDa was visible on the blot. As a negative control, MRC5 and MCF7 cells that did not express melanopsin were used. As shown in figure 9, MCF7 cells that expressed mOpn4S and mOpn4L show a vague protein band around 53 kDa as expected. For the MRC5 cells, this protein band was not observed.

(18)

(19)

Figure 11A: Umbilical cord (UC) received fresh and washed with PBS+1% P/S

Figure 11B: UC washed with 70% ethanol twice

Figure 11C: UC washed with PBS+1% P/S and cut Into pieces of 1cm

Figure 11E: Explants removed from dish after 10 days in culture Figure 11D: 1cm pieces cut smaller

and 5ml medium (DMEM, 10% FCS, 1% P/S) added

Figure 11F: Cells from p1, in culture for 7 days

Author: D. Mulders

Mesenchymal stem cell isolation and characterization

Cells were isolated from Wharton’s jelly from human umbilical cord as shown by the photo protocol (figure 11A-F) and assessed for expression of cell surface markers after passage 3. Matrix receptor CD44 and integrin CD29 are known to be present (positive staining) for mesenchymal stem cells, whereas hematopoietic lineage marker CD45 is known to not be present (negative staining) for mesenchymal stem cells.

The results obtained show that the cells are positive for CD44 and CD29 and negative for CD45 for all MSC clones tested, as would be expected (figure 12). Umbilical cord A, clone 2 was stained at passage 6 and showed 99,6% negative staining for CD45 and 81,6% positive staining for CD44 as expected. Umbilical cord B, clone 1 was stained at passage 4 and showed 99,3% negative staining for CD45, 60,9% positive staining for CD29 and 83,6% positive staining for CD44 as expected. Umbilical cord B, clone 2 was stained at passage 4 and showed two populations of cells. The largest population showed 99,2% negative staining for CD45, 50,9% positive staining for CD29 and 47,3% positive staining for CD44.

(20)

In vitro assays to determine chronotype Author: D. Mulders

hMSCs from umbilical cord A, passage 7 were transfected with Bmal1::luc which was obtained by recombinant DNA technique. Duplicates were analyzed, synchronized with either 0.1µM dexamethasone, 10µM forskolin or a serum shock of 1.5h with 50% FCS. Some experiments showed an oscillation for the hMSCs synchronized with 0.1µM dexamethasone, while sometimes no oscillation was observed (figure 13, raw data and subtracted data). These cells were taken from the Lumicycle after 7 consecutive days and again characterized. Immuno-phenotyping of the cells indicate that two populations of cells were present, where some populations were still positive for CD44 and CD29 and negative for CD45 (figure 14) whereas other populations lost the markers CD44 and CD29 or obtained the marker CD45.

(21)

Author: D. Mulders

(22)

While different results were obtained when hMSC were synchronized with either dexamethasone or forskolin, the cells either started an oscillation from time of synchronization, or after 4-5 days or not at all (independent of passage or UC). Therefore, cells were synchronized with a 1 hour 0.1µM dexamethasone pulse and analyzed on mRNA expression level instead of a cellular level as for real time imaging, in order to determine oscillation at the level of clock gene transcription level (figure 15). No significant oscillation is observed with these results.

(23)

Author: D. Mulders

Discussion

The main aim of this research project was to develop assays to determine chronotype and circadian clock period in vitro. The first objective was to identify a circadian clock defect in fibroblast cells from DSPS patients using ectopic expression of melanopsin and light entrainment. This will be examined with use of the Lumicycler-32 and gene expression analysis. We expect to identify a delayed phase on entrainment in cells from DSPS patients in comparison to control subjects and MRC5 fibroblasts, used as a proof of principle.

The second objective was to use umbilical cord derived human mesenchymal stem cells (hMSC) to determine circadian clock period and chronotype of newborns, as a tool to determine health risk later in life. We expect to isolate hMSC and identify a circadian rhythm in synchronized cell cultures.

MRC5 cells expressing melanopsin

The MRC5 fibroblast cells were used as a proof of principle, the circadian clock was visualized with real time imaging and stable cell lines expressing different forms of melanopsin and the empty vector were made. With melanopsin, the short (mOpn4S) and long (mOpn4L) version were expressed and an empty vector as a negative control, from here the circadian clock was again visualized with real time imaging. The MRC5 cells transiently expressed Bmal1::luc and were synchronized with a one hour pulse of 0.1µM dexamethasone, but did not show an oscillation. When the MRC5 cells expressing melanopsin were entrained to light, still no oscillation was observed. As a negative control, the same type of cells were kept in dark conditions and surprisingly, these did show an oscillation. As shown before, mOpn4S is more similar to the human and rat homologues of melanopsin then mOpn4L. Therefore, MRC5 cells expressing mOpn4S should show a more robust oscillation compared to MRC5 cells expressing mOpn4L. MRC5 cells expressing the empty vector should not show an oscillation, as these cannot be entrained by light due to lack of melanopsin. The same principle was applied to MCF7 tumor cells, which were transduced with Per2::luc. MCF7 tumor cells expressing mOpn4S, mOpn4L or an empty vector all showed an oscillation whether these were entrained by light or kept in dark conditions.

Due to the fact that real time imaging did not show differences between cells expressing mOpn4S, mOpn4L or an empty vector, Western Blotting was used to visualize the expression of melanopsin by these cells. As shown in figure 10, MCF7 cells expressing mOpn4S and mOpn4L do express the melanopsin protein (protein band of approximately 53 kDa [ CITATION Bai13 \l 1043 ]) while the cells expressing an empty vector or only expressing Per2::luc did not show this protein band. This indicates that these cells are successfully transfected with melanopsin, while MRC5 cells did not express this protein (no protein bands visible around 53 kDa). By making clones and testing these again with Western Blot for the presence of melanopsin, the chances of obtaining cells that do express melanopsin improve.

Mesenchymal stem cell isolation and characterization

Multiple research groups have tried to obtain mesenchymal stem cells from the Wharton’s Jelly of umbilical cords and most of these groups were successful [ CITATION LuL06 \l 1043 \m Wan04 \m FuY06]. Characterization of these cells showed a fibroblast-like cells that grows in a spindle-like shape with expression levels of the matrix receptor CD44, integrin CD29, and lack of expression of hematopoietic lineage marker CD45 [ CITATION FuY06 \l 1043 ]. The ability of these cells to differentiate into cartilage, bone, tendon, ligament, marrow stroma and connective tissue [ CITATION Cap91 \l 1043 ] is another indicator that these cells can be classified as mesenchymal stem cells. The results obtained show the ability to successfully obtain Wharton Jelly derived mesenchymal stem cells using the explant method, cultured in DMEM medium containing 10% FCS and 1% P/S. These cells expressed CD44(+), CD29(+) and lacked expression of CD45(-) for multiple passages (at least until p7). The cells showed the ability to differentiate, where expression levels of CD44 and CD29 lowered and CD45 expression levels elevated. This event occurred after Lumicycle analysis for 7 days Page | 21

(24)

where the media contained 25mM Hepes and 1mM Luciferin, transiently expressed Bmal1::luc and were synchronized with 0.1µM dexamethasone, 10µM forskolin or 50% FCS shock. This treatment could have induced the differentiation by initiating a pathway that leads to differentiation of the cells. But there is evidence that hMSC change expression patterns of surface makers depending on culture time, even though that has not yet been identified in these results. The differences in expression of surface markers can also be due to heterogeneous cell populations of immature stem cells and more restricted progenitor cells considering the isolation protocol [ CITATION Wie06 \l 1043 ].

Real time imaging of the circadian clock of hMSCs showed no oscillation for cells synchronized with 10µM forskolin or 50% FCS shock, while synchronization with 0.1µM dexamethasone did show an oscillation on occasion after 3-4 days of analysis. Here, the signal went down in the first days (probably due to cell death) after which the signal went up again and showed an oscillation (probably due to cell growth and spontaneous synchronization of the cells). This event occurred with different cell lines from different umbilical cords, but mostly when synchronized with 0.1µM dexamethasone (supplemented data B). The differences in response of cells from the same umbilical cord, the same passage and same treatment to possible differentiation makes more experiments necessary to give a better overview of what induces differentiation. While overall no oscillation was obtained with real time imaging, mRNA expression levels were analyzed for Bmal1, Per2 and Cry1 normalized against the housekeeping gene HSGADP. Here also, no 24-hour rhythm could be obtained from these cells. More experiments with different umbilical cords, different treatments and possible differentiated hMSC should be executed to obtain a better overview of the circadian clock on a mRNA expression level in these cells.

(25)

Author: D. Mulders

Conclusion

This research project focused on methods for human chronotype determination and concerned two objectives whereas the first was to identify a circadian clock defect in fibroblast cell from DSPS patients using ectopic expression of melanopsin and light entrainment. Expectations were that a delayed phase could be identified on entrainment in cells from DSPS patients in comparison to control subjects and MRC5 fibroblasts, used as a proof of principle.

The first part of this objective can be partially answered. MRC5 cells expressing either mOpn4S, mOpn4L or an empty vector show an oscillation when kept in dark conditions, but no oscillation was observed when entrained to light. MCF7 cells expressing either mOpn4S, mOpn4L or an empty vector show an oscillation when entrained by light, but also when kept in dark conditions.

The second objective was to use umbilical cord derived human mesenchymal stem cells (hMSC) to determine circadian clock period and chronotype of newborns, as a tool to determine health risk later in life. Expectations were that hMSC could be isolated and a circadian rhythm in synchronized cell cultures could be synchronized

Results showed that hMSCs can be reproducibly derived from the Wharton’s jelly of umbilical cords. These cells express the surface markers CD29 and CD44 and lack expression of CD45, which represent the expression pattern for mesenchymal stem cells. When these cells transiently express Bmal1::luc and are synchronized with either 0.1µM dexamethasone, 10µM forskolin or 50% FCS shock no oscillation can be obtained on mRNA expression level or cellular level with real time imaging.

The main aim of this research project was to develop assays to determine chronotype and circadian clock period in vitro. These results suggest that light synchronization can be used, but it will need more research into expression of melanopsin by different cell lines and if hMSCs can express melanopsin and use a light/dark cycle to synchronize the cells.

Recommendations

hMSC have the ability to differentiate into different cell types (i.e. cartilage, bone, neuronal cells, connective tissue [ CITATION Cap91 \l 1043 ]). When this ability is proven, it is another indicator that the derived cells from the Wharton’s Jelly of the umbilical cord are hMSC. Also more expression markers can be tested, such as the MSC marker CD90 (+), matrix receptor CD105 (+), integrin CD51 (+), MSC markers SH2 (+) and SH3 (+) and lack expression of hematopoietic lineage marker CD34 (-) and B-cell marker CD19 (-) [ CITATION FuY06 \l 1043 \m Mal14].

The presence of a circadian clock can be proven by conducting more experiments, since hMSC cells have already shown different real time imaging results there is a possibility the same will happen for mRNA expression levels. Also differentiated cells can be used for real time imaging and mRNA expression level analysis, to indicate the presence of a circadian clock in these cells.

Different cell lines can be used to express melanopsin and be used as a positive control for multiple experiments so no chemicals will be needed to synchronize cells and a more ‘realistic’ experiment can be conducted considering the circadian clock.

(26)

References

Archer, S. N., Robilliard, D. L., Skene, D. J., Smits, M., Williams, A., Arendt, J., et al. (2003). A length polymorphism in the circadian clock gene per3 is linked to delayed sleep phase syndrome and extreme diurnal preference. SLEEP, 26(4), 413-415.

Asher, G., Gatfield, D., Stratmann, M., Reinke, H., Dibner, C., Kreppel, F., et al. (2008, July). SIRT1 regulates circadian clock gene expression through Per2 deacetylation. Cell, 134(2), 317-328. Bae, K., Jin, X., Maywood, E., Hastings, M., Reppert, S., & Weaver, D. (2001, May). Differential

functions of mPer1, mPer2 and mPer3 in the SCN Circadian clock. Neuron, 30(2), 525-536. Bailes, H. J., & Lucas, R. J. (2013, May). Human melanopsin forms a pigment maximally sensitive to

blue light supporting activation of Gq/11 and Gi/o signalling cascades. The Royal Society,

280(1759).

Balsalobre, A. (2002, May). Clock genes in mammalian peripheral tissues. Cell Tissue, 309, 193-199. Balsalobre, A., Brown, S., Marcacci, L., Tronche, F., Kellendonk, C., Reicardt, H., et al. (2000,

September). Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Journal

of Science, 289(5488), 2344-2347.

Balsalobre, A., Francesca, D., & Schibler, U. (1998, June). A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell Press, 93, 929-937.

Beckham, W., & Lessie, T. G. (1979, December). Response of Pseudomonas cepacia to B-Lactam Antibiotics: Utilization of Penicillin G as the Carbon Source. Journal of Bacteriology, 140(3), 1126-1128.

Berson, D. M., Dunn, F. A., & Takao, M. (2002). Phototransduction by Retinal Ganglion Cells That Set the Circadian Clock. Science Magazine, 295, 1070-1073.

Bjarnason, G., & Jordan, R. (2000). Progress in cell cycle research. In L. Meijer, A. Jézéquel, & B. Ducommun, Progress in cell cycle research (Vol. 4, pp. 201-202). New York: Springer. Bunger, M., Wilsbacher, L., Moran, S., Clendenin, C., Radcliffe, L., Hogenesch, J., et al. (2000,

December). Mop3 is an essential component of the master circadian pacemaker in mammels.

Cell Press, 103(7), 1009-1017.

Burns, J. L., Jonas, M., Chi, E. Y., Clark, D. K., Berger, A., & Griffith, A. (1996, October). Invasion of respiratory epithelial cells by Burkholderia (Pseudomonas) cepacia. Journal of Infection and

Immunity, 64(10), 4054-4059.

Caplan, A. I. (1991). Mesenchymal Stem Cells. Jounal of Orthopaedic Research, 9, 641-650. Caraher, E., Reynolds, G., Murphy, P., McClean, S., & Callaghan, M. (2007, March). Comparison of

antibiotic susceptibility of Burkholderia cepacia complex organisms when grown planktonically or as biofilm in vitro. Journal of Clinical Microbiology and infectious diseases, 26(3), 213-216. Chen, G., Yue, A., Ruan, Z., Yin, Y., Wang, R., Ren, y., et al. (2014, June). human umbilical cord-derived

mesenchymal stem cells do not undergo malignant transformation during long-term culturing in serum-free medium. PLOS One, 9(6), 1-8.

Chen, G., Yue, A., Ruan, Z., Yin, Y., Wang, R., Ren, Y., et al. (2014, June). Human Umbilical Cord-derived mesenchymal stem cells do not undergo malignant transformation during long-term culturing in serum-free medium. Plos one, 9(6), 1-8.

Czeisler, C., Richardson, G., Coleman, R., Zimmerman, J., Moore-Ede, M., Dement, W., et al. (1998). Chronotherapy: resetting the circadian clocks of patients with delayed sleep phase insomnia.

Sleep, 4(1), 1-21.

Dibner, C., Schibler, U., & Albrecht, U. (2010). The mammalian circadian timing system: organization and coordination of central and peripheral clocks. Annual review o Physiology, 72, 517-549. Edgar, D., Dement, W., & Fuller, C. (1993, March). Effect of SCN lesions on sleep in squirrel monkeys:

evidence for opponent processes in sleep-wake regulation. Journal of Neuroscience, 13(3), 1065-1079.

Erices, A., Conget, P., & Minguell, J. J. (2000). Mesenchymal progenitor cells in human umbilical cord blood. Britisch journal of Haematology, 109, 235-242.

(27)

Author: D. Mulders

Fu, Y.-S., Chen, Y.-C., Lin, M.-Y. A., Cheng, H., Chu, P.-M., Chou, et al. (2006, January). Conversion of human umbilical cord mesenchymal stem cells in Wharton's jelly to dopaminergic neurons in vitro: Potential therapeutic application for parkinsonism. Stem Cells, 24(1), 115-124.

Gerstner, J. R., & Yin, J. C. (2010, August). Circadian rhythms and memory formation. Nature Reviews

Neuroscience, 11, 577-588.

Goodwin, H., Bicknese, A., Chien, S.-N., Bogucki, B., Oliver, D., C.O., Q., et al. (2001). Multilineage differentiation activity by cells isolated from umbilical cord blood: expression of bone, fat and neural markers. Biology of Blood and Marow Transplantation, 7, 581-588.

Han, Y.-F., Tao, R., Sun, T.-J., Chai, J.-k., Xu, G., & Liu, J. (2013, January). Optimization of human umbilical cord mesenchymal stem cell isolation and culture methods. Cytotechnology, 65, 819-827.

Hancock, R. E. (1998). Resistance mechanisms in Pseudomonas aeruginosa and other

nonfermentative gram-negative bacteria. Journal of clinical infectious diseases, 27(1), 93-99. Hatori, M., & Panda, S. (2010, October). The emerging roles of melanopsin in behavorial adaption to

light. Cell Press, 16(10), 435-446.

Hattar, S., Liao, H.-W., Takao, M., Berson, D., & Yau, K.-W. (2002, February). Melanopsin-containing retinal ganglion cells: architecture, projections and intrinsic photosensitivity. Journal of Science,

295(5557), 1065-1070.

Hofman, A., Jaddoe, V. W., Mackenbach, J. P., Moll, H. A., Snijders, R. F., Steegers, E. A., et al. (2004, January). Growth, development and health from early fetal life until young adulthood: the Generation R study. Paediatric and Perinatal Epidemiology, 18(1), 61-72.

Jin Jin, H., Park, S. K., Oh, W., Sun Yan, Y., Who Kim, S., & Jin Choi, S. (2009, February).

Down-regulation of CD105 associated with multi-lineage differentiation in human umbilical cord blood-derived mesenchymal stem cells. Biochemical and biophysical research communications, 381, 676-681.

Jones, C. R., Campbell, S. S., Zone, S. E., Cooper, F., DeSano, A., Murphy, P. J., et al. (1999). Familial advanced sleep-phase syndrome: a short period circadian rhythm variant in humans. Nature

Medicine, 5, 1062-1065.

Kadam, S. S., Tiwai, S., & Bhonde, R. R. (2008, December). Simultaneous isolation of vascular

endothelial cells and mesenchymal stem cells from the human umbilical cord. In Vitro Cellular &

Developmental Biology, 45, 23-27.

Kuti, J. L., Moss, K. M., Nicolau, D. P., & Knauft, R. F. (2004). Empiric treatment of multidrug resistant Burkholderia cepacia Lung exacerbation in a patient with cystic fibrosis: application of

pharmacodynamic concepts to meropenem therapy. Journal of Pharmacotherarpy, 24(11), 1641-1645.

Lee, O. K., Kuo, T. K., Chen, W.-M., Lee, K.-D., Hsieh, S.-L., & Chen, T.-H. (2004, March). Isolation of multipotent mesenchymal stme cells from umibilical cord blood. Blood, 103(5), 1669-1675. Lopez-Malina, L., Conquit, F., Dubois-Dauphin, M., & Schibler, U. (1997, November). The DBP gene is

expressed according to a circadian rhythm in the suprachiasmatic nucleus and influences circadian behavior. the EMBO journal, 16(22), 6615-6896.

Lu, L.-L., Liu, Y.-J., Yang, S.-G., Zhao, Q.-j., Wang, X., Gong, W., et al. (2006). Isolation and characterization of human umbilical cord mesenchymal stem cells with hematopoiesis-supportive function and other potentials. Hematopoietic Stem Cells, 91, 1017-1026.

MacDonald, K. L., & Speert, D. P. (2006). Interaction of Burkholderia species with the Phagocitic system. In T. Coenye, & P. Vandamme, Burkholderia: Molecular microbiology and genomics (pp. 111-128). Wymondham: Horizon Bioscience.

Maleki, M., Ghanbarvand, F., Behvarz, M. R., Ejtemaei, M., & Ghadirkhomi, E. (2014, November). Comparison of mesenchymal stem cell markers in multiple human adult stem cells. International

Journal of Stem Cells, 7(2), 118-126.

Miyano, N., Oie, S., & Kamiya, A. (2003, May). Efficacy of disinfectants and hot water against biofilm cells of burkholderia cepacia. Journal of Biology and Pharmaceutical Bulletin, 26(5), 671-674. o. (n.d.).

(28)

O'Neill, J. S., Maywood, E. S., Chesham, J. E., Takahshi, J. S., & Hastings, M. H. (2008, May). cAMP-Dependent signaling as a core component of the mammalian circadian pacemaker. Science, 320, 949-953.

O'Shea, M. V. (1900). Fresh air, exercise and rest in the production and expenditure of cerebral energy. In M. V. O'Shea, Aspects of mental economy (pp. 163-169). Wisconsin: Bulletin of the University of Wisconsin.

Panda, S., Antoch, M. P., Miller, B. H., Su, A., Schook, A., Straume, M., et al. (2002, May). Coordinated Transcription of Key Pathways in the Mouse by the Circadian Clock. Cell Press, 109(3), 307-320. Pires, S. S., Hughes, S., Turton, M., Melyan, Z., Peirson, S. N., Zheng, L., et al. (2009, September).

Differential expression of two distinct functional isoforms of Melanopsin (Opn4) in the mammalian retina. The Journal of Neuroscience, 29(39), 12332-12342.

Pittendrigh, C. S. (1993). Temporal Organization: Reflections of a Darwinian clock-watcher.

Physiology, 55, 17-54.

Promega. (2013, October). PureYield Plasmid Midiprep System Technical Manual. Madison, Winsconsin, USA.

Promega. (2015, May). pGL4 Luciferase Reporter vectors technical manual. Madison, Winsconsin, USA.

Reppert, S., & Weaver, D. (2002, August). Coordination of circadian timing in mammals. Nature, 418, 935-941.

Richards, J., & Gumz, M. L. (2013, June). Mechanism of the circadian clock in physiology. American

Journal of Physiology, 304(12), 1053-1064.

Roenneberg, T., Daan, S., & Merrow, M. (2003, June). The Art of Entrainment. Journal of Biological

rhythms, 18(3), 183-194.

Roenneberg, T., Kuehnle, T., Juda, M., Kantermann, T., Allebrandt, K., Gordijn, M., et al. (2007). Epidemiology of the human circadian clock. Sleep medicine reviews, 11(6), 429-438.

Roenneberg, T., Kuehnle, T., Pramstaller, P. P., Ricken, J., Havel, M., Guth, A., et al. (2004, December). A marker for the end of adolescence. Currect Biology, 14(24), 1038-1039.

Romanov, Y. A., Svintsitskaya, V. A., & Smirnov, V. N. (2003). Searching for alternative sources of postnatal human mesenchymal stem cells: Candidate MSC-like cells from umbilical cord. Stem

Cells, 21, 105-110.

Ruby, N., Brennan, T., Xie, X., Cao, V., Franken, P., Heller, H., et al. (2002, December). Role of melanopsin in circadian responses to light. Science, 298(5601), 2211-2213.

Stephan, F., & Zucker, I. (1972). Circadian rhythms in drinking behavior and locomotor activity of rats are eliminated by hypothalamic lesions. Journal of Physiology, 69(6), 1583-1586.

Tian, H., McKnight, S. L., & Russell, D. W. (1997). Endothelial PAS domain protein 1 (EPAS1), a

transcription factor selectively expressed in endothelial cells. Genes and development, 11, 72-82. Toh, K. L., Jones, C. R., He, Y., Eide, E. J., Hinz, W. A., Virshup, D. M., et al. (2001, February). An hPer2

phosphorylation site mutation in familial advanced sleep phase syndrome. Science, 291(5506), 1040-1043.

van der Horst, G., Muijtjens, M., Kobayashi, K., Takano, R., Kanno, S.-i., Takao, M., et al. (1999, April). Mammalian Cry1 and Cry2 are essential for maintenance of circadian rhythms. Nature, 298, 627-630.

Vitaterna, M. H., Takahashi, J. S., & Turek, F. W. (2001, November). Overview of Circadian Rhythms.

Alcohol research & Health, 25(2), 85-93.

Wang, H.-S., Hung, S.-C., Peng, S.-T., Huang, C.-C., Wei, H.-M., Guo, Y.-J., et al. (2004, December). Mesenchymal stem cells in the Wharton's Jelly of the human umbilical cord. Stem Cells, 22(7), 1330-1337.

Wiesmann, A., Bühring, H.-J., Mentrup, C., & Wiesmann, H.-P. (2006, March). Decreased CD90 expression in human mesenchymal stem cells by applying mechanical stimulation. Head and

(29)

Author: D. Mulders

Wittman, M., Dinich, J., Merrow, M., & Roenneberg, T. (2006). Social jetlag: Misalignment of biological and social time. The journal of biological and medical rhythm research, 23(1-2), 497-509.

Yagita, K., & Okamura, H. (2000, January). Forskolin induces circadian gene expression of rPer1, rPer2 and dbp in mammalian rat-1 fibroblasts. FEBS Letters, 465(1), 79-82.

Yagita, K., & Okamura, H. (2000, January). Forskolin induces circadian gene expression of rPer1, rPER2 and dbp in mammalian rat-1 fibroblasts. Febs Letters, 465(1), 79-82.

Yoshikawa, A., Shimada, H., Numazawa, K., Susaki, T., Ikeda, M., Kato, N., et al. (2008, November). Establishment of human cell lines showing circadian rhythms of bioluminescence. Neuroscience

Letters, 446(1), 40-44.

(30)

Supplemented data

a.

Abbreviations

A Amacrine cells

B Bipolar cells

BMAL1 Brain and Muscle Arnt-like protein-1

cAMP Cyclic Adenosine triphosphate CCG Clock controlled gene

CKIε Casein Kinase Iε

CLOCK Circadian Locomotor Output Cycle Kaput

Cry Cryptochrome

CYP Cytochrome P450

Dex Dexamethasone

DMEM Dulbecco’s Modified Eagle Medium

DMSO Dimethyl sulfoxide DNA Deoxyribose nucleic acid

DSPS Delayed Sleep Phase

syndrome

E-box Enhancer box

FCS Fetal calf serum

Fors Forskolin

FW Forward primer

G418 Geniticin, selective antibiotic GCL Ganglion cell layer

GPCR G-protein coupled receptor

H Horizontal cells

hMSC Human mesenchymal stem cells

IF Image forming

INL Inner nuclear layer IPL Inner plexiform layer ipRGCs Intrinsically photosensitive

retinal ganglion cells

Luc Luciferase

MCF7 Michigan Cancer Foundation 7

MEQ Morningness-eveningness questionnaire

mM Millimole

MRC5 Medical Research Council-5 mRNA Messenger RNA

MTS 3-(4,5-dimethylthiazol-2-yl)-5- (3-carboxymethoxyphenyl)-2-

(4-sulfophenyl)-2H-tetrazolium

ng Nano gram

NIF Non-image forming

OPL Outer Plexiform layer

OPN4 Melanopsin

P/S Penicillin streptomycin PBS Phosphate Buffered Saline

Per Period

PKA Protein Kinase A

qPCR Quantitative polymerase chain reaction

Rev-Erbα NR1D1, nuclear receptor subfamily, group D, member 1 RGCs Retinal ganglion cells

RNA Ribose nucleic acid

RPE Retinal pigment epithelium RPMI Roswell Park Memorial

Institute

RV Reverse primer

SCN Suprachiasmatic Nucleus T Tau, circadian period

TE Trypsin EDTA

µg Microgram

µl Microliter

(31)

Author: D. Mulders

b.

Real time imaging of mesenchymal stem cells

Multiple umbilical cords where used to obtain mesenchymal stem cells and perform experiments with. Umbilical cord C (p3) and D (p4) were also analyzed with real time imaging after the cells have been transfected with Bmal1::luc and synchronized with either 0.1µM dexamethasone or 10µM forskolin (figure 16 for umbilical cord C and figure 17 for umbilical cord D). The results show no oscillation neither in raw or subtracted data for cells from umbilical cord C and D synchronized with 10µM forskolin, while cells from umbilical cord D synchronized with 0.1µM dexamethasone did show an oscillation in subtracted data. The raw data showed a loss of signal in the first days of analysis while the signal went back up after multiple days, but not for cells from umbilical cord C.

(32)

In vitro assays to determine chronotype