Stabilization
Bot, I.
Citation
Bot, I. (2005, September 22). Modulation of Atherothrombotic Factors: Novel Strategies for
Plaque Stabilization. Retrieved from https://hdl.handle.net/1887/3296
Version:
Corrected Publisher’s Version
License:
Licence agreement concerning inclusion of doctoral thesis in the
Institutional Repository of the University of Leiden
Ilze Bot, Martine Bot, Jean Sébastien Saulnier-Blache*, Theo J.C. van Berkel and Erik A.L. Biessen
Division of Biopharmaceutics, Leiden/Amsterdam Center for Drug Research, Leiden University, Leiden, The Netherlands,
*INSERM U317, Institut Louis Bugnard, Université Paul Sabatier, Toulouse, France.
Manuscript in preparation Abstract
Lysophosphatidic acid (LPA) accumulates in the lipid core of human atherosclerotic plaques and is the primary platelet-activating lipid constituent of plaques. Here, we aimed to delineate the metabolic regulation of LPA homeostasis and to temporally profile LPA accumulation in atherosclerotic lesions at various stages of disease progression. Therefore, atherosclerotic lesions were induced in LDLr-/- mice by placing perivascular collars at both carotid arteries. At 0, 2, 4, 6 and 8 weeks after collar placement, lipids were extracted and total RNA was isolated from the plaques. Lipid composition analysis confirmed the accumulation of LPA in atherosclerotic tissue. Plaque expression profiling revealed a 5-fold increase in expression of phospholipase D3, which generates phosphatidic acid (PA). The conversion
of PA to LPA is mediated by cytoplasmic phospholipase A2IVA, the expression of which was up to 2-fold increased in advanced lesions. Conversely, from week 4 a 75% reduction was observed for LPA acyltransferase, which catalyzes LPA hydrolysis. W hile the expression data pointed to a shifted LPA homeostasis favoring LPA synthesis, analysis of plaque lipids indeed revealed a highly significant increase in the LPA content of advanced atherosclerotic lesions. Moreover, LPA receptors 2 and 3 (LPA2
and LPA3) showed respectively a 7-fold and 3-fold increase, while the
intracellular receptor PPARȖ and its effector CD36 showed a 93% reduction at later stages of plaque formation. In conclusion, atherosclerosis progression results in a changed expression of proteins involved in LPA homeostasis reflecting a strongly induced production of intracellular LPA and an augmentation of signal transduction pathways through LPA2 and LPA3.
W e propose that intervention in the LPA metabolism could be an effective
Introduction
Cardiovascular disease continues to be one of the major causes of death in Western society. They are characterized by the development of atherosclerotic lesions in the large arteries consisting of a large lipid core and an overlying thin fibrous cap1,2. Upon rupture of the fibrous cap, the thrombogenic content of the plaque will be exposed to the blood circulation and trigger the coagulation cascade, leading to thrombus formation and acute coronary syndromes3,4. One of the major thrombogenic constituent of the lipid core was demonstrated to be lysophosphatidic acid (LPA)5-7.
LPA is a bioactive lipid that was originally known as a key intermediate in de novo lipid synthesis, but it has emerged as an intra- and intercellular phospholipid messenger with a wide variety of biological activities8. LPA has multiple effects on blood cells and various cell types of the vessel wall and nowadays, evidence is accumulating that this lipid can be athero- as well as thrombogenic and aggravate cardiovascular disease7,9. LPA mediates multiple cellular processes that are instrumental in atherogenesis, including smooth muscle contraction10,11, platelet aggregation5 and cell proliferation
12-14
. In the early phase of atherosclerosis, LPA can induce barrier dysfunction by increasing the permeability of the endothelium5. LPA can stimulate monocyte adhesion to the endothelium by upregulation of E-selectin and vascular cell adhesion molecule-1 (VCAM-1)9 expression.
LPA exerts its multiple effects through specific G-protein-coupled receptors (GPCRs) belonging to the Endothelial Differentiation Gene family (e.g. EDG2, EDG4, EDG7 and GPR23, which are also known as LPA receptors 1, 2, 3 and 4, respectively)15. Furthermore, recent studies reveal a direct role for LPA as PPARȖ agonist, regulating the expression of genes that contain PPAR Response Elements (PPRE)7. The CD36 (Scavenger Receptor B) promoter for example was found to contain such PPRE, rendering it sensitive to LPA induced transcriptional upregulation of CD36 in macrophages. Zhang et al. have shown that LPA can induce neointima formation via PPARȖ activation and CD36 upregulation16.
Amongst others, LPA is formed during mild oxidation of low density lipoprotein (LDL) and it is its main active compound. It is most likely directly deposited in the plaque by mildly oxidized LDL that has entered the arterial wall. Moreover, LPA can be formed from phosphoglycerides by macrophages and smooth muscle cells that are present in the developing atherosclerotic lesion17. In addition to the influx of LPA into the lesion via LDL particles, a misbalance in cellular LPA homeostasis can also result in accumulation of LPA in atherosclerotic lesions. Overall, LPA will accumulate in the lipid-rich core of the atherosclerotic plaques and is considered the primary platelet-activating lipid constituent of the plaque. Thus it is conceivable that LPA is an important risk factor of intra-arterial thrombus formation in the late stages of atherogenesis7,9.
receptor deficient (LDLr-/-) mice. We are the first to demonstrate that also in LDLr-/-mice, LPA accumulates in carotid artery plaques as was also shown in human atherosclerotic arteries. RNA analysis of plaque material from these mice provided evidence that LPA homeostasis is indeed altered during atherosclerotic lesion development favouring intracellular LPA accumulation and we believe that intervention in the LPA metabolism could be an effective new strategy in reducing plaque thrombogenicity.
Methods Animals
All animal work was approved by the regulatory authority of Leiden University and performed in compliance with Dutch government guidelines. Male LDLr-/- mice, obtained from the local animal breeding facility, were fed a Western type diet containing 0.25% cholesterol and 15% cacaobutter (Special Diet Services, Sussex, UK) two weeks prior to surgery and throughout the experiment. To determine the LPA content of (n=16) and gene expression levels in (n=20) mouse plaques, atherosclerotic carotid artery lesions were induced by perivascular collar placement as described previously18. Mice were anaesthetized by subcutaneous injection of ketamine (60 mg/kg, Eurovet Animal Health, Bladel, The Netherlands), fentanyl citrate and fluanisone (1.26 mg/kg and 2 mg/kg respectively, Janssen Animal Health, Sauderton, UK). During the experiments, total serum cholesterol levels were quantified colorometrically by enzymatic procedures using Precipath as internal standard (Roche Diagnostics GmbH, Mannheim, Germany).
Tissue harvesting
From 0 to 8 weeks after collar placement every two weeks a subset of 4 mice was sacrificed. The animals were anaesthetized as described above and perfused through the left cardiac ventricle with PBS and exsanguinated by femoral artery transsection. Subsequently, both common carotid arteries were removed and snap-frozen in liquid nitrogen for optimal RNA and lipid preservation. The specimens were stored at -80°C until further use.
Lipid extraction from plaque material
Lipids were extracted from the atherosclerotic plaque material using a modified Bligh and Dyer19 and a 1-butanol extraction for optimal extraction of the lysophospholipids as described previously20,21. In short, 2 or 3 pooled carotid artery tissue samples were homogenized in 0.5 mL distilled water using a mechanical potter and used for lipid extraction. All solvents was evaporated under N2 and extracted lipids were dissolved in PBS + 0.1%
LPA quantification
LPA content of the plaque lipid extracts was determined using a highly sensitive radio-enzymatic assay as described previously22. Briefly, in the presence of [14C]Oleoyl-CoA, a recombinant rat LPA acyltransferase (LPAAT) selectively catalyzes the transformation of LPA and alkyl-LPA into [14C]phosphatidic acid (PA). Resulting lipids were separated by two-dimensional thin-layer chromatography and identified by co-migration with unlabeled lipid and subsequent visualization by iodine staining. [14C]PA spots were scraped and the silica was counted for radioactivity after suspending in a scintillation cocktail after which the radioactivity could be converted to picomoles.
RNA isolation
Two or three carotids were pooled per sample and homogenized by grounding in liquid nitrogen with a pestle. Total RNA was extracted from the tissue using Trizol reagent according to manufacturers instructions (Invitrogen, Breda, The Netherlands). RNA was reverse transcribed using M-MuLV reverse transcriptase (RevertAid, MBI Fermentas, Leon-Roth) and used for quantitative analysis of gene expression with an ABI PRISM 7700 Taqman apparatus (Applied Biosystems, Foster City, CA) as described previously23, using murine hypoxanthine phosphoribosyltransferase (HPRT) and cyclophilin A (CypA) as standard housekeeping genes (Table 1).
Table 1. RT-PCR primer sequences and sources.
Gene forward primer (5’-3’) reverse primer (5’-3’)
LPA1 TGTCCTGGCCTATGAGAAGTTCT TTGTCGCGGTAGGAGTAGATGA LPA2 CTCACTGGTCAATGCAGTGGTATAT GAAGGCGGCGGAAGGT LPA3 GGGACGTTCTTCTGCCTCTTTA GAAAGTGGAACTTCCGGTTTGT GPR23 GATGGAGTCGCTGTTTAAGACTGA TGTTTGATCACTAACTTCCTCTTGGATA LPAATĮ TCCCTCGACCTGCTTGGA CATAGTAGCTCACGCTTGGCAAT LPAP AAATGGCCCCCATTTGCT TGCACAAACCACTCCTTAGATTCTT PLD1 GACTCTGCCTGTGACCGTGAT CCAGATGCATAAATGAACCTAAGAAC PLD2 GCCAGCAAACAGAAATACTTGGA GGCGTGGTAATTGCGATAGAA PLD3 CACCATGGAGTTCTCTCATCCA TCATACGCAGCCCGTCTCA FABP1 GAACTTCTCCGGCAAGTACCAA GGCAGACCTATTGCCTTCATG FABP2 AGCAACGCTGAAGAGCTAAGCT CCAGTGCTGATAGGATGACGAA FABP3 ACTCGGTGTGGGCTTTGC TATCCCCGTTCTTCTCGATGAT FABP4 GCGTGGAATTCGATGAAATCA CCCGCCATCTAGGGTTATGA FABP5 GGAAGGAGAGCACGATAACAAGA GGTGGCATTGTTCATGACACA cPLA2IVA GGATGAGCATGACCCTGAGTAGTT GAGACACGTGAAGAGAGGCAAAG PPARȖ CATGCTTGTGAAGGATGCAAG TTCTGAAACCGACAGTACTGACAT CD36 GTTCTTCCAGCCAATGCCTTT ATGTCTAGCACACCATAAGATGTACAGTT CD68 CCTCCACCCTCGCCTAGTC TTGGGTATAGGATTCGGATTTGA
Statistical analysis
Data are expressed as mean ± SEM. A 2-tailed Student’s t-test was used to compare individual groups. To determine the significance of the relative mRNA expression levels, statistical analysis was performed on ǻCt values.
Results
LPA quantification
To induce atherosclerotic lesions, perivascular collars were placed at the carotid arteries of male Western type diet fed LDLr-/- mice and at different time points after collar placement, plaques were isolated and entrapped lipids extracted from these plaques were analyzed. Total cholesterol levels between treatment groups did not differ (data not shown). Plaque lipid analysis revealed that in empty carotid arteries almost no LPA could be detected (0.95 ± 0.95 pmol/mg tissue). LPA levels in advanced lesions were found to increase during atherogenesis via 19 ± 9 and even 31 ± 13 at two and four weeks to 38 ± 17 pmol/mg tissue in advanced lesions at 8 weeks after collar placement (Figure 1). These data indicate that in LDLr-/- mice LPA is abundantly present in atherosclerotic lesions but not in the intact artery and that it is legitimate for use this animal model to further delineate the intracellular metabolic regulation of LPA homeostasis in the plaque.
Weeks after collar placement
L PA co n te n t (p m o l/ m g t is s u e ) 0 10 60 50 40 30 20 0 2 4 8
Expression profiling
In the next stage, we have investigated whether the increased LPA accumulation correlates with an altered expression of important genes in LPA homeostasis in the atherosclerotic plaque and effectors of LPA.
0 2 4 6 8 10 0 2 4 6 8 10 ** ** ** ** ** * 0 2 4 6 8 10 ** A C B PLD LPAATα cPLA2IVa ** 0 0.4 0.8 1.2 1.6 ** ** 3 0 0.6 1.2 1.8 2.4 0 0.4 0.8 1.2 1.6
weeks after collar placement weeks after collar placement weeks after collar placement
re la ti v e e x p re s s io n
Figure 2. Gene expression profile of LPA metabolizing enzymes. (A) During atherogenesis, the phosphatidic acid (PA) producing enzyme phospholipase PLD3 increased in time compared to RNA isolated from non-atherosclerotic artery tissue (week 0). (B) The gene expression pattern of LPA acyltransferase Į, which converts LPA into PA, revealed a downregulation of this enzyme during atherogenesis. (C) One of the cytosolic phospholipases A, cPLA2IVa, is highly significantly upregulated in atherosclerotic lesions compared to non-atherosclerotic tissue. *P<0.05, **P<0.01.
PCR analysis showed no change in expression over time for the phospholipases D1 and D2, which hydrolyze glycerophospholipids at the
terminal phosphodiester bond, generating phosphatidic acid (PA, data not shown). Phospholipase D3, a predicted phospholipase D, showed a 5-fold
increase in expression at weeks 4 and 6 (P<0.01) (Figure 2A). Gene expression of LPA acyltransferase Į (LPAATĮ), which converts LPA into phosphatidic acid (PA), was 75% reduced over time (P<0.01) (Figure 2B). No difference in expression was seen for lysophosphatidic acid phosphatase (LPAP), which regulates lipid metabolism in mitochondria via hydrolysis of LPA to monoacylglycerol (MAG, data not shown). Interestingly, cytosolic PLA2IVa, possibly involved in the intracellular conversion of PA into LPA, was 2-fold upregulated during atherogenesis (Figure 2C).
Signal transduction mediated by LPA in the plaque might also be altered during atherogenesis and we have thus analyzed the expression of the different LPA receptors. Expression of LPA receptor Edg2/LPA1 did not
change during atherogenesis but Edg4/LPA2 and Edg7/LPA3 both showed
an increased gene expression (respectively 7-fold, P<0.01, and 3-fold, P<0.05) (Figure 3A). Recently, a novel G-protein coupled receptor for LPA has been identified, p2y9/GPR23
24
keeping with this finding, that of CD36, a PPARȖ effector gene, showed a 13-fold reduction (both P<0.05, figure 3C).
0 2 4 6 8 10 * * ** * 0 2 4 6 8 10 ** ** ** 0 2 4 6 8 10 ** ** ** A B C
LPA receptors PPARγ CD36
** 0 0.3 0.6 0.9 1.2 0 2 4 6 8 0 10 20 30 40
weeks after collar placement
re la ti v e e x p re s s io n
weeks after collar placement weeks after collar placement
Figure 3. Gene expression profile of LPA receptors. (A) Expression of LPA receptor 1, also known as Edg2, does not change during atherogenesis (Ƒ), however both LPA receptors 2 (Ŷ) and 3 (ǻ, Edg 4 and 7, respectively) show significantly increased gene expression as the atherosclerotic lesions develop. (B) The only nuclear receptor known to be activated by LPA, PPARȖ, illustrates an over 14-fold reduction in relative expression from week 4 after collar placement and it’s effector CD36 (C) revealed a similar pattern during atherogenesis. *P<0.05, **P<0.01.
0 2 4 6 8 10 0 2 4 6 8 10 0 2 4 6 8 10 0 2 4 6 8 10 A B C FABP1 FABP2 FABP5 FABP4 FABP3 D E 0 2 4 6 8 10 * * * ** ** *** * * ** 0 1 2 3 4 5 0 0.3 0.6 0.9 1.2 1.5 0 3 6 9 12 15 0 40 80 120 160 200 0 3 6 9 12 15
weeks after collar placement weeks after collar placement
weeks after collar placement weeks after collar placement
weeks after collar placement
re la ti ve e x p re s s io n re la ti ve e x p re s s io n *
Figure 4. Expression pattern of the fatty acid binding proteins in atherosclerotic plaques. (A,B) Expression profiles of FABP1 and particularly FABP2 reveal a significant increase in relative expression up to week 8, where a sharp decrease in expression is observed. (C,D) FABP3 and 4 expression is significantly downregulated during atherogenesis up to 95% in advanced plaques compared to week 0 (non-atherosclerotic tissue). (E) The expression profile of FABP5 does not change significantly during atherogenesis. *P<0.05, **P<0.01, ***P<0.001.
Discussion
be detected in the vessel wall. While these data clearly show that LPA indeed accumulates in the intima during atherosclerotic lesion progression, the question remains which part of the plaque LPA originated from infiltrated modified LDL versus in situ synthesis. We show that already at two weeks after collar placement a significant amount of LPA has accumulated in the vessel wall. At this timepoint, lesions have progressed to the fatty streak stage and it is conceivable that the main contributor of LPA at this stage is delivery via modified LDL. However, we suggest that when lesions progress further, cellular metabolism may become more important.
LPA
FABP /
LPA
ER/mitochondria
cytoplasm
?
LPA
PA
LPAAT
PLA
2PC
PLD
Figure 5. Simplified intracellular pathways of LPA production and degradation. The link between the FABPs and transport of LPA to the cytoplasm has not been proven yet.
Therefore, we have used this model to further delineate the metabolic regulation of LPA in the atherosclerotic plaque. First, we analyzed metabolic enzymes the phospholipases, which convert phosphatidylcholine (PC) into phosphatidic acid (PA), the main source of LPA. Phospholipase D3 (PLD3)
was found to be highly upregulated during atherogenesis, whereas no changes were observed in phospholipases D1 and D2expression. Likewise,
the expression of cytosolic phospholipase A2IVa (cPLA2IVa), the major intracellular PLA2 enzyme in humans25, was increased during atherogenesis. The relative contribution of this PLA familiy member in total LPA production has yet to be determined. Amongst others, cytosolic PLA2 has been shown to be involved in vascular smooth muscle cell and macrophage apoptosis27,28 and in the production of pro-inflammatory prostaglandins via arachidonic acid, pointing to a pro-atherogenic and plaque destabilizing activity of this enzyme. Furthermore, we observed highly significant downregulation of lysophosphatidic acid acyl transferase Į (LPAATĮ), an intracellular LPA converting enzyme. LPAATĮ is the isoform expressed highest of the two major isoforms present in tissue29.
increased expression of phospholipases D could result in proliferation of vascular smooth muscle cells and increased LPA production12. Not only LPA homeostasis appeared to be perturbed during atherogenesis, also LPA signal transduction was changed. A significant upregulation was shown for two LPA receptors, LPA2 and -3, which may translate in an augmentation of
signaling pathways. Selective antagonists of LPA1 and LPA3 on platelets
have been shown to quench plaque lipid induced platelet activation6. After blocking of these LPA receptors, thrombogenic capacity was decreased, which suggests that an increased LPA receptor expression may be accompanied by an elevated risk of thrombosis. Moreover, we observed a significant downregulation of the plaque expression of the intracellular LPA receptor PPARȖ, and its downstream effector, CD36. PPARȖ activation has been associated with reduced atherosclerosis and regulates the expression of many genes involved in inflammation and lipid homeostasis30.
Fatty acid binding proteins (FABPs) can bind intracellular LPA and have been shown to play a role in atherosclerosis31. Absence of the adipocyte specific FABP4 (aP2) in macrophages attenuates atherosclerosis in hypercholesterolemic mice32,33. In the expression analysis a downregulation of FABP4 during plaque development was found, which might suggest a role for FABP4 in the initiation of atherosclerotic lesion development. Recently, Makowski et al. described a role for aP2 in macrophage cholesterol trafficking and inflammatory activity34. Our data on cardiomyocyte-specific FABP3 expression during atherogenesis are in keeping with earlier reports in rabbits35,36, demonstrating a decreased FABP3 activity in atherosclerotic aortas upon high cholesterol feeding. However, the effects of FABP3 downregulation on atherogenesis have not yet been elucidated. Surprisingly, FABP1, which is mainly present in liver tissue, was also expressed in vascular tissue and slightly upregulated during lesion development.
In conclusion, LPA accumulates during atherogenesis, already starting in the initial stage of atherosclerotic lesion development. Although these expression data still have to be verified by in situ hybridization to locate the cell type(s) responsible for the changed enzyme/receptor expression and/or by immunohistochemistry, it is clear that the shift in gene expression will favor accumulation of LPA during plaque progression and will augment LPA receptor signal transduction. As such, this study provides us a panel of potentially relevant target genes for further investigation with respect to atherosclerotic lesion development and thrombogenicity and we suggest that intervention in the LPA metabolism can be an effective new therapeutic entry in the reduction of plaque thrombogenicity
References
1. Ross R. Atherosclerosis, an inflammatory disease. New Engl J Med. 1999;340:115-126. 2. Libby P. Current concepts of the pathogenesis of the acute coronary syndromes. Circulation. 2001;104:365-372.
3. Shah PK. Mechanisms of plaque vulnerability and rupture. J Am Coll Cardiol. 2003;41:15S-22S.
5. Siess W, Zangl KJ, Essler M, Bauer M, Brandl R, Corrinth C, Bittman R, Tigyi G, Aepfelbacher M. Lysophosphatidic acid mediates the rapid activation of platelets and endothelial cells by mildly oxidized low density lipoprotein and accumulates in human atherosclerotic lesions. Proc Natl Acad Sci U S A. 1999;96:6931-6936.
6. Rother E, Brandl R, Baker DL, Goyal P, Gebhard H, Tigyi G, Siess W. Subtype-selective antagonists of lysophosphatidic acid receptors inhibit platelet activation triggered by the lipid core of atherosclerotic plaques. Circulation. 2003;108:741-747.
7. Siess W, Tigyi G. Thrombogenic and atherogenic activities of lysophosphatidic acid. J Cell Biochem. 2004;92:1086-1094.
8. Moolenaar WH. Lysophosphatidic acid, a multifunctional phospholipid messenger. J Biol Chem. 1995;270:12949-12952.
9. Siess W. Athero- and thrombogenic actions of lysophosphatidic acid and sphingosine-1-phosphate. Biochim Biophys Acta. 2002;1582:204-215.
10. Moolenaar WH. Lysophosphatidic acid signalling. Curr Opin Cell Biol. 1995;7:203-210. 11. Moolenaar WH, Kranenburg O, Postma FR, Zondag GC. Lysophosphatidic acid: G-protein signalling and cellular responses. Curr Opin Cell Biol. 1997;9:168-173.
12. Gennero I, Xuereb JM, Simon MF, Girolami JP, Bascands JL, Chap H, Boneu B, Sie P. Effects of lysophosphatidic acid on proliferation and cytosolic Ca++ of human adult vascular smooth muscle cells in culture. Thromb Res. 1999;94:317-326.
13. Natarajan V, Scribner WM, Hart CM, Parthasarathy S. Oxidized low density lipoprotein mediated activation of phospholipase D in smooth muscle cells: a possible role in cell proliferation and atherogenesis. J Lipid Res. 1995;36:2005-2016.
14. Tokumura A, Iimori M, Nishioka Y, Kitahara M, Sakashita M, Tanaka S.Lysophosphatidic acids induce proliferation of cultured vascular smooth muscle cells from rat aorta. Am J Physiol. 1994;267:C204-C210.
15. Goetzl EJ, An S. Diversity of cellular receptors and functions for the lysophospholipid growth factors lysophosphatidic acid and sphingosine 1-phosphate. FASEB J. 1998;12:1589-1598. 16. Zhang C, Baker DL, Yasuda S, Makarova N, Balazs L, Johnson LR, Marathe GK, McIntyre TM, Xu Y, Prestwich GD, Byun HS, Bittman R, Tigyi G. Lysophosphatidic acid induces neointima formation through PPARgamma activation. J Exp Med. 2004;199:763-774.
17. Guyton JR. Phospholipid hydrolytic enzymes in a 'cesspool' of arterial intimal lipoproteins: a mechanism for atherogenic lipid accumulation. Arterioscler Thromb Vasc Biol. 2001;21:884-886. 18. von der Thüsen JH, van Berkel TJC, Biessen EAL. Induction of rapid atherogenesis by perivascular carotid collar placement in apolipoprotein E-deficient and low-density lipoprotein receptor-deficient mice. Circulation. 2001;103:1164-1170.
19. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Med Sci. 1959;37:911-917.
20. Bjerve KS, Daae LN, Bremer J. The selective loss of lysophospholipids in some commonly used lipid-extraction procedures. Anal Biochem. 1974;58:238-245.
21. Bremer J. Carnitine in intermediary metabolism. The biosynthesis of palmitylcarnitine by cell subfraction. J Biol Chem. 1963;238:2774-9.:2774-2779.
22. Saulnier-Blache JS, Girard A, Simon MF, Lafontan M, Valet PA. simple and highly sensitive radioenzymatic assay for lysophosphatidic acid quantification. J Lipid Res. 2000;41:1947-1951. 23. 't Hoen PA, Van der Lans CA, Van Eck M, Bijsterbosch MK, Van Berkel TJ, Twisk J. Aorta of ApoE-deficient mice responds to atherogenic stimuli by a prelesional increase and subsequent decrease in the expression of antioxidant enzymes. Circ. Res. 2003;93:262-269. 24. Noguchi K, Ishii S, Shimizu T. Identification of p2y9/GPR23 as a novel G protein-coupled receptor for lysophosphatidic acid, structurally distant from the Edg family. J Biol Chem. 2003;278:25600-25606.
25. Pickard RT, Strifler BA, Kramer RM, Sharp JD Molecular cloning of two new human paralogs of 85-kDa cytosolic phospholipase A2. J Biol Chem. 1999;274:8823-8831. J Biol Chem. 1999 Mar 26;274(13):8823-31
26. Pages C, Simon MF, Valet P, Saulnier-Blache JS. Lysophosphatidic acid synthesis and release.Prostaglandins Other Lipid Mediat. 2001;64:1-10.
28. Panini SR, Yang L, Rusinol AE, Sinensky MS, Bonventre JV, Leslie CC. Arachidonate metabolism and the signaling pathway of induction of apoptosis by oxidized LDL/oxysterol. J Lipid Res. 2001;42:1678-1686.
29. Tigyi G, Parrill AL. Molecular mechanism of lysophosphatidic acid action. Prog Lipid Res. 2003;42:498-526.
30. Puddu P, Puddu GM, Muscari A. Peroxisome proliferator-activated receptors: are they involved in atherosclerosis progression? Int J Cardiol. 2003;90:133-140.
31. Boord JB, Fazio S, Linton MF. Cytoplasmic fatty acid-binding proteins: emerging roles in metabolism and atherosclerosis. Curr Opin Lipidol. 2002;13:141-147.
32. Perrella MA, Pellacani A, Layne MD, Patel A, Zhao D, Schreiber BM, Storch J, Feinberg MW, Hsieh CM, Haber E, Lee ME. Absence of adipocyte fatty acid binding protein prevents the development of accelerated atherosclerosis in hypercholesterolemic mice. FASEB J. 2001;15:1774-1776.
33. Layne MD, Patel A, Chen YH, Rebel VI, Carvajal IM, Pellacani A, Ith B, Zhao D, Schreiber BM, Yet SF, Lee ME, Storch J, Perrella MA. Role of macrophage-expressed adipocyte fatty acid binding protein in the development of accelerated atherosclerosis in hypercholesterolemic mice. FASEB J. 2001;15:2733-2735.
34. Makowski L, Brittingham KC, Reynolds JM, Suttles J, Hotamisligil GS. The fatty acid-binding protein, aP2, coordinates macrophage cholesterol trafficking and inflammatory activity. Macrophage expression of aP2 impacts peroxisome proliferator-activated receptor gamma and IkappaB kinase activities. J Biol Chem. 2005;280:12888-12895.
35. St John LC, Bell FP. Arterial fatty acid-binding protein activity associated with dietarily-induced and spontaneously occurring atherosclerosis in the rabbit (Oryctolagus cuniculus). Comp Biochem Physiol B. 1990;97:123-127.
