oxygen transfer proteins and redox enzymes
Zauner, G.
Citation
Zauner, G. (2008, October 23). A FRET-based method to study the activity of electron or oxygen transfer proteins and redox enzymes. Retrieved from https://hdl.handle.net/1887/13201
Version: Corrected Publisher’s Version
License: Licence agreement concerning inclusion of doctoral thesis in the Institutional Repository of the University of Leiden
Downloaded from: https://hdl.handle.net/1887/13201
Note: To cite this publication please use the final published version (if applicable).
Chapter V
Sensitive fluorescence method to detect substrate binding to P450cam #
# Gerhild Zauner,[a] Soumen K. Manna,[b] Sanjay D. Mhaske,[b] Armand W.J.W. Tepper,[a] Thijs J.
Aartsma,[a] Gerard W. Canters[a] and Shyamalava Mazumdar[b]
[a] Leiden Institute of Chemistry, Leiden University, 2300 RA Leiden, The Netherlands
Abstract
A method for fluorescence detection of a protein’s redox state based on resonance energy transfer from an attached fluorescent label to the prosthetic group of the protein has been proposed previously (1). Herein, we describe the application of this principle to P450cam from Pseudomonas putida to monitor substrate binding to the active site of the protein. The wild type P450cam was covalently linked with Cy5 fluorescent label on the N-terminus. In addition, a cysteine mutant of the enzyme, A113C, was specifically labeled with Atto700. Fluorescence titrations with a high and a low affinity substrate were performed yielding dissociation constants that match the data acquired by absorption spectroscopy. This method permits to perform fluorescence titrations at submicromolar concentrations of P450cam, which will be applicable to a wide range of P450’s. Given the importance of these enzymes in high throughput assays for drug screening, the present contribution may lead to new developments in this area.
Introduction
Cytochrome P450 enzymes form a large superfamily of heme protein mono- oxygenases that catalyze a wide variety of physiologically important processes such as fatty acid metabolism, xenobiotic degradation, steroid biosynthesis etc. (2). The model system used most for a better structural and mechanistic understanding of P450s is probably cytochrome P450cam (CYP101, E.C.: 1.14.15.1) (3) from the soil bacterium Pseudomonas putida. It has been favoured because of its stability and solubility as well as the availability of structural data in all possible intermediate states during catalysis (4).
Cytochrome P450cam catalyses the oxidation of (+)- camphor to 5-exo- hydroxycamphor, the first step in the camphor metabolic pathway of the organism (4).
In order to complete the catalytic cycle two electrons, one molecule of oxygen and two protons are required- apart from the substrate- before the product is released. In the natural system the electrons required for this reaction are delivered by putidaredoxin, the redox partner of P450cam. The whole process has been studied extensively; the crystal structures of the camphor bound and free forms of the enzyme have been reported (5;6) and even the intermediates involved have been identified at atomic resolution recently (4). In particular the conversion from a low-spin form of the iron to a high-spin form upon camphor binding to the heme of P450cam has been used extensively to characterize the camphor-bound form of the enzyme (7).
It has been shown that the enzyme is quite selective for camphor as the substrate and that the binding affinity for many camphor derivatives is much smaller compared to the native substrate of the enzyme. Selective mutations of the active site have been used to enable metabolism by P450cam of ‘unrelated’ compounds, for example styrene and its derivatives, nicotine, ethylbenzene etc. (8). Even ruthenium- linker substrates have been shown to get hydroxylated by the enzyme when suitable electron donors are provided, underlining the extraordinary ability of P450s to handle a wide variety of substrates (9). The binding of the substrate is the first step of the enzymatic
cycle and reversible high binding affinity of the substrate to the enzyme is required for catalytic efficiency. It is thus important to accurately determine the binding affinity of a potential substrate to the enzyme in order to assess its potential for catalytic conversion and to subsequently design suitable mutations of the active site to enable stronger binding of the potential substrate to P450cam.
Inspired by the continuous efforts to accommodate diverse substrates within the P450 heme pocket (10;11), we investigated the binding of camphor and a ‘novel’ substrate of Pseudomonas putida P450cam, lindane (the - isomer of 1,2,3,4,5,6- hexachlorocyclohexane). Lindane belongs to the cyclodienes, a class of organochlorine insecticides that are prepared from hexachlorocyclopentadiene using the Diels-Alder reaction (12). Usage of lindane as pesticide is wide spread; it is applied on fruit, vegetables and forest crops, and is also used for topical treatments for head and body lice. A big problem is the disposal of lindane due to its possible carcinogenic effects on humans (13). The cheapest method, combustion, is undesirable because of formation of even more toxic polychlorinated dioxins (13).
Given the importance of camphor as a model compound for the substrate binding mechanism to P450cam (14) and of lindane in agriculture as a pesticide (15) and its role as a xenobiotic, gaining a more detailed understanding of their interactions with monooxygenases is a strong focus of research in molecular biochemistry (16;17). To be able to study P450 using only small amounts of protein we have opted for a fluorescence based technique as fluorescence detection is sensitive and can be used in protein (bio)chemistry in many ways. For example, it has been shown that the intrinsic fluorescence of the tryptophan residues of P450cam can provide information on the substrate dependent dynamics in P450cam (18). Others have shown that fluorescein isothiocyanate (FITC) can be attached specifically to P450scc(CYP11A1) and that, through Förster resonance energy transfer from the dye to the heme conformational changes as well as intermolecular recognition events can be followed (19).
In our study the wild type P450cam was labeled with Cy5 succinimidylester on the N- terminus of the enzyme. Also the fluorophore Atto700 was attached to the surface cysteine of an engineered A113C mutant by employing maleimide chemistry. Substrate binding constants were determined for (+)- camphor and lindane by means of titrations that were monitored by absorbance spectroscopy and by a FRET based fluorescence technique. The latter proved much more sensitive in that at least ten times less enzyme concentration is needed for the titration.
Materials and Methods
General
Restriction enzymes were purchased from New England Biolabs. DEAE-Sepharose, Q-sepharose and Sephadex G-25 columns were from Pharmacia Biotech. General reagents, (1R)-camphor and 1,2,3,4,5,6- hexachlorocyclohexane (lindane) were obtained from Sigma. Atto700 maleimide was purchased from ATTO-TEC Biolabeling and Ultraanalytics (Siegen, Germany), Cy5 was ordered from Amersham Biosciences (Freiburg Germany). 50 mM stock solutions of the dyes were prepared by dissolving the powders in water-free DMSO. All purification steps during protein labeling were performed using a PD-10 gel-filtration columns (Amersham Pharmacia).
Mutation, Expression and Purification
The WT Pseudomonas putida P450 expression and purification was performed as described earlier (20). Site- directed mutagenesis was carried out using the Quikchange site-directed mutagenesis kit (Stratagene). The forward and reverse primers for the alanin 113 to cysteine mutant of cytochrome P450cam (A113C) were as follows:
x 5’ - GTGCGCTGGCCTGCCAAGTGGTTG - 3’,and x 3’ - CACGCGACCGGACGGTTCACCAAC - 5’ respectively.
The primers (purchased from GENEI (Bangalore, India)) removed the MscI site at the 361bp position of the WT camC gene along with introducing the A113C mutation. For the expression and purification of the mutant the same procedure was followed as for the WT. Fractions of A113C mutant with an RZ value (A391/A280)
>1.2 were used for this study.
Protein labeling
The P450cam A113C variant was labeled at position 113 with Atto700 maleimide in potassium phosphate buffer 100 mM, pH 7.0. The WT P450 was labeled at the N- terminus with Cy5 in the same buffer at pH 7.4. To roughly 10 μM enzyme solution a 5-fold molar excess of the individual dye was added and the mixture was incubated for 4 minutes in the case of the mutant P450 and for 30 minutes for the WT enzyme, both at 4ºC, before removing the unbound label as described earlier (21). Labeling ratios were in the range of 0.1 –0.4 (dye molecule/protein), as determined from the absorption spectra of the labeled proteins using the extinction coefficients at 417 nm for the protein (= 119mM-1cm-1) (20), at 700 nm for the Atto700 (= 120 mM-1cm-1) and at 645 nm for Cy5
(
= 250 mM-1cm-1; for both dyes extinctions as stated by the manufacturers). The protein absorption was corrected for the contribution of the dye absorption at 417 nm.As a control for the A113 mutant labeling on the cysteine residue WT protein was treated under the same conditions; no fluorophore binding was observed (data not shown).
UV-VIS Spectroscopy
All UV-vis absorption spectra were measured either on a Shimadzu (UV-2100) spectrophotometer or on a Cary50 UV-VIS spectrophotometer and were recorded at 20ºC using a 10x10 mm quartz cuvette (Hellma). The substrate free form of P450cam was obtained by passing the protein twice through a PD-10 column, pre-equilibrated and subsequently eluted with 100 mM potassium phosphate buffer or 50 mM Tris (pH 7.4). The extinction coefficient used for the substrate bound WT and the substrate bound A113C enzyme at 391 nm was 102 mM-1cm-1(20); for the substrate free forms an extinction coefficient of 119 mM-1cm-1 at 417 nm was used (20).
The camphor binding constant was determined by optical absorption spectroscopy (7) by measuring the change in the absorbance at 417 nm upon titrating the substrate free WT enzyme with camphor in 50 mM Tris (pH = 7.4) in the presence of 100 mM KCl at room temperature. Stock solutions of camphor were prepared in EtOH at several concentrations (0.2-7.5 mM) and aliquots were consecutively added to the protein solution. After five minutes the spectra were measured. The same procedure was used to determine the lindane binding constant.
Fluorescence Spectroscopy
Fluorescence spectra were measured on a Spex Fluorolog-1681T spectrofluorometer with the excitation and emission band width set to 3 nm, in a 10x5 mm quartz cuvette (Hellma). The fluorescence excitation wavelength for P450 labeled with Atto700 was set at 700 nm and the fluorescence spectra were measured in the range of 710-850 nm after each addition of substrate. For the P450 Cy5 construct the fluorescence excitation wavelength was 645 nm and the spectra were taken from 650-850 nm after each substrate addition. Measurements were performed in potassium phosphate buffer (100 mM, pH 7.4) at room temperature.
Transfer efficiency calculations
The efficiency of Förster resonance energy transfer (FRET) is defined as (22):
E = 1- FDA/ FD Eq.5.1
where E stands for the FRET efficiency, and FDA and FD are the donor fluorescence intensities with and without an acceptor, respectively. As an example the value of FD
for the Atto700 labeled P450 was established as follows: the absorbance of a sample solution of the free Atto dye was measured to determine the concentration of the dye after which the fluorescence intensity was measured at 720 nm under 700 nm excitation. In this way the Atto fluorescence intensity could be related to the Atto concentration in the sample solution. Subsequently the fluorescence intensity of a solution of labeled P450 of a known concentration was measured with and without the substrate (camphor) to determine the FRET efficiencies for both cases in relation to the intensity of the free dye. For the camphor free form an efficiency (Efr) of 0.52 was found, for the bound form (Eb) a value of 0.57 was obtained.
Förster radius calculation
The customary way to obtain a theoretical estimate of the efficiency of the energy transfer is based on the following equation:
E = R06 / (R6+R06) Eq.5.2
where R stands for the distance between donor and acceptor and R0 is the Förster radius, a system parameter depending in the spectral properties of donor and acceptor and their relative orientation (23). R0 values for Atto700 or Cy5 in relation to the
heme center of P450cam were determined from the equation R0=0.211(JN2n-4)D)1/6 (Å) (22). Here N2 is an orientation factor, n – the refractive index, )D – the fluorescence quantum yield of the donor and J – the spectral overlap integral, defined as J= ³FD(O)HA(O)O4dO/³FD(O)dO, where FD(O) is the fluorescence intensity of the donor, HA(O) - the extinction coefficient in [M-1 cm-1] of the acceptor at wavelength O with O expressed in nanometers. The refractive index was assumed to be 1.4 and the orientation factor N2 was taken to be 2/3. )D for Atto700 was taken to be 0.25, for Cy5 a value of 0.28 was used as stated by the manufacturers.
The distance (R) from either the Atto700 or the Cy5 to the active site was estimated as R= (d +1) r 0.5nm (adding 1 nm to the calculated distance d accounts for the approximate length of the linker chain), where d is the distance from the attachment point of the dye (mutated cysteine 113 or N-terminus) to the Fe of the heme. The distance d was estimated as 1.5r0.5nm for the A113C mutant and 3r0.5nm for the WT enzyme as determined from the P.p. P450cam crystal structures in the camphor free and bound forms [PDB codes: 1PHC and 1DZ4] (4;6). (For further details on the estimation of the distances between donor and acceptor as well the influence of N, please also see chapter 2.)
Results and Discussion
Spectroscopic features of P450cam
Figure 5.1A shows the absorption spectrum of P.p. P450cam in the camphor-bound and camphor-free state and the high spin marker band around 645 nm (inset) indicative of camphor binding (10). The overlap of this band with the emission spectra of Atto700 and Cy5 is shown in Figure 5.1B. In the substrate-free form this high spin marker band is missing. The variation in spectral overlap modulates the
quenching of the label fluorescence meaning that upon substrate binding the efficiency of energy transfer from the dye (Atto700 or Cy5) to the heme is increased.
300 400 500 600 700 800
0 10 20 30 40 50
600 650 700 750 800
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0
H , mM-1 cm-1
wavelength, nm
A
H , mM-1 cm-1
wavelength, nm
600 650 700 750 800
0 2 4 6 8
H , mM-1 cm-1
B
wavelength, nm
Atto700,Cy5 fluoresc., a.u.
Figure 5.1. A. Absorption spectrum of camphor-free (red) and camphor-bound (black) Pseudomonas putida P450cam and the high spin marker band around 645 nm (inset; bound form). B. Spectral overlap of the 645 nm band of P.p. P450cam (solid line) with the emission spectrum (em= 665 nm) of Cy5 (black dashed line) and the emission spectrum (em= 720 nm) of Atto700 (gray dashed line). Protein concentration: 2.8 μM in 100 mM potassium phosphate buffer (pH = 7.4) in presence of 100 mM KCl at room temperature.
Substrate binding to the WT P450
The steady state dissociation constant (Kd) of (1R)- camphor to the P450 WT from Pseudomonas putida was studied by following the absorbance changes occurring upon substrate binding at 417 nm as described previously (7) at room temperature (see figure 5.2A). The intensities of the signals versus the substrate concentration were fit to the following equation:
F0- Fobs = (F0- F )*[St] / ([St]+Kd), Eq.5.3
where Fobs is the absorbance at 417nm measured after each substrate addition, F0 is the initial absorbance at 417 nm in absence of the substrate, F is the absorbance at 417 nm in the substrate saturated state of the enzyme, [St] is the total concentration of substrate and Kd is the dissociation constant for the substrate. The titration was performed with ~ 6 M WT P450cam in 50 mM Tris (pH = 7.4) in the presence of 100 mM KCl. Fitting the data to equation Eq.5.3 (Figure 5.2A inset), a Kd value of 1.3
± 0.2μM was calculated, which is in agreement with literature data (20). Plotting and fitting the data as described previously by Peterson et al (7) resulted in the same Kd
value (Figure 5.3).
350 400 450 500 550 600 650 0.0
0.2 0.4 0.6
0 10 20 30 40 50 60 70 80
0.54 0.55 0.56 0.57 0.58 0.59 0.60
Absorbance at 417nm
lindane, PM
B
Absorbance
wavelength, nm
350 400 450 500 550 600 650 0.0
0.2 0.4 0.6 0.8
0 5 10 15 20 25 30
0.35 0.40 0.45 0.50 0.55 0.60 0.65
Absorbance at 417nm
camphor, PM
A
Absorbance
wavelength (nm)
Figure 5.2. A. Absorption titration of WT P450cam from Pseudomonas putida (black line) with 0.5, 1, 1.5, 2, 2.5, 3.5, 4, 5, 7, 12, 17, 22 M of total concentration of camphor. The inset shows the absorbance at 417 nm as a function of the total camphor concentration. Protein concentration was roughly 6 M WT P450cam in 50 mM Tris (pH = 7.4) in presence of 100 mM KCl at room temperature. B. Absorption titration of WT P450cam from Pseudomonas putida (black line) with 2, 7, 17, 37, 77 M of lindane. The inset shows absorbance at 417 nm as a function of the total lindane concentration. Protein concentration was roughly 5 M WT P450cam in 50mM Tris (pH = 7.4) in presence of 100mM KCl at room temperature.
For the binding of lindane to the protein the same method was used (Figure 5.2B).
The Kd value for lindane as determined from fitting the data to Eq. 3 amounted to 16.4± 3.2 M.
0.0 0.1 0.2 0.3 0.4 0.5 3.0
3.5 4.0 4.5 5.0 5.5
1/ dA
4171/camphor
(P M-1
)Figure 5.3. The double reciprocal plot for camphor binding corresponding to Figure 5.2A. The absorbance was followed at 417 nm. Protein concentration was roughly 6 M WT P450cam in 50 mM Tris (pH = 7.4) in presence of 100 mM KCl at room temperature. The Kd extracted from the plot amounted to 1.5± 0.1 M.
For the A113C variant we have not measured the Kd values. This is because judging from the crystal structure of P450cam (5) it may be expected that the engineered A113C mutation, which is located on the distal side of the protein, does not interfere with the binding of the substrate. The same Kd values as found for the WT P450 cam, therefore, be assumed to apply to the A113C variant.
Substrate binding to the fluorescently labeled P450
To test our fluorescence based method it was decided to introduce a fluorescent label at two different positions in the P450 protein: the N-terminus and the position of an engineered surface cysteine (position 113). In order to check whether the labeled proteins would be capable of binding substrate, the optical spectrum was measured for the case of the Atto700 labeled A113C mutant in the absence of camphor and in the presence of a saturating concentration (36 μM) of camphor. Clearly, upon substrate binding the spectral transition from 417 to 392 nm corresponding to the low- to high- spin state transition of the heme in the WT enzyme (7) is observed (Figure 5.4). The conclusion is that the enzyme binding pocket is not affected by the covalent attachment of the fluorophore to the enzyme. This is in line with expectations based on an inspection of the crystal structure as the introduced attachment point of the dye molecule (cysteine residue 113) is not in the proximity of the binding site. Likewise we expect no interference with substrate binding from the label at the N-terminus.
300 400 500 600 700 800 0.00
0.01 0.02 0.03 0.04 0.05 0.06 0.07
420nm
392nm
Absorbance, AU
wavelength, nm
Dye Absorption
Figure 5.4. Absorption spectra of substrate free A113C mutant P450cam from Pseudomonas putida labeled with Atto700 maleimide (grey line) and of the substrate bound form (black line). Protein concentration was roughly 1.5 M in 100 mM potassium phosphate (pH = 7.4) at room temperature.
Fluorescence spectra of the Atto700 labeled A113C variant were measured upon excitation at 700 nm in the absence and presence of (1R)- camphor and lindane.
In Figure 5.5 we show the difference spectra (F = Fini – Fobs) obtained by the titration of the labeled enzyme with camphor and a plot of the fluorescence intensity at 720 nm versus the substrate concentration. The data were fit to equation Eq.5.3 which gave a value for Kd of 1.5 ± 0.2μM. This value agrees with the value of Kd = 1.3± 0.2 μM obtained for the optical absorption titration data of the WT enzyme. A similar titration with lindane gave a Kd value of 22± 6 μM (Figure 5.6). Also here the results are in agreement with the data measured by absorption spectroscopy (see section Substrate binding to the WT P450).
Secondly, the fluorescence spectra of the N-terminally Cy5 labeled wt P450 were measured upon excitation at 645 nm during titrations with (1R)- camphor. The experiment was repeated a number of times and the signals were normalized and globally fit to equation Eq.5.3 (Figure 5.5B). The obtained value for the Kd amounted to 0.8± 0.1 μM, a value slightly lower than the one observed for the P450 Atto700 construct.
0 2 4 6 8 10 12 14 16
-0.2 0.0 0.2 0.4 0.6 0.8 1.0
B
day 1 day 2 day 3
Fluorescence at 665nm, AU
camphor, PM
720 740 760 780 800
0 20000 40000 60000
0 5 10 15 20 25 30
490 500 510 520 530 540
Fluorescence at 720nm, AU
camphor, PM
difference spectra, AU
wavelength, nm
A
Figure 5.5. A. Difference spectra (F0 –Fobs) obtained from fluorescence measurements upon excitation at 700nm of the A113C variant of P450cam labeled with Atto700 upon titration with camphor ( 0.2, 0.4, 0.8, 1.2, 2.0, 2.8, 4.6, 6.9, 10.8, 17.7 and 27.3 μM). Protein concentration was 0.6 M in 100 mM potassium phosphate (pH = 7.4) at room temperature. Inset: Plot of the observed fluorescence intensity at 720 nm versus total camphor concentration. B. Plot of the observed fluorescence intensity at 665 nm (excitation: 645 nm) obtained from a camphor titration of WT P450cam labeled with Cy5 versus the camphor concentrations for three datasets.
720 740 760 780 800 820 840 0
400 800 1200 1600
A
Fluorescence, AU
wavelength, nm
0 20 40 60 80 100
735 750 765 780 795 810
B
lindane, PM
Fluorescence at 730nm, AU
Figure 5.6.A. Fluorescence specta obtained upon excitation at 700nm of A113C P450cam labeled with Atto700 upon titration of lindane (0.8- 101 μM). Protein concentration was roughly 0.8 M in 100 mM potassium phosphate (pH = 7.4) at room temperature. B. Plot of the observed fluorescence intensity at 730 nm versus lindane concentration plus fit. The Kd value obtained was 22 ± 6 M.
The data are summarized in Table 5.1.
Substrate Titration followed by absorption spectroscopy
Titration followed by fluorescence spectroscopy [P450cam] Kd [P450cam/A700] Kd
(1R)- camphor 6M 1.5 ± 0.1μM 0.6M 1.5 ± 0.2μM
lindane 5M 20 ± 2μM 0.6M 22 ± 6μM
[P450cam/Cy5]
(1R)- camphor 0.2M 0.8 ± 0.1μM
Table 5.1. Kd values obtained for binding of (1R)- camphor and lindane to P450cam by UV/VIS and fluorescence titration method.
R
0values and switching ratios
It is of interest to compare the observed transfer efficiencies (as defined by equation Eq.5.1) with the theoretical estimates (as given by equation Eq.5.2). This is done for the case of the Atto700 labeled A113C enzyme as an example. The observed transfer efficiencies amount to (vide supra) 0.52 and 0.57 for the camphor-free and camphor- bound states, respectively. Based on the calculated Förster radii of 34.57 and 34.85Å (vide supra), respectively, and a label-heme distance of 30 Å, the theoretical transfer efficiencies (equation Eq.5.2) amount to 0.68 and 0.69 (equation Eq.5.2). Although the theoretical estimates agree with the observed values in that substrate binding results in an increase in the transfer efficiency, the magnitudes of the theoretical estimates differ from the observed values. This can be traced back to the calculation of the spectral overlap integral, J. As can be seen in Figure 5.1B the overlap between the Atto700 emission band and the P450 high-spin absorption band is critically dependent on the position of the baseline in the latter spectrum. In fact minimal changes in this position by = ± .01 mM-1cm-1 cause variations in J by 2% leading to variations in E (equation Eq.5.2) by 1%. The change in spectral overlap upon substrate binding, on the other hand, is much less sensitive to the spectral baseline position.
One might ask if conformational changes could produce a similar effect, i.e., if a change in R instead of R0 in equation Eq.5.2 could be responsible for the observed change in transfer efficiency between substrate-bound and -free forms. Although strictly speaking this possibility cannot be ruled out, it seems unlikely as the cause for the observed switching due to the fact that the distance between the heme and residue 113 (or the N-terminus) is not altered upon substrate binding (4;6).
It should be noted that even if the cause for the change in transfer efficiency is uncertain, the change itself can be used for the fluorescence based monitoring of substrate binding thereby offering a distinctive advantage in sensitivity over absorbance techniques.
Controls
The stability of free dye (Atto700 maleimide) in nanomolar concentration in 100mM potassium phosphate was tested versus both substrates used in this study. In the case of camphor a negligible change in the fluorescence intensity of the dye (1%) was obtained, for lindane a decrease of 2.4% upon addition of up to 80 μM lindane was observed (taken at the dye maximum, Figure 5.7). Plotting the changes in fluorescence intensity versus substrate concentration added did not results in any regular trend (data not shown).
720 740 760 780 800
50 100 150 200 250 300 350 400 450 A
Fluorescence Atto700, AU
wavelength, nm
720 740 760 780
0 100 200 300 400 500
Fluorescence Atto700, AU
wavelength, nm
B
Figure 5.7.A. Fluorescence spectra of unbound Atto700 observed upon titration of camphor into the solution (0.8- 27.3 μM). B. Fluorescence spectra of unbound Atto700 observed upon titration of lindane into the solution (0.8- 80 μM). Conditions for both experiments: 700 nm excitation; 100 mM potassium phosphate (pH = 7.4) at ambient temperature.
Conclusions
The present data provide proof that the previously introduced labeling technique for monitoring the redox states of proteins with prosthetic groups like a type-1 copper site or a flavin (1), can also be applied to P450cam and used to monitor substrate binding. In our study changes in fluorescence intensities could be observed at high wavelength and be used to determine the dissociation constants for two different substrates. We could show that P450cam binds lindane with low affinity (Kd around 20 μM) on the basis of absorption spectroscopy and that the data match the observations obtained by fluorescence techniques. This allows us (1) to follow substrate binding in a sensitive (submicromolar concentrations of substrate) and selective way and (2) to determine binding of various substrates requiring only submicromolar amounts of protein. The enzyme concentrations used in our fluorescence studies were ten times lower than the ones needed for absorption measurements and even lower enzyme concentrations can be used depending on the degree of fluorescence labeling of the enzyme. Compared to the purification and expression procedure, the labeling of the enzyme with a fluorophore is simple. We expect that our method can be applied to other P450’s providing a very sensitive tool to monitor substrate binding and/or even turnover. In the field of drug screening our findings might be significant for possible high throughput applications.
Acknowledgements
The authors thank Mr.Bharat T. Kansara for assistance. This work is supported by the Stichting voor Fundamenteel Onderzoek der Materie (FOM) with financial aid from the Nederlandse Organisatie voor Wetenschappelijk Onderzoek (NWO) and and by the European Community through the EdRox network under Contract No. MRTN- CT-2006-035649.
Reference List
1. Kuznetsova, S., Zauner, G., Schmauder, R., Mayboroda, O. A., Deelder, A. M., Aartsma, T. J., and Canters, G. W. (2006) Analytical Biochemistry 52-60.
2. Ortiz de Montellano (1995) Cytochrome P450: Strucuture, Mechanism, and Biochemistry.
3. Bell, S. G., Chen, X., Sowden, R. J., Xu, F., Williams, J. N., Wong, L. L., and Rao, Z. (2003) J.Am.Chem.Soc. 705-714.
4. Schlichting, I., Berendzen, J., Chu, K., Stock, A. M., Maves, S. A., Benson, D.
E., Sweet, B. M., Ringe, D., Petsko, G. A., and Sligar, S. G. (2000) Science 1615- 1622.
5. Schlichting, I., Jung, C., and Schulze, H. (1997) Febs Letters 253-257.
6. Poulos, T. L., Finzel, B. C., and Howard, A. J. (1986) Biochemistry 5314-5322.
7. Peterson, J. A. (1971) Archives of Biochemistry and Biophysics 678-693.
8. England, P. A., Harford-Cross, C. F., Stevenson, J. A., Rouch, D. A., and Wong, L. L. (1998) Febs Letters 271-274.
9. Dunn, A. R., Dmochowski, I. J., Bilwes, A. M., Gray, H. B., and Crane, B. R.
(2001) Proceedings of the National Academy of Sciences of the United States of America 12420-12425.
10. Narasimhulu, S. (2007) Biochimica et Biophysica Acta-General Subjects 360- 375.
11. Helms, V., Deprez, E., Gill, E., Barret, C., Hoa, G. H. B., and Wade, R. C.
(1996) Biochemistry 1485-1499.
12. Crosby (1998) Environmental Toxicology and Chemistry, New York.
13. Zinovyev, S. S., Shinkova, N. A., Perosa, A., and Tundo, P. (2004) Applied Catalysis B-Environmental 27-36.
14. Winn, P. J., Ludemann, S. K., Gauges, R., Lounnas, V., and Wade, R. C. (2002) Proceedings of the National Academy of Sciences of the United States of America 5361-5366.
15. Walsh, L. P. and Stocco, D. M. (2000) Biology of Reproduction 1024-1033.
16. Swart, M., Groenhof, A. R., Ehlers, A. W., and Lammertsma, K. (2005) Chemical Physics Letters 35-41.
17. Zhang, Z. P., Sibbesen, O., Johnson, R. A., and de Montellano, P. R. O. (1998) Bioorganic & Medicinal Chemistry 1501-1508.
18. Prasad, S. and Mitra, S. (2002) Biochemistry 14499-14508.
19. Lepesheva, G. I., Strushkevich, N. V., and Usanov, S. A. (1999) Biochimica et Biophysica Acta-Protein Structure and Molecular Enzymology 31-43.
20. Manna, S. K. and Mazumdar, S. (2006) Biochemistry 12715-12722.
21. Zauner, G., Lonardi, E., Bubacco, L., Aartsma, T. J., Canters, G. W., and Tepper, A. W. J. W. (2007) Chemistry-A European Journal 7085-7090.
22. Lakowicz J.R. (1996) Principles of Fluorescence Spectroscopy, Kluwer Academic/Plenum Publishers, New York, Boston, Dordrecht, Moscow.
23. Stryer, L. and Haugland, R. P. (1967) P Natl Acad Sci USA 719-726.
