A Lipooligosaccharide Silencing RNA regulates
Campylobacter jejuni pathogenicity
D. Beerens
ErasmusMC, Medical Microbiology and Infectious Diseases, Rotterdam, the Netherlands Avans University of Applied Sciences, Academy of Life Sciences and Environmental
Technologies, Breda, the Netherlands
Abstract
The bacterial cell envelope is the most important structure to counteract the early stages of (a)biotic stressors. Bacteriophages and transcytosis across epithelial cells both induce stress on the bacterial cell envelope. In Campylobacter jejuni, modification of the bacterial cell envelope and Clusters of
Regulatory Interspaced Short Palindromic Repeats and associated genes (CRISPR-Cas) have both been
linked to defense and virulence features. Current evidence suggests that a dual function exist between regulation of cell envelope exposed Sialic Acid-containing Carbohydrates (SACS) and the CRISPR-Cas system in C. jejuni. Presence of SACS makes C. jejuni isolates highly pathogenic, provoke severe colitis and induce post-infectious complications in susceptible patients. Lack of SACS or the CRISPR-Cas marker gene cas9 strongly altered C. jejuni transcytosis across polarized Caco-2 cells, the ability to cause cellular damage and susceptibility to viruses. Recently, the Cas9 nuclease and two small CRISPR associated RNAs in Francisella novicida have been shown to regulate the lipoprotein expression on the cell envelope that is involved in cell host entrance and immune recognition. In C.
jejuni, these two small CRISPR RNAs might not only control the lipoprotein expression, but also the
cell envelope exposed SACS during viral defense and virulence features. Indeed, our results indicate that C. jejuni uses its CRISPR-Cas system to regulate its cell envelope exposed SACS in order to survive encountered biotic stresses in the environment or inside a host.
Introduction
Bacteria are continuously exposed to environmental stress. Bacteria can fall prey to lytic bacteriophages or have to deal with diverse (a)biotic stresses, such as sudden changes in temperature, exposure to antibiotics, leukocytes or UV light1. The bacterial cell envelope is the most important structure to counteract in early stages of such stressors, enabling the survival of the bacterium1. Interestingly, independent studies found evidence in different bacteria that modification of the bacterial cell envelope as a defense mechanism against lytic bacteriophages also contributes to the virulence of these bacteria2-14. Additionally, specific environmental envelope stress and bacterial membrane physiology have been indirectly linked to a
described bacteriophage defense system, the CRISPR-Cas system15-16.
The Clustered Regularly Interspaced Short
Palindromic Repeats and CRISPR Associated
genes system (CRISPR-Cas system) encodes a sequence-specific heritable adaptive immune system against invading nucleic acids, such as bacteriophages and plasmids17-19. Based on the presence of Cas3, Cas9 and Cas10 proteins, CRISPR-Cas systems are currently classified into three main groups (Type I-III), respectively20-23. The mechanism of CRISPR-Cas interference starts with CRISPR RNA transcripts that are processed into short CRISPR RNAs (crRNAs) by Cas proteins. crRNAs then guide Cas nucleases in a sequence specific manner towards invading nucleic acids. Hereafter, foreign nucleic acids are degraded in a RNA interference like manner by
CRISPR-Cas marker protein-(tra)crRNA complexes24,25. To date CRISPR-Cas systems have been found in almost 50% of bacterial and 85% of archaeal genome sequences26. Noteworthy, the Type II CRISPR–Cas system seems to be overrepresented in pathogenic bacteria.
Campylobacter jejuni, a gram-negative zoonotic
bacterial pathogen, is able to enter, survive in and translocate across the intestinal epithelial cells27. C. jejuni is a worldwide leading cause of bacterial gastroenteritis. Symptoms of C. jejuni associated gastroenteritis range from asymptotic infections to severe bloody diarrhea28. C. jejuni strains can be divided into two separate groups, based on the presence or absence of Sialic Acid-containing Carbohydrates (SACS) on their cell envelope. Sialylated C. jejuni isolates are highly pathogenic, cause a more severe colitis and are associated with post infectious complications29-34. Also, C. jejuni has been identified with a Type II CRISPR-Cas system35 which is shown in appendix I. Recently, it has been shown that lack of SACS or the CRISPR-Cas gene cas9 strongly altered C. jejuni transcytosis across polarized Caco-2 cells, the ability to cause cellular damage, immune recognition by host cells and susceptibility to viruses32. Interestingly, the Cas9 protein in combination with two small CRISPR associated RNAs (scaRNAs) in Francisella novicida have been shown to regulate the lipoprotein expression on its cell envelope36. As bacterial lipoproteins trigger a pro-inflammatory innate immune response, the silencing of this transcript plays a major role in evading the host immune response and promote virulence. In C.
jejuni, these two scaRNAs might not only
control the lipoprotein expression, but also the cell envelope exposed SACS during viral defense and virulence features, i.e. affecting recognition by the host immune system. Recently, it was established by bioinformatic analysis that the C.
jejuni scaRNA harbored significant reverse
complementary identity against Cj1135. This gene, encoding a putative glycosyltransferase, is involved in lipooligosaccharide (LOS) biosynthesis37,38 and is required to generate sialylated LOS39. Previously, it has been revealed that LOS gene Cj1135 is of importance in biofilm formation, stress survival and colonization in mice, all important virulence features of C. jejuni40,41. Because of the strong similarity
between this scaRNA and its endogenous gene
Cj1135, scaRNA in C. jejuni will from now on be
termed the Lipooligosaccharide Silencing RNA (LSRNA).
The main purpose of this study is to elucidate whether LSRNA in the CRISPR-Cas system of C.
jejuni regulates transcriptions of Cj1135.
Regulation of this putative glycosyltransferase could consequently affect the availability of the cell envelope expressed SACS and in this respect
C. jejuni pathogenicity.
Material and Methods
Bacterial strains
Seven clinical C. jejuni isolates (4 enteritis inducing and 3 Guillain-Barré syndrome (GBS) inducing), their respective cas9 deletion mutants and complemented cas9 strains were used in this study. The cas9 mutants and complemented strains were generated by genomic DNA transformation, which will be described later.
C. jejuni isolates 81176, 11168, R65, 9141, GB2,
GB11 and GB19 were recovered from the original glycerol stock by culturing them on blood agar plates, containing 5% sheep blood (Becton Dickinson) and vancomycin (10 μg/ml) unless otherwise stated. All isolates were cultured under micro-aerophilic conditions at 37°C, using anaerobic jars and an Anoxomat (Mart Microbiology B.V., Drachten, The Netherlands).
RNA analysis
Freshly overnight grown C. jejuni isolates were exposed to 3 ml of 250 mM S-Nitrosoglutathione for stress induction by nitric oxide. Hereafter, total RNA was harvested using Trizol and chloroform extraction. Briefly, 2 ml of nitric oxide induced C. jejuni isolates were centrifuged after which 1 ml of Trizol and 200 µl chloroform were added to the pellet. This solution was then mixed and centrifuged at 13.000 rpm for 15 minutes at 4°C. The supernatant was transferred to a new tube and 500 µl of isopropanol was added and incubated for 10 minutes at room temperature. This mixture was then centrifuged at 13k rpm for 10
minutes at 4°C. The resulting pellet was washed 2 times in 1ml 70% ethanol and air dried. Finally, the pellet was dissolved in nanopure water. The total RNA was treated with DNAse to remove residual DNA. 2U of DNAse was added to 10 µg of isolated RNA in a total mix of 100 µl that included 10x DNAse buffer and nanopure water. The mixture was incubated for 30 minutes at 37°C and RNA was extracted by using the phenol/chloroform extraction method. Subsequently, cDNA was generated by a reverse transcriptase (RT) reaction. 2 µl of RNA was mixed with 2 µl of random hexamer primers or 2 µl 50 pMol (long)tracr primers (see table 1 in appendix 2 for primers) in 16 µl nanopure water and incubated at 65°C for 5 minutes. 4 µl of this mixture was then added to 26 µl RT reaction mix containing 6 µl 5x reaction buffer, 0,5 µl RNAse blocker, 2 µl dNTP, 1 µl RT enzyme and 16,5 µl H2O. The resulting cDNA was then PCR amplified using primers for (long)tracr RNA and LSRNA, as described in table 1 of appendix II. A PCR program of 1 minute at 95°C, 1 minute at 55°C and 1 minute at 72°C was used for amplification. The resulting products were checked on ethidium bromide containing agarose gels.
Knock out mutagenesis and complementation
Natural transformation is the ability of a bacterium to take up genetic material, which can be integrated into the chromosomal DNA via homologous recombination. We utilized this feature of bacteria for our knock out mutagenesis and complementation. For knock out mutagenesis of Cj1135 and cas9 we utilized genomic DNA of C. jejuni isolates where Cj1135 or cas9 was disrupted and genomic DNA of C.
jejuni isolates where Cj1135 or cas9 was
restored for complementation. Generation of
cas9 knock out mutants (Δcas9), complemented
strains (Δcas9Δ), Cj1135 knock out mutants (ΔCj1135) and complemented strains (ΔCj1135Δ) are described elsewhere31,40, respectively. In this study, bacterial donor cells were harvested and suspended in 1 ml of Brain Heart Infusion broth (BHI). 50 µl of this bacterial suspension was preincubated in 950 µl fresh BHI under micro-aerophilic conditions for 2 h. Subsequently, 10 µg of originally isolated chromosomal DNA of either Cj1135 or cas9
knock outs or complemented strains were added and incubated for 3 h. After incubation, the bacteria were grown on blood agar supplemented with chloramphenicol (10 µg/ml) for knock out selection or erythromycin (10 µg/ml) for complementation selection under micro-aerophilic conditions until colonies were visible. Colonies resistant to chloramphenicol or erythromycin were cultured to generate stable clones. Genomic DNA of these stable clones was isolated using a DNA isolation kit (qiagen) according to the manufactures protocol. The isolated DNA of the clones were checked by PCR for integrity and the correct orientation of introduced gene. See table 1 in appendix II for primers which were used for Cj1135 and cas9 knock out mutagenesis and complementation. Knock out mutagenesis and restoration of cas9 was also checked by western blotting to check Cas9 protein expression, for which the protocol will be described later.
Cell envelope permeability
Ethidium bromide and propidium iodide experiments were performed to check the cell envelope permeability. Ethidium bromide and propidium iodide solutions were prepared by adding 1 µl ethidium bromide or propidium iodide to 12 ml Hank’s Balanced Salt Solution (HBSS) (Life technologies). Fresh overnight C.
jejuni strains were grown on blood agar plates,
containing 5% sheep blood (Becton Dickinson) supplemented with vancomycin (10 μg/ml). Grown isolates were harvested in HBSS and the optical density (OD600) was calibrated at 0,3. 100 µl of bacterial suspension was then mixed with 100 µl of ethidium bromide solution or 100 µl propidium iodide solution and the emission was measured immediately in a fluorstar optima (BMG labtech) fluorescence meter.
Swarming assay
C. jejuni suspensions of R65, 9141, GB2, GB11
and GB19 isolates, their respective Δcas9 mutant strains and complemented Δcas9Δ strains were prepared with an OD600 of 1. A semi-solid agar plate (MH broth supplied with 0.5% agar) was inoculated with 1 μl of bacterial culture by stabbing and inoculated plates were grown for 12-24h at 37°C under
micro-aerophilic conditions. Hereafter, the resulting circle diameters of bacterial swarming were measured in millimeters and compared.
SDS-PAGE and Western blot
Fresh overnight C. jejuni cultures of GB2, GB11, GB19, their respective Δcas9 mutant strains and complemented Δcas9Δ strains were harvested in icecold phosphate-buffered saline (PBS) after growth under equal conditions. Growth conditions were either on blood agar, supplemented with 5% sheep blood and vancomycin (10 μg/ml) or in Mueller Hinton (MH) broth, supplemented with SR204E
Campylobacter selective supplement (oxoid).
The bacteria were set at the same OD600 and lysed using glass beads (MPbio, Illkrich, France) in a tissuelyser (Qiagen) for 3 times 30s at max speed. Hereafter, lysates were treated or not with proteinase K (1 mg/ml) for 2 h at 55 °C while shaking at 500rpm. When grown in MH broth, the supernatant was precipitated using TriChloroacetic Acid (TCA) (Sigma-Aldrich) to concentrate LOS structures in culture media. Precipitated supernatants, lysed strains and proteinase K-treated lysates were run in a 15% SDS-PAGE gel and subsequently blotted onto a polyvinylidene fluoride (PVDF) nitrocellulose membrane. Membranes were blocked with PBS containing 5% non-fat dry milk (BioRad) for 1h at room temperature or overnight at 4°C. For detection of SACS, pooled sera from GBS patients was used at a dilution of 1:1000 and incubated for 1,5-2h at room temperature. 1:1000 diluted goat anti-human total IgG labeled with alkaline phosphatase (Sigma) was used as a secondary antibody. The detection of Cas9 was done with polyclonal antibodies generated in rabbits against Cas9, diluted 1:1,000 and a secondary antibody anti-rabbit IgG alkaline phosphatase labeled, also diluted at 1:1,000. For Cas9 detection, lysates of GB2, GB11, GB19, R65 and 9141 strains were used. NBT/BCIP solution (Sigma-Aldrich) was used for visualization.
Results
RT-PCR showed the existence of the tracrRNA, longtracrRNA and the newly identified LSRNA
TracrRNA is known to be transcribed under normal growth conditions34 and we used this feature as positive control. We observed that tracrRNA is transcribed in C. jejuni isolates that harbor a CRISPR-Cas system but not in a strain that lacks a CRISPR-Cas system after nitric oxide induction (Figure 1). After nitric oxide induction of C. jejuni isolates and RT-PCR reactions of isolated RNA, we also observed the presence of our newly identified LSRNA. We observed transcription of LSRNA in C. jejuni isolates that harbor a CRISPR-Cas system, but not in a C.
jejuni isolate that lacks a CRISPR-Cas system
(Figure 2). Additionally, the longtracrRNA has been shown to be induced by nitric oxide in a GBS associated strain, but not in enteritis inducing isolates (Figure 3A). In combination with this, also the mRNA transcript of its proposed target is vanished when this longtracrRNA is transcribed (Figure 3B).
Figure 1: tracrRNA transcription in C. jejuni isolates after nitric oxide induction that harbor a CRISPR-Cas system (1: 11168, 2: R104, 3: GB11), but not in a strain that lacks a CRISPR-Cas system (4: 81176).
Figure 2: newly identified LSRNA transcription in C. jejuni isolates after nitric oxide induction that harbor a CRISPR-Cas system (1: 11168, 2: R104, 3: GB11), but not in a strain that lacks a CRISPR-Cas system (4: 81176).
Figure 3: A) longtracrRNA transcription in a GBS associated C. jejuni isolate after nitric oxide induction that harbors a CRISPR-Cas system (3: GB11) but not in enteritis inducing isolates (1: 11168, 2: R104) or a strain that lacks the CRISPR-Cas system (4: 81176). B) The mRNA transcript of the proposed target gene is vanished when longtracrRNA is transcribed.
PCR and western blotting confirmed integrity of Cj1135 and cas9 knock out mutagenesis and complementation
After knock out mutagenesis and complementation of Cj1135 and cas9, the resulting stable clones were checked for integrity. PCR reactions against Cj1135 revealed that the ΔCj1135 and ΔCj1135Δ mutant strains were correct by observing a shift in product size between the wild type strains, knock out mutants and complemented strains. The ΔCj1135 mutant shows a larger band due to the chloramphenicol cassette that was inserted. The ΔCj1135Δ strains show restoration of a normal sized Cj1135 product (Figure 4). Genomic DNA of stable knock out clones were also checked by PCR with a reverse primer inside the chloramphenicol cassette and a forward primer in the flanking gene. This result is given in appendix III. For primers, see table 1 in appendix II.
Figure 4: PCR products that show a shift in size of Cj1135 between wild type, ΔCj1135 and ΔCj1135Δ strains. WT) Cj1135 product of a wild type C. jejuni strain. KO) PCR product of Cj1135 where a chloramphenicol cassette is introduced for disruption of Cj1135. Comp) PCR product of Cj1135 after restoration of Cj1135.
Genomic DNA of stable Δcas9 and Δcas9Δ mutant strains were checked for presence of
cas9 by using a primer pair that amplifies a PCR
product of approximately 450bp in the middle of the cas9 gene. The resulting products confirm that knock out mutagenesis and complementation of cas9 were correct. Indeed, wild type and Δcas9Δ strains show a product of
cas9, whereas the Δcas9 mutant strains fail to
show a product (Figure 5).
Figure 5: wild type strains (WT) and Δcas9Δ strains (comp) show a PCR product of cas9 while Δcas9 strains (KO) do not.
Due to the fact that cas9 encodes the protein Cas9, it was required to check Cas9 expression after cas9 deletion and complementation.
Western blotting shows that Cas9 expression after complementation is restored in various Δcas9Δ strains. Cas9 is present at around 115 Kilo Dalton (KDa) in wild type strains, but not in a strain that lacks a CRISPR-Cas system and Δcas9 mutant strains. In Δcas9Δ strains, Cas9 is present again at 115 KDa confirming that Cas9 is expressed in complemented strains (Figure 6).
Figure 6: Cas9 expression at around 115 KDa in lysate of wild type C. jejuni strains (WT) and various complemented strains (comp) but not in knock out strains (KO) and a strain that lacks a CRISPR-Cas system (81176).
Knock out mutagenesis and complementation of
cas9 resulted in the following strains: R65, 9141,
GB2, GB11 and GB19, their respective Δcas9 mutants and complemented Δcas9Δ strains. Knock out mutagenesis and complementation of
Cj1135 resulted in 81-176, 81-176ΔCj1135 and
81-176ΔCj1135Δ strains.
Ethidium bromide and propidium iodide assays confirm a change in cell envelope permeability between wild type strains, Δcas9 and Δcas9Δ strains
Due to the hypothesis that Cas9 is involved in regulation of cell envelope exposed structures, we investigated the cell envelope permeability of wild type C. jejuni isolates, Δcas9 mutants and Δcas9Δ strains by means of ethidium bromide and propidium iodide assays. The uptake of these compounds was measured in different strains and their Δcas9 mutants and it showed that there is a difference in uptake of ethidium bromide and propidium iodide between wild type C. jejuni isolates, Δcas9 mutants and Δcas9Δ strains. In all Δcas9 mutants, the uptake of ethidium bromide was higher compared to wild type and complemented strains (Figure 7).
Figure 7: the uptake of ethidium bromide by wild type C. jejuni strains R65, 9141, GB2, GB11, GB19, their respective Δcas9 and Δcas9Δ strains. Compared to wild type and complemented strains, the uptake of ethidium bromide by Δcas9 mutants was significantly higher.
Also, the uptake of propidium iodide shows that there is a difference in uptake of propidium iodide between Δcas9 mutants and the wild type and Δcas9Δ strains. Δcas9 mutants of strains 9141 and GB2 show a higher uptake of propidium iodide compared to their respective wild type and Δcas9Δ strains while Δcas9 mutants of R65, GB11 and GB19 show a decreased uptake of propidium iodide compared to their respective wild type and Δcas9Δ strains (Figure 8).
Control R65 9141 GB2 GB11 GB19 0 5000 10000 15000 20000 25000 30000
EthidiumBromide
Wildtype cas9 KO cas9 complemented Li gh t in te n si ty (E m is si o n 6 0 5 n m )Figure 8: Δcas9 mutants of strains 9141 and GB2 show a higher uptake of propidium iodide while Δcas9 mutants of R65, GB11 and GB19 show a lesser uptake of propidium iodide compared to their respective wild type and Δcas9Δ strains. Control R65 9141 GB2 GB11 GB19 0 2000 4000 6000 8000 10000 12000
Propidium Iodide
Wildtype cas9 KO cas9 complemented Li gh t in te n si ty (E m is si o n 6 1 7 n m )Swarming assays revealed that cas9 deletion affects virulence features of C. jejuni
The swarming assay revealed that the swarming behavior of enteritis inducing isolates R65 (Figure 9) and 9141 decreased by deletion of
cas9 but was restored by complementation of cas9. In contradiction, the swarming behavior of
GB11 (Figure 10) and GB19 increased by deletion of cas9 and was partially restored by
cas9 complementation. Figures of swarming
behavior of other strains are provided in appendix IV.
In millimeters, we measured for R65 25±0; R65Δcas9 17,3±2,5; R65Δcas9Δ 25±0; 9141 29,6±2,5; 9141Δcas9 22,3±2,5; 9141Δcas9Δ 32,6±2,3; GB2 19,3±1,2; GB2Δcas9 20,6±0,5; GB2Δcas9Δ 19±1,7; GB11 4±1; GB11Δcas9 33,6±1,5; GB11Δcas9Δ 22,3±0,5; GB19 4±1; GB19Δcas9 28,3±2,1; GB19Δcas9Δ 15±0 (Figure 11). Given numbers are the mean of three independent experiments, standard deviations are included.
Figure 9: swarming behavior of enteritis inducing isolate R65 (upper left) decreased by deletion of cas9 (upper right) but was restored by complementation of cas9 (below).
Figure 10: swarming behavior of GBS associated isolate GB11 (upper left) increased by deletion of cas9 (upper right) but was partially restored by complementation of cas9 (below).
Figure 11: average millimeters of measured swarming behavior of different C. jejuni isolates, their respective Δcas9 mutant and Δcas9Δ strain in three independent experiments.
R65 9141 GB2 GB11 GB19 0 5 10 15 20 25 30 35 40
Swarming assay
Wildtype cas9 KO cas9 com-plemented M ill im et e rsMutagenesis of Type II CRISPR-Cas marker gene cas9 affects antibody binding of GBS patient serum to SACS
To test the proposed link between Cas9, in combination with LSRNA, and SACS expression on the cell envelope of C. jejuni, we performed a Western blot analysis to test antibody binding of GBS patient serum against SACS on the C.
jejuni cell envelope. Western blotting of C. jejuni
isolate GB11, its respective Δcas9 mutant and Δcas9Δ strain after growth on blood agar, supplemented with 5% sheep blood and vancomycin (10µg/ml) revealed a decrease in binding of GBS patient serum to SACS of the Δcas9 mutant compared to its wild type and Δcas9Δ strain (Figures 12 and 13). The opposite effect is observed when C. jejuni isolate GB11, its respective Δcas9 mutant and Δcas9Δ strain are grown in MH broth supplemented with
Campylobacter selective agent SR204E. Here we
observe a higher binding of antibodies in GBS patient serum to SACS of the Δcas9 mutant lysate (Figures 14 and 15) and precipitated SACS (Figures 16 and 17) compared to wild type and Δcas9Δ strains.
Figure 12: after growth of C. jejuni strains GB11, GB11Δcas9 and GB11Δcas9Δ on blood agar supplemented with vancomycin, Western blotting shows a decrease in binding of antibodies in GBS patient serum to SACS of the Δcas9 mutant compared to its wild type and complemented strain.
Figure 13: After the removal of background color of figure 12, the observed effect of the Western blot analysis more clearly shows the decrease in binding of antibodies in GBS patient serum to SACS of the Δcas9 mutant compared to its wild type and complemented strain.
Figure 14: after growth of C. jejuni strains GB11, GB11Δcas9 and GB11Δcas9Δ in MH broth supplemented with Campylobacter selective agent, Western blotting shows an increase in binding of antibodies in GBS patient serum to SACS of the Δcas9 mutant compared to its wild type and complemented strain.
Figure 15: After the removal of background color of figure 14, the observed effect of the Western blot analysis more clearly shows the increase in binding of antibodies in GBS patient serum to SACS of the Δcas9 mutant compared to its wild type and complemented strain.
Figure 16: after precipitation of SACS in the supernatant of cultured medium (MH broth with supplement), Western blotting shows an increased antibody binding of GBS patient serum to SACS of the Δcas9 mutant compared to its wild type and complemented strain.
Discussion
Current evidence suggests that a dual function exist between regulation of cell envelope exposed SACS and the CRISPR-Cas system in C.
jejuni42,43. Additionally, bioinformatics and microarray analysis previously revealed
potential gene targets, such as Cj1135, that not only regulate the expression of cell envelope exposed SACS, but also harbor identity to the (long)tracrRNA or LSRNA that lie within the C.
jejuni CRISPR-Cas system (appendix I). In this
study, we focused mainly on regulation of LOS via LSRNA and cas9. Indeed, results show that Type II CRISPR-Cas marker gene cas9 affects various virulence features of C. jejuni, including expression of SACS.
We observed that, in C. jejuni isolates that harbor a CRISPR-Cas system, our newly identified longtracrRNA and LSRNA were transcribed under specific stress conditions that can be encountered during invasion of epithelial host cells. Subsequently, we observed that when the longtracrRNA was transcribed, the mRNA of its proposed target gene (Cj1095) vanished, thus indicating a strong link that crRNAs are involved in endogenous gene regulation in C. jejuni. Because of the strong similarity between LSRNA and Cj1135, it is proposed that the same phenomenon occurs, in the same way as observed for Cj1095. LSRNA transcription still has to be confirmed for its ability to silence the transcription of Cj1135. With the right primers, transcription of LSRNA and Cj1135 mRNA has to be compared under normal conditions when LSRNA is not transcribed against nitric oxide induction when LSRNA is transcribed. Vanishing of Cj1135 mRNA when LSRNA is transcribed will confirm our hypothesis. In another study36, small RNAs were found to regulate a transcript of an endogenous gene in F. novicida that is involved in expression of cell envelope exposed lipoproteins. Silencing of this lipoprotein was shown to be crucial for immune evasion, as it is a pro-inflammatory lipoprotein that contains a pathogen-associated molecular pattern (PAMP) which is recognized by Toll-like receptor 2 (TLR-2) of the host immune cells. Here they show that regulation of the expressed lipoprotein requires Cas9, longtracrRNA and an additional scaRNA for a potential temporal reduction of expressed lipoproteins on the cell envelope. Due to this observation, we came to conclusion that knock outs and complementation of Cj1135 and the LSRNA area within the CRISPR-Cas system of C.
jejuni have to be made to observe the same
effect as cas9 mutagenesis. Results of such
experiments will provide more information about the molecular mechanism by which C.
jejuni regulates cell envelope exposed
structures such as SACS, although it is highly expected that the molecular mechanism is similar to that observed in F. novicida44.
Due to the hypothesis that Cas9 is involved in regulation of cell envelope exposed structures, we investigated the cell envelope permeability of wild type C. jejuni isolates, cas9 knock out mutants and cas9 complemented strains. Although not yet backed up by statistics, ethidium bromide experiments reveal a higher permeability of the cell envelope of Cas9 mutants compared to wild types and complemented strains. Additionally, propidium iodide experiments show a difference in cell envelope permeability between wild type isolates, knock out strains and complemented strains. Although we did not observe the same effect of propidium iodide uptake as in the uptake of ethidium bromide, results show that
cas9 mutagenesis affects the permeability of
the cell envelope but can be different between various strains. This observation suggests that
cas9 alters the cell envelope permeability.
Another study45 found that the hydrophobicity of the cell envelope plays an important role in the uptake of DNA or other external compounds. This study showed that bacterial surface polysaccharides, especially LOS, reduced the transformation efficiency in C. jejuni. The authors proposed that because both DNA and the surface polysaccharides are negatively charged, the electrostatic current between them may repulse DNA or other negatively charged compounds and reduce transformation efficiencies45. They also state that LOS may act as a physical barrier, structurally hindering the binding of DNA or other compounds to receptor proteins located in the outer membrane. Swarming behavior of C. jejuni is an important virulence feature of the bacterium46. To investigate if cas9 is involved in the regulation of this virulence feature of C. jejuni, we assessed the swarming behavior of C. jejuni cas9 knock out mutants in comparison with their respective wild type isolate and complemented strain. The swarming assay revealed an increased swarming behavior of cas9 knock out mutants compared
to their wild type and complemented strain in GBS associated strains, while the contradicting effects are observed in enteritis inducing strains. Here the cas9 mutants showed a reduced swarming behavior. Although swarming assays in this study revealed that cas9 deletion affects virulence features of C. jejuni, the exact mechanism by which cas9 affects swarming behavior of C. jejuni remains to be elucidated. A previous study41 found that LOS structures on the cell envelope of C. jejuni was important for biofilm formation, stress survival and colonization of hosts. Due to our hypothesis that cas9 regulates LOS transcripts, it could possibly also play a role, or act as a dual function, in swarming behavior of C. jejuni. The difference between GBS associated isolates and enteritis inducing strains remains unclear. In this study, we observed that mutagenesis of Type II CRISPR-Cas marker gene cas9 affects antibody binding of GBS patient serum to cell envelope expressed SACS. Previously, SACS were shown to make C. jejuni isolates highly pathogenic, provoke a more severe colitis and induces post-infectious complications, such as Guillain-Barré syndrome (GBS) and reactive arthritis, in susceptible patients47-49. A dual functionality between cas9 and SACS could open new doors of research towards novel virulence features of C. jejuni, as regulation of SACS expression via this novel LSRNA might be beneficial to regulate C. jejuni bacteriophage defense, to withstand damaging environmental stress and/or other virulence features. Our results strengthen the hypothesis that there is a dual functionality between the CRISPR-Cas system and cell envelope exposed SACS in defense and virulence, as proposed by Louwen
et al32.
We observed a different expression of SACS in
cas9 mutants compared to their wild type and
complemented strains during different growth conditions. As we found an increased expression of SACS when C. jejuni was cultured in supplemented MH broth but a decreased expression of SACS when C. jejuni was cultured on vancomycin supplemented blood agar plates, it led us to hypothesize that growth conditions play a major role in the expression of SACS. It could be that LSRNA transcription is silenced by compounds in the SR204E Campylobacter selective agent to withstand environmental
stress, but not by vancomycin as C. jejuni is intrinsically resistant against vancomycin. Additionally, because expression of cell envelope exposed SACS are due to different growth conditions, which may give us an explanation why some people get GBS after an infection and others do not. As we observed different concentrations of expressed SACS when C. jejuni and cas9 mutants were cultured in or on different antibiotics, GBS induction could correlate with antibiotic treatment that was used prior to post-infectious complications. To confirm this hypothesis of dual functionality, it is still needed to optimize Western blot analysis by adding knock out mutants and complemented strains of the proposed LSRNA area to observe the same effect as when cas9 is knocked out. Additionally, Western blotting of
Cj1135 knock outs and complemented strains
have to be performed to observe the same effects as cas9 mutagenesis. When results show the same effect on the expression of SACS, a molecular mechanism behind the regulation of expressed SACS by the CRISPR-Cas system will be revealed. Subsequently, Western blotting analysis with monoclonal antibodies have to be performed to investigate which specific cross-reactive antibodies are effected. Results of such analysis may be utilized in clinical features, such as the treatment of GBS or provide a better understanding behind the mechanism by which GBS is induced. Previously, another study50 found that the temperature by which C. jejuni was cultured played a major role in the expression of carbohydrates on the cell envelope. This study showed a reduced expressed LPS and a change in expressed LOS structures at a higher temperature (42°C) compared to growth of C. jejuni at the human body temperature (37°C). The authors suggested that this was a main reason why C.
jejuni act as a pathogen in humans but not in
poultry.
A previous study45 described that the hydrophobicity of the cell envelope plays an important role in the uptake of external compounds. As it has been shown in this study that cas9 mutagenesis affect LOS structures on the C. jejuni cell envelope and therefore the hydrophobicity of the cell envelope, it could be interesting to test antibiotic resistance between
wild type strains, cas9 mutants and
complemented strains. Different antibiotics have a different hydrophobic or hydrophilic behavior, so it could be that affecting the cell envelope of C. jejuni alters susceptibility to antibiotics. Future work herein could lead to new insights in antimicrobial resistance.
Conclusion
Although the exact regulatory mechanism is still under investigation, this study already reveals that the C. jejuni CRISPR-Cas system is actively involved in the regulation of expressed cell envelope structures and other virulence features. C. jejuni could utilize its CRISPR-Cas system to regulate its cell envelope structures in order to survive encountered (a)biotic stresses in the environment or inside a host during infection.
Acknowledgements
Firstly, I would like to thank my supervisor, Dr. Rogier Louwen for his commitment and guidance, both theoretical and practical, during this project. I also want to thank him for helpful insights and carefully reading this manuscript. I also want to thank the rest of my colleagues, especially Astrid Heikema and my co-intern Niall van Rooijen, of the department for Medical Microbiology and Infectious Diseases for guidance during my internship and for helping me whenever I needed. In addition, I would like to thank Dr. Nicole van den Braak for her guidance from school.
References
[1] Erken, M., Lutz, C. and McDougald, D. (2013) The rise of pathogens: predation as a factor driving the evolution of human pathogens in the environment. Microb. Ecol. 65, 860–868
[2] Foster, T.J. (2005) Immune evasion by staphylococci. Nat. Rev. Microbiol. 3, 948–958
[3] Nordstrom, K. and Forsgren, A. (1974) Effect of protein A on adsorption of bacteriophages to Staphylococcus
aureus. J. Virol. 14, 198–202
[4] Nicholson, T.F., Watts, K.M. and Hunstad, D.A. (2009) OmpA of uropathogenic Escherichia coli promotes postinvasion pathogenesis of cystitis. Infect. Immun. 77, 5245–5251
[5] Prasadarao, N.V., Wass, C.A., Weiser, J.N., Stins, M.F., Huang, S.H. and Kim, K.S. (1996) Outer membrane protein A of Escherichia coli contributes to invasion of brain microvascular endothelial cells. Infect. Immun. 64, 146– 153
[7] Pedruzzi, I., Rosenbusch, J.P. and Locher, K.P. (1998) Inactivation in vitro of the Escherichia coli outer membrane protein FhuA by a phage T5-encoded lipoprotein. FEMS Microbiol. Lett. 168, 119–125 15 Riede, I. and Eschbach, M.L. (1986) Evidence that TraT interacts with OmpA of
Escherichia coli. FEBS Lett. 205, 241–245
[8] Sutherland, I.W. (1995) Polysaccharide lyases. FEMS Microbiol. Rev. 16, 323–347 17 Hanlon, G.W., Denyer, S.P., Olliff, C.J. and Ibrahim, L.J. (2001) Reduction in exopolysaccharide viscosity as an aid to bacteriophage penetration through Pseudomonas aeruginosa biofilms. Appl. Environ. Microbiol. 67, 2746–2753
[9] Castillo, F.J. and Bartell, P.F. (1974) Studies on the bacteriophage 2 receptors of Pseudomonas aeruginosa. J. Virol. 14, 904–909
[10] Temple, G.S., Ayling, P.D. and Wilkinson, S.G. (1986) Isolation and characterization of a lipopolysaccharide-specific bacteriophage of Pseudomonas aeruginosa. Microbios 45, 81–91
[11] Moll, D.M. and Vestal, J.R. (1992) Survival of microorganisms in smectite clays: implications for Martian exobiology. Icarus 98, 233–239
[12] Stirm, S. (1968) Escherichia coli K bacteriophages. I. Isolation and introductory characterization of five Escherichia coli K bacteriophages. J. Virol. 2, 1107–1114 [13] Steinbacher, S., Miller, S., Baxa, U., Weintraub, A. and Seckler, R. (1997) Interaction of Salmonella phage P22 with its O-antigen receptor studied by X-ray crystallography. Biol. Chem. 378, 337–343
[14] Perry, L.L., SanMiguel, P., Minocha, U., Terekhov, A.I., Shroyer, M.L., Farris, L.A., Bright, N., Reuhs, B.L. and Applegate, B.M. (2009) Sequence analysis of Escherichia
coli O157:H7 bacteriophage PhiV10 and identification of a
phage-encoded immunity protein that modifies the O157 antigen. FEMS Microbiol. Lett. 292, 182–186
[15] Viswanathan, P. Murphy, K. Julien, B. Garza, A. G. Kroos, L (2007) Regulation of dev, an operon that includes genes essential for Myxococcus xanthus development and CRISPR-associated genes and repeats.
[16] Perez-Rodriguez, R. Haitjema, C. Huang, Q. Nam, K. H. Bernardis, S. Ke, A. DeLisa, M. P. (2011) Envelope stress is a trigger of CRISPR RNA-mediated DNA silencing in
[17] Marraffini L.A, Sontheimer E.J. (2010) CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea. Nat. Rev. Genet., 11, 181–190.
[18] Terns, M.P, Terns, R.M. (2011) CRISPR-based adaptive immune systems. Curr. Opin. Microbiol., 14, 321–327. [19] Wiedenheft B, Sternberg S.H, Doudna J.A. (2012) RNA-guided genetic silencing systems in bacteria and archaea. Nature, 482, 331–338.
[20] Richter C, Chang JT, Fineran PC. (2012) Function and Regulation of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR Associated (Cas) Systems. Viruses 2012, 4, 2291-2311.
[21] Makarova K.S, Haft D.H, Barrangou R, Brouns S.J, Charpentier E, Horvath P, Moineau S, Mojica F.J, Wolf Y.I, Yakunin A.F. et al. (2011) Evolution and classification of the CRISPR-Cas systems. Nat. Rev. Microbiol., 9, 467–477. [22] Haft D.H, Selengut J, Mongodin E.F, Nelson, K.E. (2005) A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes. PLoS Comput. Biol., 1, e60.
[23] Godde J.S, Bickerton A. (2006) The repetitive DNA elements called CRISPRs and their associated genes: Evidence of horizontal transfer among prokaryotes. J. Mol. Evol., 62, 718–729.
[24] Makarova K.S, Haft D.H, Barrangou R, Brouns S.J, Charpentier E, Horvath P, Moineau S, Mojica F.J, Wolf Y.I, Yakunin A.F. et al. (2011) Evolution and classification of the CRISPR-Cas systems. Nat. Rev. Microbiol., 9, 467–477. [25] Labrie S.J, Samson J.E, Moineau S. (2010) Bacteriophage resistance mechanisms. Nat. Rev. Microbiol., 8, 317–327.
[26] Grissa, I.; Vergnaud, G.; Pourcel, C. (2007) The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics, 8, 172.
[27] Louwen R, Nieuwenhuis EE, van Marrewijk L, Horst-Kreft D, de Ruiter L, Heikema A, van Hamel W, Wagenaar J, Endtz H, Samsom J, van Baarlen P, et al. (2012)
Campylobacter jejuni translocation across intestinal
epithelial cells is facilitated by ganglioside-like lipooligosaccharide structures. Infection and Immunity 80: : 3307–3318 11; 10.1128/IAI.06270-11.
[28] Louwen R, Heikema A, van Belkum A, Ott A, Gilbert M, et al. (2008) The sialylated lipooligosaccharide outer core in Campylobacter jejuni is an important determinant for epithelial cell invasion. Infect Immun 76: 4431–4438. [29] Nachamkin, I., B. Mishu Allos, and T. Ho. (1998)
Campylobacter species and Guillain-Barré syndrome. Clin.
Microbiol. Rev. 11555-567.
[30] Godschalk, P. C., A. P. Heikema, M. Gilbert, T. Komagamine, C. W. Ang, J. Glerum, D. Brochu, J. Li, N. Yuki, B. C. Jacobs, A. van Belkum, and H. P. Endtz. (2004) The crucial role of Campylobacter jejuni genes in antiganglioside antibody induction in Guillain-Barré syndrome. J. Clin. Investig. 1141659-1665.
[31] van Belkum, A., N. van den Braak, P. Godschalk, W. Ang, B. Jacobs, M. Gilbert, W. Wakarchuk, H. Verbrugh, and H. Endtz (2001) A Campylobacter jejuni gene associated with immune-mediated neuropathy. Nat. Med. 7752-753. [32] Louwen R, Horst-Kreft D, de Boer AG, van der Graaf L, de Knegt G, Hamersma M, Heikema AP, Timms AR, Jacobs BC, Wagenaar JA, Endtz HP, van der Oost J, Wells JM, Nieuwenhuis EE, van Vliet AH, Willemsen PT, van Baarlen P, van Belkum A. (2012) A novel link between Campylobacter
jejuni bacteriophage defense, virulence and Guillain-Barré
syndrome. Eur J Clin Microbiol Infect Dis. 32(2):207-26. [33] Nyati K, Nyati ., (2013) Role of Campylobacter jejuni Infection in the Pathogenesis of Guillain-Barré Syndrome: An Update. Biomed Res Int.: 852195.
[34] Ang CW, Jacobs BC, Laman JD (2004) The Guillain-Barré syndrome: a true case of molecular mimicry. Trends Immunol 25 (2):61-66.
[35] Chylinski, K., Le Rhun, A. & Charpentier, E. (2013) The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems. RNA Biol. 10, 726–737.
[36] Sampson TR, Saroj SD, Llewellyn AC, Tzeng YL, Weiss DS. 9 (2013) A CRISPR/Cas system mediates bacterial innate immune evasion and virulence. Nature. 2013 Sep 12;501(7466):262.
[37] Taboada EN, van Belkum A, Yuki N, Acedillo RR, Godschalk PC, Koga M, Endtz HP, Gilbert M, Nash JH. (2007) Comparative genomic analysis of Campylobacter
jejuni associated with Guillain-Barré and Miller Fisher
syndromes: neuropathogenic and enteritis-associated isolates can share high levels of genomic similarity. BMC Genomics. Oct 5;8:359.
[38] Taketoshi Iwata, Kazuhiro Chiku, Ken-ichi Amano, Masahiro Kusumoto, Mayumi Ohnishi-Kameyama, Hiroshi Ono, Masato Akiba. (2013) Effects of Lipooligosaccharide Inner Core Truncation on Bile Resistance and Chick Colonization by Campylobacter jejuni. PLoS One.; 8(2): e56900.
[39] Gilbert M, Parker CT, Moran AP (2008) Campylobacter
jejuni Lipooligosaccharides: Structures and Biosynthesis; Campylobacter book; Book chapter 27; 3rd edition; 493–
504.
[40] Jerome JP, Bell JA, Plovanich-Jones AE, Barrick JE, Brown CT, Mansfield LS. (2011) Standing genetic variation in contingency loci drives the rapid adaptation of
Campylobacter jejuni to a novel host. PLoS One
[41] Naito M, Frirdich E, Fields JA, Pryjma M, Li J, Cameron A, Gilbert M, Thompson SA, Gaynor EC. (2010) Effects of sequential Campylobacter jejuni 81-176 lipooligosaccharide core truncations on biofilm formation, stress survival, and pathogenesis. J Bacteriol. Apr;192(8):2182-92.
[42] Louwen R, van Baarlen P (2013) Are bacteriophage defence and virulence two sides of the same coin in
Campylobacter jejuni? Biochem Soc Trans. 2013 Dec
[43] Louwen R, Staals RH, Endtz HP, van Baarlen P, van der Oost J. (2014) The role of CRISPR-Cas systems in virulence of pathogenic bacteria. Microbiol Mol Biol Rev. 2014 Mar;78(1):74-88
[44] Westra ER, Buckling A, Fineran PC (2014) CRISPR-Cas systems: beyond adaptive immunity. Nat Rev Microbiol. 2014 May;12(5):317-26.
[45] Jeon B, Muraoka W, Scupham A, Zhang Q. (2009) Roles of lipooligosaccharide and capsular polysaccharide in antimicrobial resistance and natural transformation of
Campylobacter jejuni. J Antimicrob Chemother. 2009
Mar;63(3):462-8.
[46] Morooka, T., A. Umeda, and K. Amako. (1985) Motility as an intestinal colonization factor for Campylobacter
jejuni. J. Gen. Microbiol. 131:1973-1980.
[47] Habib I, Louwen R, Uyttendaele M, Houf K, Vandenberg O, Nieuwenhuis EE, Miller WG, van Belkum A, De Zutter L (2009) Correlation between genotypic diversity, lipooligosaccharide gene locus class variation, and caco-2 cell invasion potential of Campylobacter jejuni isolates from chicken meat and humans: contribution to virulotyping. Appl Environ Microbiol 75(13):4277–4288 [48] Phongsisay V, Perera VN, Fry BN (2006) Exchange of lipooligosaccharide synthesis genes creates potential Guillain–Barré syndrome-inducible strains of
Campylobacter jejuni. Infect Immun 74(2):1368–1372
[49] Mortensen NP, Kuijf ML, Ang CW, Schiellerup P, Krogfelt KA, Jacobs BC, van Belkum A, Endtz HP, Bergman MP (2009) Sialylation of Campylobacter jejuni lipo-oligosaccharides is associated with severe gastro-enteritis and reactive arthritis. Microbes Infect 11(12):988–994 [50] Kilcoyne M, Twomey ME, Gerlach JQ, Kane M, Moran AP, Joshi L. (2014) Campylobacter jejuni strain discrimination and temperature-dependent glycome expression profiling by lectin microarray. Carbohydr Res. 2014 May 7;389:123-33
Appendix I
Figure 1: Type II CRISPR-Cas system in Campylobacter jejuni. Left (green) the cas genes, which encode their respective proteins, followed by a non-coding area. It is proposed that in this area the tracrRNA (yellow, up), long-tracrRNA (yellow, below) and the LSRNA (blue) lie. The CRISPR region lies at the end of the system (repeats in red and spacers in purple).
Appendix II
Table 1: Primers used and their sequence
Number Sequence 5’ 3’ Forward/Reverse Product
3972 aagcggttttaggggattgtaacc Forward longtracrRNA
3971 agatatttaccagataatgaa Reverse longtracrRNA
3972 aagcggttttaggggattgtaacc Forward tracrRNA
3973 aagaaatttaaaagggactaaaa Reverse tracrRNA
3971 agatatttaccagataatgaa Forward LSRNA
633 atgaatctaaaacaaataagcgttattatc Forward Cj1135
4017 tagatcgagctcccatcaagttcatcaaaatcggctttaaaa Reverse Cj1135
633 atgaatctaaaacaaataagcgttattatc Forward Knock out Cj1135
1302 gagttacaacgatcatcaatcg Reverse Knock out Cj1135
4014 tagatcccatgggctgagcaaactttgcttgagtgtttaaattct Forward Complemented Cj1135 4017 tagatcgagctcccatcaagttcatcaaaatcggctttaaaa Reverse Complemented Cj1135
1907 agacgccgaacttgaatgtga Forward cas9
1908 cagccttgctatgtagcgagt Reverse cas9
Appendix III
PCR product after PCR amplification with a forward primer in Cj1135 and a reverse primer in the inserted chloramphenicol cassette confirmed our knock out mutagenesis of Cj1135 and showed the orientation of the inserted gene.
Appendix IV
Swarming behavior of enteritis inducing isolate 9141 (upper left) decreased by deletion of cas9 (upper right) but was restored by complementation of cas9 (below).
Swarming behavior of GBS associated isolate GB2 (upper left) was not significantly affected by deletion (upper right) and complementation (below) of cas9.
Swarming behavior of GBS associated isolate GB19 (upper left) increased by deletion of cas9 (upper right) but was partially restored by complementation of cas9 (below).
