Minimal genome project: observing growth rates and viability of genomically reduced Bacillus subtilis strains under different overnight dilutions in minimal medium

(1)

1

Minimal genome project: observing growth rates and viability of

genomically reduced Bacillus subtilis strains under different overnight

dilutions in minimal medium

Written by: Wanda Puijk Student number: 11283300 Examinator: Prof. Hamoen, L.W. Supervisor: Siersma, T.

(2)

2

Abstract

Creating a viable cell with minimal genes can give answers to many questions about the metabolic fundamentals of life. A minimized cell is constructed either by deletions of genes of by step by step introduction of genomic material. Reuss et al introduced the Minimal Genome Project, in which researchers try to find the function and number of essential genes in Bacillus subtilis that are necessary for a viable cell in complex medium. This research focusses growth rates of a number of genomically reduced B. subtilis strains in minimal medium. Specifically the lag-phase duration of minimized strains are compared to each other under variable optical densities, to identify potential genes associated with log-phase initiation.

(3)

3

Introduction

Cells are the smallest units of life, harbouring dozens of chemical reactions necessary for life. Genetic material, also known as the genome of an organism, contains many of genes that all have functions relating to protein expression, cell growth, division and metabolism (Reuß et al, 2016).

Bacillus subtilis, a bacterial model organism, is one of the most studied organisms, containing

around 4,100 genes. Not all genes are necessary to maintain the basic metabolic processes of the cell running, many genes are disposable or its function can be replaced by another gene (Breuer et al., 2018)(Reuß et al, 2017). A gene is described as essential when it is indispensable under optimal growth conditions (Reuß et al, 2016). Reuß et al started analysing the genome of B.

subtilis to select genes that were necessary to grow strains in optimal conditions.

Two methods are applicable when working with minimalization of genetic material, the bottom-up and the top-down approach. The bottom-up approach uses synthetically designed genomes to establish which genes are necessary for a minimal viable cell, by adding genes making the genome more complex step by step. This method is a very structured approach, however quite time consuming. Reuß et al (2016) applied the top-down method of genome minimization to determine minimal genetic requirements for a viable cell. This method involves the stepwise deletion of nonessential genes, this allows for more detailed analysis of gene functions. To make sure a cell is not impaired too much by its genomic reduction, the growth and generation time of the minimized B. subtilis strains must be similar to the wild type, as well as physiological properties when grown in complex medium (Reuß et al, 2016). Kurokawa, Seno, Matsud and Ying (2016) stated that genomically reduced organisms have an increased gene product activity, which can have many valuable applications in medical sciences. In addition, getting to know the oldest and most fundamental metabolic processes of a cell may give insights to how life started and what the molecular requirements are for an organism to be viable (Attwater & Holliger, 2014).

Reuss et al started genetic minimalization by deleting regions of the genome that are associated with non-essential functions, such as secondary metabolites, sporulation and motility. With every few gene deletions a new strain is created and by comparing the growth of each consecutive minimalized strain gene functions can be analyzed. This research focusses on the growth rate of the genomically reduced strains in minimal medium. Earlier findings of Ruben van Zwieten (2018) indicated a variation in lag phase duration within the same IIG-Bs27-14 strains when grown with different overnight optical density (OD) in minimal medium. Van Zwietens results suggest that strain IIG-Bs27-14 grown with a higher overnight OD (OD600=0.2) has a longer lag phase than the same strain grown with a lower overnight OD (OD600=0.01). The strains with high overnight OD seem to have a longer lag phase duration, therefore a delay in initiation of the exponential growth phase compared to the wild type B. subtilis strain PG344 under same growth conditions and overnight OD. To determine whether the described phenomenon is recurring in other strains, growth curve experiments in minimal medium were performed on a number of minimal genome strains. In addition, a transformation experiment was performed to knock-out the SpoIIE gene for sporulation in B. subtilis to optimize the growth curve results.

(4)

4

Methods and Materials

Growth conditions and media

In order to keep all variable environmental conditions to a minimum a Standard Operating Procedure (SOP) was applied during the growth experiments, table 1 in supplementary materials includes the protocol for the SOP. All B. subtilis strains that were used during experiments can be found in table 2 in the supplementary materials. The strains used for growth rate measurements were grown in minimal medium designed for B. subtilis, referred to as Amber medium. Further, Lysogeny Broth (LB) medium was used in some experiments, as well as LB agar for the plating of strains. The protocols for the preparation of Amber and LB medium are mentioned in table 1 in the supplementary materials. Inoculated media were placed in a shaking water bath at 200 rpm and 37° Cto let the cultures grow. Liquid overnight cultures were inoculated at the end of the day (around 17:00) and placed in shaking water bath at 200 rpm and 37° C to grow at night. In addition, inoculated LB agar plates were placed in 37° C stove at the end of the day (around 17:00).

Growth curve measurements

To determine whether minimal strains have a growth deficiency compared to the wild type or strains with fewer gene deletions, the growth of the strains was monitored by making of a growth curve. For this a spectrophotometer was used to measure the optical density (OD) using a wavelength of 600 nm. In preparation for the growth curve, the strains were streaked on LB agar plates at the end of the day to be grown overnight in 37° C stove. The next morning single colonies were picked from the plates and inoculated into Erlenmeyer flasks containing 10ml Amber medium. Next the flasks were placed in the water bath to grow during the day. At the end of the day the OD600 of the cultures was measured. If the OD600 exceeded 0.2, the 10 ml cultures were divided into two new flasks to be diluted to OD600 0.2 and OD600 0.01. In case the OD did not exceed 0.2, the cultures were diluted to 0.1 and grown overnight and the next day as well. The next morning all cultures were diluted to OD600 0.1. After this the OD600 of the cultures was measured every hour for 8 hours.

Kock-out of SpoIIE gene in minimal strains

Strains IIG-Bs1, IIG-Bs2, IIG-Bs4 and IIG-Bs9 that were used for growth curve measurements turned out to be sporulating when grown in Amber medium, since the sporulation gene was not yet deleted in these strains. To be able to determine the growth rate of these strains without the interference of spore formation, we decided to knock-out the SpoIIE gene for phosphatase activity necessary for sporulation. For this, a DNA fragment containing a kanamycin resistance gene and the upstream and downstream regions of the SpoIIE gene was designed in SnapGene viewer, details of the construct is depicted in figure 3. Firstly, DNA of wild type strain 168 was isolated, the protocol for DNA isolation is attached to table 3 in the supplementary materials. Primers were designed for the upstream and downstream regions of the SpoIIE gene in strain 168 and for the kanamycin resistance gene, a list of used primers is attached to table 4 in supplementary materials. Primers ZT153, ZT154, ZT158 and ZT159 were used for the upstream and downstream region of the SpoIIE gene. Primers ZT155 and ZT156 were designed to amplify the kanamycin resistance gene. Next the fragments were amplified by PCR and an overlap PCR was performed

(5)

5

to attach the upstream region, the kanamycin resistance gene and the downstream region, respectively, to each other to form one DNA fragment. The overlap PCR protocol can be found in table 8 in the supplementary materials . After this, the transformation of strains IIG-Bs1, IIG-Bs2, IIG-Bs4, IIG-Bs9 and IIG-Bs13 was performed using the overlap DNA fragment containing the kanamycin resistance gene, a protocol of the transformation can be found in table 5 in the supplementary materials. Thereafter, the transformed strains were plated on 5µg/ml kanamycin LB plates and grown overnight in 37° C stove. The next day single colonies were picked from the plates and inoculated in LB medium to grow for several hours. To check if the SpoIIE gene was deleted, the DNA of the strains was isolated and amplified by PCR. In addition, the strains were checked for spores under the microscope.

Research plan for future experiments

Since the transformation that we wanted to perform was not successful, we will try it again. If the transformation is successful, we will perform growth curve measurements of these strains looking at if the lag delay phenomenon is present in the transformed strains. We will transform more strains if necessary to get more detailed information about at which strain the phenomenon starts. If we find a certain strain which does not display the phenomenon while the subsequent strain with a few more deletions does show it, we will take a closer look at which specific genes were deleted. By looking into the deleted genes we hope to find more information about potential gene functions associated with log phase initiation. If the phenomenon is not an abrupt, but gradually increasing event that accumulates as the strains have a more reduced genome, then perhaps looking into this phenomenon will not bring any valuable information. Then we will most likely focus on other curiosities within the minimal genome project.

Results

Growth curve experiments

Based in the findings of Van Zwieten (2018) the focus of this research is the phenomenon he observed during his growth measurements experiments. Ruben observed a lag phase duration difference between some minimal strains compared to the wild type PG344 in Amber medium. Van Zwieten (2018) indicated that the lag phase duration difference was observed within the same minimal strains when diluted to different OD600 values (OD600 0.2 and OD600 0.01) for overnight culture (hereafter referred to as O/N). The strain with the least genome deletion in which van Zwieten observed with this phenomenon was IIG-Bs27-14. To determine whether this phenomenon is recurring, Rubens experiment was repeated. The growth curve of strain IIG-Bs27-14 compared to wild type PG344 is shown in figure 1. Figure 1 shows that within strain PG344, no difference in growth is seen between O/N OD600 0.2 and OD600 0.01. In addition, IIG-Bs27-14 with O/N dilution of OD600 0.01 has a similar growth curve to wild type PG344. However, at OD600 0.2 the strain seems to have a longer lag phase compared to the same strain at OD600 0.01, as Ruben observed during his experiments.

To determine whether this phenomenon occurs in strains with fewer deletions, the growth of a number of earlier strains was observed. To start with, a growth curve in Amber medium of strain IIG-Bs22 was made, figure 2 shows the results. The growth curve of IIG-Bs22 seems comparable to strain IIG-Bs27-14, only with OD600 0.01 growing slightly slower, but similar to IIG-Bs27-14

(6)

6

with the same O/N OD. Further, IIG-Bs22 with O/N OD600 of 0.2 shows a more linear growth line than the other cultures, implying a delay in log phase initiation. These results suggest that the phenomenon starts before strain IIG-Bs22. Since it is likely that the lag phase delay appears in earlier strains than IIG-Bs22 with fewer gene deletions, we decided to make growth curves as well of strains IIG-Bs1, IIG-Bs2, IIG-Bs4, IIG-Bs9 and IIG-Bs13 in Amber medium. However, during the measurements the strains were examined under the Bright-Field microscope and all strains appeared to be sporulating. To make sure that the sporulation of the strains did not interfere with the growth curve measurements, we decided to knock-out the SpoIIE gene responsible for sporulation in the strains mentioned above.

(7)

7

Knock-out of SpoIIE gene in minimal strains

To start with we designed a DNA fragment with SnapGene viewer containing the upstream and downstream, region of the SpoIIE gene in wildtype strain 168. Between the upstream and downstream region a kanamycin resistance gene was inserted. For this we designed PCR primers, a list can be found under supplementary materials table 5. The SnapGene DNA fragment is shown in figure 3.First, we amplified the up and downstream region of the SpoIIE gene with PCR. The results of the gel are shown in figure 4a, the bands for the upstream and downstream region of SpoIIE appeared at roughly 1000 and 1100 bp (base pairs), respectively, as was expected if amplification was successful. Next the kanamycin resistance gene was amplified using a kanamycin containing plasmid. The kanamycin resistance gene is around 820 bp long, corresponding to the length visible on the gel in figure 4b. To attach all fragments together an overlap PCR was performed. The whole DNA fragment should be around 3000 bp if amplified successfully. The result of the PCR is presented in figure 4c. The PCR was performed in triplet, sample 3 appeared to be the brightest indicating the highest concentration of DNA. This sample was taken and used for the transformation of the minimal B. subtilis strains Bs1, Bs2, IIG-Bs4, IIG-Bs9 and IIG-Bs13. Next the transformed strains were plated on a kanamycin containing LB agar plate to be grown at 37° C overnight. There appeared to be no growth on the negative control plate, to which no DNA was added. On the positive control plate, to which DNA with only a kanamycin resistance gene was added many colonies were visible. On plates all of the plates IIG-Bs1, IIG-Bs2, IIG-Bs4, IIG-Bs9 and IIG-Bs13 at least one colony appeared, figure 5 shows the inoculated kanamycin plates. To determine whether the strains successfully knocked-out the SpoIIE gene, we inoculated the strains in Amber medium to do growth curve measurements and microscopy analysis. When looked at under the Bright-Field microscope it appeared that the strains had still formed spores in Amber medium. In addition, we performed DNA isolation of the strains and amplified the supposedly inserted kanamycin gene with SpoIIE up and downstream region. Figure 4d shows the results of the gel, the bands of the amplified fragment were 3800 bp long, while if transformation was successful the band should have appeared at around 3200 bp.

(8)

8

Figure 5 Transformed strains on kanamycin LB plates. All plates had at least one colony present, except for the negative control plate. The positive control plate showed many colonies.

(9)

9

Extra assignment: Planning knock-out genes ydbC and ydbD

Genes ydbC and ydbD were chosen since they share the same operon, which makes it easier and less work to delete them both at the same time. In addition, their functions were still unknown and their Tn-values are not too low.

Part 1

1. Design primers for target gene that must be deleted. See supplementary materials table 6 for the primer sequences.

a. Primer WP1 for upstream region of target genes ydbC and ydbD b. Primer WP2 for downstream region of target gene ydbC and ydbD c. Primers WP3 and WP4 for kanamycin resistance gene

d. Primers WP5 and WP6 for 20 bp overlap between upstream region of ydbC and downstream region of ydbD to attach kanamycin resistance gene.

e. WP7 as a control primer 100 bases removed from the downstream WP1 primer 2. DNA isolation of wildtype 168, see the protocol in table 3 of the supplementary materials 3. PCR of 168 DNA with WP1, WP2, WP3 and WP4. See PCR protocol in table 7 of the

supplementary materials

4. Clean up PCR product with Wizard SV gel and PCR clean-up kit. 5. Check if fragments have the expected length with gel electrophoresis

Part 2

6. Plasmid isolation of plasmid containing kanamycin resistance gene 7. PCR of kanamycin resistance gene with primer WP5 and WP6 8. Clean up PCR product with Wizard SV gel and PCR clean-up kit. 9. Check if fragments have the expected length with gel electrophoresis

(10)

10 Part 3

10. Overlap PCR of up-, downstream fragments and kanamycin resistance gene, using primers WP1 and WP3. See table 8 in the supplementary materials for overlap PCR protocol 11. Clean up PCR product with Wizard SV gel and PCR clean-up kit.

12. Check if fragments have the expected length with gel electrophoresis

Part 4

13. Perform transformation with overlap PCR DNA fragment. The transformation protocol is mentioned in table 5 of the supplementary materials

14. Plate the transformed strains on a LB agar plate containing kanamycin. Include a negative control to which no DNA was given and include a positive control to which a DNA fragment was given that contains the kanamycin resistance gene for sure.

15. If colonies are visible, inoculate them into liquid medium to let grow during the day 16. Isolate the DNA of the transformed strains

17. Check if the kanamycin resistance gene is present by doing PCR of isolated DNA with primer WP1 and outside check primer WP7

(11)

11

References

Attwater, J., & Holliger, P. (2014). A synthetic approach to abiogenesis. Nature Methods, 495-498.

Breuer, M., Earnest, T. M., Merryman, C., Wise, K. S., Sun, L., Lynott, M. R., … Luthey-Schulten, Z. (2018). Author response: Essential metabolism for a minimal cell. doi: 10.7554/elife.36842.064

Kurokawa, M., Seno, S., Matsud, H., & Ying, B. (2016). Correlation between genome reduction and. Correlation between genome reduction and, 517–525.

Reuß, D. R., Altenbuchner, J., Mäder, U., Rath, H., Ischebeck, T., Sappa, P. K., … Stülke, J. (2016). Large-scale reduction of the Bacillus subtilis genome: consequences for the transcriptional network, resource allocation, and metabolism. Genome Research, 27(2), 289–299. doi: 10.1101/gr.215293.116

Reuß, D. R., Commichau, F. M., Gundlach, J., Zhu, B., & Stülke, J. (2016). The Blueprint of a Minimal Cell: MiniBacillus. Microbiology and Molecular Biology Reviews, 80(4), 955–987. doi: 10.1128/mmbr.00029-16

van Zwieten, R. (2018). Minimal genome project: Streamlining B. subtilis genome to maintain low

(12)

12

Supplementary materials

Table 1. Standard Operating Procedure

Lysogeny Broth (LB)

Ingredients for basic LB medium, and possible additional ingredients, in grams/litre. (G. Bertani, 1951)

Amber medium

All stocks are made using Milli-Q water. In this study, Amber medium

was generally used

without the addition of tryptophan. The volume

was appropriately

compensated with Milli-Q water. Acknowledgement to Laura C. Bohorquez for

the composition and

protocol.

Improved growth rate protocol

Day 1

Step 1 Prepare an nutrient agar plate for each strain.

Step 2 At the end of the afternoon (~17:00) take the strains from the -80 °C stock. Scrape a small amount of frozen stock out of the cryotube (be aware, do not let the -80 °C stock thaw, so put it in the cooled holder and not in your), andstreak onto a nutrient agar plate using a pipette tip. Use a sterile toothpick to streak further out to single colonies.

(13)

13

step 4 Prepare Amber medium by mixing all components except for glucose and glutamate. Keep at room temperature (it is not yet clear how long you can keep it. Check for crystallization)

Day 2

Step 1 In the morning (~9:00) Complete Amber medium by adding glucose and glutamate. Transfer 10 ml of Amber medium into 150 ml Erlenmeyer. Add a single colony from the overnight plate.

Step 2 Grow the culture at 37 °C under vigorous shaking (~200 rpm?).

Step 3 Measure the OD600, and dilute to OD600 = 0.01 into fresh 10 ml culture (in 150 ml Erlenmeyer flask), and grow overnight at 37 °C under vigorous shaking. Keep a note of the end OD as a low OD is an indication of slow growth.

Day 3

Step 1 In the morning (~ 9:00) measure the OD600. Check whether there has been lysis in the culture by checking for debris, strings (DNA from lysed cells), and a lower than normal overnight OD (measure OD600). Check cells quickly with phase contrast to see whether their morphology looks ok and that there is not too much lysis. Importantly, while you do these checks keep the culture shaking! B. subtilis needs good aeration, otherwise it lyses. Therefore use the sample used for OD measurement to check cells under the microscope (before diluting the culture for OD measurements). It is also important to reduce the number of samples because sampling raises the chance of infections.

Step 2 For growth rate measurements, dilute overnight cultures into 15 ml medium (LB or Amber medium) to OD600 = 0.1. Place the flasks at 37 °C or 48 °C under vigorous shaking. Measure the OD600 every hour for the next 7 hours.

(14)

14

Step 3 Make growth curves by plotting the natural logarithm of OD against time. Calculate Doubling times with the following formula:

In which:

X1= OD during time point 1

X2= OD during time point 2

Y1= time point 1 (in minutes) during logarithmic phase

Y2= time point 2 (in minutes) during logarithmic phase

Also measure the lag time by extrapolating the log growth phase to the start OD, to indicate the start of the log phase.

Table 2. Minimal B. subtilis strains

species Location Name Description date

Rack Box spot# (Labjournal# and page)

B.subtilis Students 2 Jurian & Wanda 1 PG344 Labjournal Wanda page 5 6-feb-20

B.subtilis Students 2 Jurian & Wanda 1 IIG-Bs1

B.subtilis Students 2 Jurian & Wanda 1 IIG-Bs2 Labjournal Wanda page 18

B.subtilis Students 2 Jurian & Wanda 1 IIG-Bs4 Labjournal Wanda page 18 13-feb-20

(15)

15

B.subtilis Students 2 Jurian & Wanda 1 IIG-Bs27-3 Labjournal Wanda page 18 13-feb-20

B.subtilis Students 2 Jurian & Wanda 12 IIG-Bs27-27 Labjournal Wanda page 18 13-feb-20 Table 3. DNA isolation protocol

DNA isolation

Chromosomal DNA from B. subtilis (1): spin down 2 ml (epp) culture

wash in 1 ml TES buffer (100 ul 1 M TrisHCl-pH8, 20 ul 0.5 M EDTA, 1 ml 1 M NaCl in 10 ml) resuspend in 750 ul TES buffer and add 25 ul Lysozyme solution, incubate 5 min at 37 °C

add 50 ul Pronase, fortexcarefully and add 30 ul 30 % Sarkosyl and mix, incubate 30 – 60 min at 37 C

add 250 ul phenol, mix, add 250 ul chloroform mix and centrifuge for 4 min, take upper phase with decapitated blue pipette.

add 500 ul chloroform, mix, centrifuge for 4 min, take 600 ul upper phase with decapitated blue pipette.

Add 2 vol = 1800 ul ethanol and mix till cloud of DNA is visible, spin few seconds and take pellet with pipet and put in 70 % ethanol, and wash another 2 x with 70 % ethanol (remove remaining etoh by spinning shortly)

don’t dry but dissolve immediately in 200 ul TES buffer and incubating for 1 hour at 37 °C, store at -20°C

Plasmid DNA isolation from B. subtilis: spin 10 ml of culture (5 min 6000 rpm)

wash in 1 ml TES buffer (100 ul 1 M TrisHCl-pH8, 20 ul 0.5 M EDTA, 1 ml 1 M NaCl in 10 ml) resuspend in 250 ul Qiagen P1 buffer, add 25 ul Lysozyme solution, incubate 5 minutes at 37 °C.

(16)

16

Follow QIAquick miniprep protocol, but after addition of neutralization buffer (N3) keep tube on ice for 10 min. Include wash step with PB and elute with 200 ul TE.

Table 4. List of primers

Organism Design by Oligo

Name Sequence 5' to 3'

Bacillus Zihao, Jurian and Wanda ZT153 CATGTCTGGAGACGGAGAAATTATC

Bacillus Zihao, Jurian and Wanda ZT154 AGCAGCGGCCCTTTTATGTA

Bacillus Zihao, Jurian and Wanda ZT155 GGCGGACCAGTTACGATCAG

Bacillus Zihao, Jurian and Wanda ZT156 CTGTAGAAAAGAGGAAGGAAATAATA

Bacillus Zihao, Jurian and Wanda ZT157 CTAAAACAATTCATCCAGTAAAATATAATATT

Bacillus Zihao, Jurian and Wanda ZT158 ATTTCCTTCCTCTTTTCTACAGTCCTCTCATCTCCCACCTGTTA

Bacillus Zihao, Jurian and Wanda ZT159 TTTACTGGATGAATTGTTTTAGCGCTTCCGTATAAATCAAATTTCTTC Table 5. Protocol for transformation of B. subtilis

Transformation of competent B. subtilis cells MM competence medium (10 ml): 10 ml SMM medium 0.125 ml sol E = 40 % glucose 0.1 ml tryptophane solution 0.06 ml sol F = 1 M MgSO4 0.01 ml 20 % CAS

(17)

17 0.005 ml 0.22 % Fe-NH4-citrate Starvation medium: 10 ml SMM medium 0.125 ml sol E = 40 % glucose 0.06 ml sol F = 1 M MgSO4

- inocculate 5 ml overnight culture L medium.

- take ~1 ml overnight culture and inocculate 10 ml MM competence medium (OD600nm= 0.1). - grow 3 hours.

- add 10 ml prewarmed starvation medium, and continue for 1.5 hours (cells can also be competent after 0.5-1 hr. If transformation is important, try different starvation times).

- mix 10 microliter DNA with 0.4 ml competent culture, and shake for 45 min to 1 hour, before plating on selective medium.

1 x SMM g/l (NH4)2SO4 2

K2HPO4 / K2HPO4 3H2O 13.9 / 19.3 KH2PO4 6

NaCitrate 2H2O 2 Sol F:

1M MgSO4 7H2O 246.5 g/l Tryptofaan 5 mg/ml Table 6. Primer sequences extra assignment

Organism Designed

by Name Primer sequence (optional, may Comments

delay order processing)

length Oligo

Bacillus Wanda WP1 GCCAATCGCTCAACATTAAACGACA upstream primer

1000bp YdbC 25 bp

Bacillus Wanda WP2 GACCAGGAAGGCCTGCAGGA downstream

primer 1000bp YdbD

20 bp Bacillus Wanda WP3 ATTTCCTTCCTCTTTTCTACAGGGCTGCTCCTCTATGATGACGG overlap up 44 bp Bacillus Wanda WP4 TTTACTGGATGAATTGTTTTAGGTACCCATCTCCTTTTTCGTTTATCT overlap down 48 bp

Bacillus Wanda WP5 CTGTAGAAAAGAGGAAGGAAATAATAA kan up 27 bp

Bacillus Wanda WP6 CTAAAACAATTCATCCAGTAAAATATAATATT kan down 32 bp

Bacillus Wanda WP7 ACGAATGTCATAGCCCCCATTATCC outside check

(18)

18

Table 7. PCR protocol

Compound Amount (in ul)

10x Buffer 5 µl dNTP 1,5 µl 50 µM MgCl2 1 µl PFU 0,4 µl DNA template 50 ng H20 41 µl Primer 1 10 µM 0,2 µl Primer 2 10 µM 0,2 µl Total 50 µl

Table 8. Overlap PCR protocol

1) Amplify your fragments, the overlapping parts should have the overlapping Tm of 60.5-61.5◦C. The normal Tm standard overlapping part should be 56.5-57.5◦C.

2) For overlap PCR, add the 2 to 6 fragments 50 ng each in standard

PCR reaction (50 ul reaction), but only use 2 ul each of 1 uM (NOT 10 or 100 uM !!! Extremely Important) oligo concentration (only add the oligo sense to the first fragment and antisense to the last fragment) 3) Use the following PCR conditions -

In the first round, stitch the fragments together at a higher annealing (only one cycle) 95/ 98 ◦C – 2 min

60.5 ◦C – 5 min 72 ◦C – 10 min 95/ 98 ◦C – 1 min

In the second round, do standard PCR amplification (35 cycles) 95/ 98 ◦C – 15 sec

56.5 ◦C – 30 sec 72 ◦C – 30 sec per Kb 72 ◦C – 10 min 4 ◦C- infi ∞

Minimal genome project: observing growth rates and viability of genomically reduced Bacillus subtilis strains under different overnight dilutions in minimal medium