UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)
ß2-glycoprotein I in innate immunity
Ağar, C.
Publication date
2011
Document Version
Final published version
Link to publication
Citation for published version (APA):
Ağar, C. (2011). ß2-glycoprotein I in innate immunity.
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.
β
2
-Glycoprotein I
in innate immunity
Çetin Ağar
β
2-G
ly
co
p
ro
te
in
I
in
in
n
at
e i
m
m
u
n
ity
20
11
Çetin A
ğar
Çetin Ağar
β
2
-Glycoprotein I
β2-Glycoprotein I in Innate Immunity.
Dissertation, University of Amsterdam, Amsterdam, The Netherlands.
Author Çetin Ağar
Cover Cedarlane Laboratories, Ontario; Canada
Print Wöhrmann Print Service, Zutphen; The Netherlands
Copyright © 2011. Ç. Ağar, ‘s-Hertogenbosch, The Netherlands.
All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, without written permission of the author.
The publication of this thesis was financially supported by:
Instrumentation Laboratory Novo Nordisk Farma
Cedarlane Laboratories Glaxo Smith Kline
β
2
-Glycoprotein I
In Innate Immunity
ACADEMISCH PROEFSCHRIFT
ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam
op gezag van de Rector Magnificus Prof. dr. D.C. van den Boom
ten overstaan van een door het college voor promoties ingestelde commissie,
in het openbaar te verdedigen in de Agnietenkapel op donderdag 15 september 2011, te 14.00 uur door
Çetin Ağar
PROMOTIECOMMISSIE
Promotores: Prof. dr. J.C.M. Meijers
Prof. dr. P.G. de Groot
Overige leden: Prof. dr. M.M. Levi
Prof. dr. T. van der Poll
Prof. dr. J. van Strijp
Prof. dr. A. Sturk
Prof. dr. P.P. Tak
FACULTEIT DER GENEESKUNDE
Financial support by the Netherlands Heart Foundation and the Academic Medical Center for the publication of this thesis is gratefully acknowledged.
Birtanem
*C. 1. General Introduction
C. 2. β2-Glycoprotein I is incorrectly named apolipoprotein H
C. 3. β2-Glycoprotein I can exist in two conformations: implications for our understanding of the
antiphospholipid syndrome
C. 4. β2-Glycoprotein I: a novel protein in innate immunity
C. 5. Evolutionary conservation of the LPS binding site
of β2-Glycoprotein I
C. 6. Induction of auto-antibodies against β2GPI in mice by protein H of Streptococcus pyogenes
C. 7. Summary & Discussion
C. 8. Nederlandse samenvatting D. Dankwoord L. List of publications 080 102 008 016 022 044 70 064 116 124 136
CONTENTS
Page
“By three methods we may learn wisdom:
First, by reflection, which is noblest;
Second, by imitation, which is easiest;
and third by experience, which is the bitterest.”
08
CHAPTER
1
GENERAL INTRODUCTION
INTRODUCTION
History of β
2-glycoprotein I
β2-Glycoprotein I (β2GPI) was described in literature for the first time in 19611 and seven years later the first 2GPI deficient, seemingly healthy individual was identified2. β2GPI’s alternative name, apolipoprotein H, suggests a function in lipid metabolism but this was only based on a single publication that dates from 1979 in which it was shown that β2GPI was distributed over different human lipoproteins3. Since 1983 the names β2GPI and apolipoprotein H were used side by side for the same protein4, and the official designation for the β2GPI gene has become APOH. From 1990 on, the interest in this protein has increased significantly when β2GPI was identified as the most important antigen in the antiphospholipid syndrome (APS), which is amongst others characterized by the presence of antibodies directed to β2GPI5,6.
Proposed functions of β
2-glycoprotein I
Individuals and mice deficient in β2GPI appear to be healthy, indicating that the presence of β2GPI is not essential for life. β2GPI, however, is a highly abundant protein present in blood, and it is unlikely that it should not have a function. Because of the affinity of β2GPI for anionic phospholipids, it was thought that β2GPI could play a role in maintaining the haemostatic balance by inhibition of the contact phase activation of coagulation7-9. It was suggested that binding of β2GPI to either FXI or FXII results in inhibition of the intrinsic pathway of coagulation in in vitro
systems7-9. Furthermore, it has been suggested that β2GPI is involved in platelet prothrombinase activity and ADP-mediated platelet aggregation10,11. β2GPI binds liposomes and microparticles via an interaction with phosphatidylserine and is also involved in the clearance of these negatively charged cellular fragments in mice12-14. β2GPI has also been identified in atherosclerotic plaques15 and a number of studies
have suggested that the presence of antibodies against β2GPI resulted in accelerated atherosclerosis16,17. The first publication suggesting a role of β2GPI in angiogenesis showed that clipped or nicked β2GPI was able to inhibit bladder cancer development in mice18.2GPI levels increase with age and are reduced in pregnant women and in patients with stroke and myocardial infarction19.
β
2-glycoprotein I and the antiphospholipid syndrome
APS is an auto-immune disease defined by the presence of antiphospholipid antibodies in blood of patients in combination with thrombotic complications in arteries or veins as well as pregnancy-related complications20. In APS patients, the most common venous event is deep vein thrombosis and the most common arterial event is stroke. In pregnant women with APS early and late miscarriage can occur. Next to miscarriages also placental infarctions, early deliveries and stillbirth are reported. Antiphospholipid antibodies are found in 1% of the general population, however, the incidence increases with age and coexistent chronic disease21. The syndrome occurs more in women than in men, and is most common in young to middle-aged adults but can also occur in children and the elderly. Among patients with systemic lupus erythematodes, or lupus, the prevalence of antiphospholipid antibodies ranges from 12% to 30% for anticardiolipin antibodies, and 20% to 35% for lupus anticoagulant antibodies21. It is now generally accepted that the relevant auto-antibodies are not directed against phospholipids but towards proteins bound to these phospholipids5,6. β2GPI has a relative low affinity towards these negatively charged phospholipids but its affinity increased more than 100 times in the presence of auto-antibodies. β2GPI is now accepted as the most prominent antigen for the auto-antibodies in APS22. Recently, three independent groups have shown the importance of antibodies against β2GPI. Mice that were challenged by injection of these antibodies had an
10
increased thrombus formation23-26 and showed increased foetal resorption and a significant reduction in foetal and placental weight27,28. Despite the significant role of β2GPI in the pathophysiology of APS, all these in vivo and in vitro experiments did not reveal a convincing physiological function for β2GPI.
Biochemistry of β
2-glycoprotein I
β2GPI is a 43 kDa protein, consists of 326 amino acid residues29 (Figure 1). β2GPI is synthesized in the liver and it circulates in blood at variable levels (1-10 M)30. β2GPI is an anionic phospholipid binding glycoprotein composed of five homologous complement control protein repeats (CCP-I to CCP-V)31,32. These CCPs are generally found in proteins from the complement system and they could mediate binding of complement factors to viruses and bacteria33,34. The first four domains contain about 60 amino acids each, whereas the fifth domain has a 6 residues insertion and an additional 19 amino acid C-terminal extension. The extra amino acids are responsible for the formation of a large positive charged patch within the fifth domain of β2GPI35 that forms the binding site for anionic phospholipids (Figure 1). Human β2GPI contains one O-linked sugar on Threonine 130 and four N-glycosylation sites, at Arginines 143, 164, 174 and 234, localized in the third and fourth domain. The glycans account for 20% of the total molecular mass36. The crystal structure of β2GPI has been solved in 1999 by two groups32,37 and revealed a structure that looked like a J-shaped fishhook. The phospholipid binding site is located at the bottom side of CCP-V and consists of two major parts, a large positive patch of 14 charged amino acid residues and a flexible hydrophobic loop. This flexible loop contains a Tryptophan-Lysine sequence, giving the loop the potential to insert into the membranes38. Of the many single-nucleotide polymorphisms in the promoter region of the β2GPI gene, only two have been identified that correlate with a significant reduction of plasma levels of β2GPI39,40.
An interesting polymorphism is Cysteine to Glycine at position 306, a polymorphism that disrupts the phospholipid binding site within β2GPI, and which is also correlated with plasma levels of β2GPI41.
Figure 1. Crystal structure of β2GPI with the five domains (CCP-I to CCP-V). In blue the
negatively charged amino acids and in red the positively charged amino acids. In yellow the large positive charged patch within the fifth domain of β2GP that forms the binding site
for anionic phospholipids. Picture was made using Cn3D version 4.1, produced by the National Center for Biotechnology Information (http:// www.ncbi.nlm.nih.gov).
OUTLINE OF THIS THESIS
This thesis started with a general introduction on β2GPI of what was known until the year 2007 in which I started my PhD project. My work focused on the search for a physiological function of β2GPI, an abundant plasma protein and the major antigen for the antiphospholipid syndrome, but whose physiological function is still an enigma. The second chapter describes the distribution of β2GPI (apolipoprotein H) over the different lipoprotein fraction to confirm or falsify observations made in the literature. Since patients with antiphospholipid antibodies do not have circulating antibody antigen complexes in the presence of large amounts of β2GPI in the circulation, we hypothesized that the conformation of β2GPI in plasma may be different than when used in tests for the antiphospholipid syndrome. Therefore in chapter three, we focused on different conformations that β2GPI can adopt in response to changes in its environment. Due to the fact that β2GPI can adopt different conformations and the description in literature that domain V of β2GPI shows antibacterial activity, we hypothesized that β2GPI has the capacity to bind to LPS. This novel interaction between LPS en β2GPI is described in chapter four. In chapter five we show that the β2GPI protein isconserved across the animal kingdom. More and more evidence supports the association between infectious agents and APS, and it has been suggested that many autoimmune diseases are caused or triggered by infections. Despite this, the exact nature of their contribution is not deciphered. In chapter six we try to give an answer on the etiology of the antiphospholipid syndrome. In chapter seven I summarize and discuss all chapters described above and finish this thesis with a Dutch summary.
REFERENCES
1. Schultze HE, et al. Naturwissenschaften. 1961; 48: 719.
2. Haupt H, et al. Humangenetik. 1968; 5: 291-293.
3. Polz E and Kostner GM. Febs Letters. 1979; 102: 183-186. 4. Lee NS, et al. J Biol Chem. 1983;
258: 4765-4770.
5. McNeil HP, et al. Proc Natl Acad Sci USA. 1990; 87: 4120-4124.
6. Galli M, et al. Lancet. 1990; 335: 1544-1547.
7. Schousboe I. Blood. 1985; 66: 1086-1091.
8. Brighton TA, et al. Br J Haematol. 1996; 93: 185-194.
9. Shi T, et al. J Biol Chem. 2005; 280: 907-912.
10. Nimpf J, et al. Thromb Haemost. 1985; 54: 397-401.
11. Nimpf J, et al. Biochim Biophys Acta. 1986; 884: 142-149.
12. Nomura S, et al. Br J Haematol. 1993; 85: 639-640.
13. Chonn A, et al. J Biol Chem. 1995; 270: 25845-25849.
14. Balasubramanian K, et al. J Biol Chem. 1997; 272: 31113-31117. 15. George J, et al. Circulation. 1999;
99: 2227-2230.
16. Vaarala O. Lupus. 1996; 5: 442-447.
17. Staub HL, et al. Autoimmun Rev. 2006; 6: 104-106.
18. Beecken WD, et al. Ann Surg Oncol. 2006; 13: 1241-1251.
19. Lin F, et al. Lupus. 2006; 15, 87-93. 20. Miyakis S, et al. J Thromb Haemost.
2006; 4: 295-306.
21. Gezer S. Dis Mon. 2003; 49: 696-741.
22. Willems GM, et al. Biochemistry. 1996; 35: 13833-13842.
23. Fischetti F, et al. Blood. 2005; 106: 2340-2346.
24. Romay-Penabad Z, et al. Blood. 2009; 114: 3074-3083.
25. Ramesh S, et al. J Clin Invest. 2011; 121 :120-131.
26. Romay-Penabad Z, et al. Blood. 2011;117: 1408-1414
27. García CO, et al. Am J Reprod Immunol. 1997; 37: 118-124. 28. Ikematsu W, et al. Arthritis Rheum.
1998; 4: 1026-1039.
29. Lozier J, et al. Proc Natl Acad Sci USA. 1991; 81: 3640-3644.
30. Rioche M, et al. Biomedicine. 1974; 21: 420-423.
31. Bouma B, et al. EMBO J. 1999; 18: 5166-5174
32. Schwarzenbacher R, et al. EMBO J. 1999; 18: 6228-6239.
33. Brier AM, et al. Science. 1970; 170: 1104-1106.
34. Pangburn MK, et al. Biochem Soc Trans. 2002; 30: 1006-1010. 35. Hunt JE, et al. Proc Natl Acad Sci U
S A. 1993; 90: 2141-2145.
14
36. Kondo A, et al. J Proteomics. 2009; 73: 123-133.
37. Bouma B, et al. EMBO J. 1999; 18: 5166-5174.
38. de Planque MR, et al. J Biol Chem. 1999; 274: 20839-20846.
39. Kamboh MI, et al. Lupus. 1999; 8: 742-750.
40. Mehdi H, et al. Hum Genet. 1999; 105: 63-71.
41. Suresh S, et al. FEBS J. 2010; 277: 951-963.
16
CHAPTER
2
β
2-Glycoprotein I
is incorrectly named apolipoprotein H.
Çetin Ağar, Flip de Groot, Joost Levels, Arnoud Marquart, Joost Meijers.
β2Glycoprotein I (β2GPI) is a highly abundant protein present in blood, but without a known physiological function. In 1990, β2GPI has become a protein of great interest since it was shown by different groups that the so-called antiphospholipid antibodies present in the antiphospholipid syndrome (APS) are in fact directed against this plasma protein1,2. It has been acknowledged that β2GPI plays an important role in the thrombotic and pregnancy complications observed in APS and the correct biochemical characterisation of β2GPI is thus of pivotal importance3,4.
In 1979, Polz and Kostner5 showed the distribution of β2GPI over different human lipoproteins. Based on these observations, Lee, Brewer and Osborne designated β2GPI as apolipoprotein H (apoH)6. Since then the names β2GPI and apoH are both used for the same protein, and the official designation for the β2GPI gene has become APOH.
We were interested whether the localisation of β2GPI on lipoproteins was influenced by the presence of antiphospholipid antibodies and decided to reinvestigate the distribution of β2GPI over the different lipoproteins and plasma fractions. We observed that after this original observation no other publications have appeared that confirmed the observed association of β2GPI with lipoproteins.
Blood was drawn from five healthy volunteers in a fasting state and 3 hours after consuming a classic English breakfast (>1000 kilocalories), to repeat the original experiments by Polz and Kostner. Besides this, plasmas from 2 septic patients, 2 APS patients with antibodies against β2GPI and pooled plasma from more than 200 healthy volunteers were also investigated. The institutional Review Boards of the University Medical Centre Utrecht and Academic Medical Centre Amsterdam approved this study and informed consent was obtained from all patients or their caretakers.
Citrated blood samples were centrifuged (15 min, 1200 g) and plasma was collected. Three mL of plasma was brought to a density (D)
of 1.250 with KBr and layered with three KBr densities; D=1.225, D=1.100 and D=1.006. A single step ultracentrifugation (XL-90 Beckman, USA) was performed; 96.000 g for 19 hours at 10°C, and fractions of 200 µL were collected with a fraction collector. Collected fractions were diluted at least 1000-fold in Tris buffered saline (50 mM Tris, 150 mM NaCl, 0.1 % Tween-20, pH 7.4; TBS). Determination of β2GPI was done by a home-made sandwich enzyme-linked immunosorbent assay (ELISA), using a mouse monoclonal antibody 3B7 as the capturing antibody and a rabbit polyclonal α-β2GPI as a secondary antibody. Serial dilutions of normal pooled plasma (2.000x - 256.000x in TBS) were used as standard curve. Very low-density lipoproteins (VLDL), low-density lipoproteins (LDL) and high-density lipoproteins (HDL) samples were determined by PAP 250 cholesterol enzymatic methods. Cholesterol reagent (Biomerieux, Le Fontanille, France) was added to 10 μL of sample and measured on a spectrophotometer. As can be observed (figure 1A), no β2GPI could be detected in the different lipoprotein fractions from a healthy volunteer. These results were confirmed with an additional four healthy volunteers, two septic patients and normal pooled plasma (figure 1B). The consumption of a classic English breakfast did not change the distribution of β2GPI (data not shown). All fractions were also measured with surface plasmon resonance using a Biacore 2000 (Life Sciences, GE Healthcare, Sweden). To determine the binding of β2GPI to the lipoproteins, anti-β2GPI antibodies were coupled to a CM5-chip and the fractions were applied to the chip. In the fractions containing the different lipoproteins no β2GPI could be detected (data not shown). Antibodies directed against apoA1 and apoB were also coupled to a CM5-chip. The different lipoproteins were then directly captured from the ultracentrifugation fractions, followed by an injection of anti-β2GPI antibodies to detect potentially formed complexes between β2GPI and VLDL, LDL or HDL. No complexes were detected (data not shown). Subsequently, reconstituted HDL
(CSL-18
111, Parkville, Victoria, Australia) was bound to an anti-apoA1 coupled chip and purified β2GPI, from human plasma as described by Oosting7, was injected over the chip. No complex formation between purified β2GPI and purified HDL could be observed (data not shown).
Figure 1. (A) Ultracentrifugation profile of subject 1. Cholesterol (□) and β2-glycoprotein I
(β2GPI; ●) are depicted. (B) β2GPI distribution over the different human plasma
lipoproteins. Lipoproteins were separated after a one-step ultracentrifugation. Subjects 1-5 were normolipemic volunteers. Normal pooled plasma is from more than 200 volunteers. Blood from septic patients were drawn at the time they had sepsis. (APS: patients with antibodies against β2GPI).
19
A
To exclude the possibility that the separation technique for the lipoproteins could influence the outcome, lipoproteins from plasmas of 3 volunteers were separated using gel filtration on a Superose 6 HR 10/30 column (Pharmacia Biotech, Uppsala, Sweden) with inline fluorescence and UV detection. Fractions were diluted in BSA/TBS (20 mM Tris, 150 mM NaCl, 3% BSA) and 0.1% Tween-20 and the presence of β2GPI was detected with an ELISA. Again, β2GPI was only found in the plasma fractions, not in the fractions that contain the different lipoproteins (data not shown).
Since Polz and Kostner5 published the presence of β2GPI in human lipoproteins almost 30 years ago, no other studies have been performed to confirm the distribution of β2GPI over the different lipoprotein. Following this observation, Lee, Brewer and Osborne designated the name apoH for β2GPI and from then on apoH and β2GPI were used as synonyms for the same protein. Here we show with state-of-the-art techniques that β2GPI is not present in appreciable quantities in the lipoprotein fractions, neither in fasting healthy persons nor postprandially. Also, when plasmas of two APS patients positive for anti-β2GPI antibodies were subjected to lipoprotein separation, the presence of anti-β2GPI antibodies did not result in re-distribution of β2GPI from the plasma fraction over the lipoprotein fractions (figure 1B). From these observations it is clear that there are no interactions between β2GPI and LDL or HDL. It cannot be excluded that there is a possible weak interaction with VLDL. We have not studied the effects of oxidation of LDL8 on the distribution of β2GPI over the lipoproteins, because we do not know a patient cohort with proven oxidation of lipoproteins and it is questionable if in vitro oxidation of LDL mimics a physiological condition.
We conclude that apoH is not expected to be an integral part of lipoproteins and for this reason the name apolipoprotein H for β2GPI is clearly a misnomer. We therefore suggest to only use the name β2GPI.
20
REFERENCES
1. Levine JS, et al. N Engl J Med. 2002; 346: 752-763.
2. Urbanus RT, et al. Blood Rev. 2008; 22: 93-105.
3. Jankowski M, et al. Blood. 2003; 101:157-162.
4. de Groot PG, et al. J Thromb Haemost. 2005; 3: 1854-1860.
5. Polz E and Kostner GM. Febs Letters. 1979; 102 :183-186. 6. Lee NS, et al. J Biol Chem. 1983;
258: 4765-4770.
7. Oosting JD, et al. Thromb Haemost. 1992; 67: 499-502.
8. Matsuura E, et al. Prog Lipid Res. 2006; 45: 466-486.
22
CHAPTER
3
β
2-GLYCOPROTEIN I CAN EXIST IN 2
CONFORMATIONS: IMPLICATIONS FOR
OUR UNDERSTANDING OF
THE ANTIPHOSPHOLIPID SYNDROME.
Çetin Ağar, Gwen van Os, Matthias Mörgelin, Richard Sprenger, Arnoud Marquart, Rolf Urbanus, Ron Derksen, Joost Meijers, Flip de
Groot.
ABSTRACT
The antiphospholipid syndrome is defined by the presence of antiphospholipid antibodies in blood of patients with thrombosis or fetal loss. There is ample evidence that β2-glycoprotein I (β2GPI) is the major antigen for antiphospholipid antibodies. The auto-antibodies recognize β2GPI when bound to anionic surfaces and not in solution. We showed by electron microscopy studies, MALDI-TOF MS, LC/MS-MS that β2GPI can exist in at least two different conformations, a circular plasma conformation and an ‘activated’ open conformation. We also showed with surface plasmon resonance that the closed, circular conformation is maintained by interaction between the first and fifth domain of β2GPI. By changing pH and salt concentration, we were able to convert the conformation of β2GPI from the closed to the open conformation and back. In the activated open conformation, a cryptic epitope in the first domain becomes exposed that enables patient antibodies to bind and form an antibody-β2GPI complex. We also demonstrate that the open conformation of β2GPI prolonged the aPTT when added to normal plasma, while the aPTT is even further prolonged by addition of anti-β2GPI antibodies. The conformational change of anti-β2GPI and the influence of the auto-antibodies may have important consequences for our understanding of the antiphospholipid syndrome.
INTRODUCTION
The antiphospholipid syndrome is defined as the presence of antiphospholipid antibodies in blood of patients with thrombosis or fetal loss. The antiphospholipid syndrome is one of the most common causes of acquired thrombophilia1, especially at younger age. In 1990 it was shown that the so-called antiphospholipid antibodies do not recognize phospholipids directly but they interact with phospholipids via the plasma protein β2-glycoprotein I (β2GPI)2-4. However, the discovery of β2GPI as target for the auto-antibodies did not provide a more in-depth knowledge on the underlying cause of the syndrome. It was unclear which metabolic pathway was disturbed by the auto-antibodies, since no physiological function has convincingly been ascribed to β2GPI to date. Nevertheless, as antibodies against β2GPI can induce thrombosis in animal models5-7, the protein β2GPI must hold an important functional clue to our understanding of the syndrome.
β2GPI is a highly abundant 43 kDa protein that circulates at a concentration of approximately 200 µg/mL. β2GPI consists of 326 amino acids arranged in five short consensus repeat domains8,9. The first four domains contain 60 amino acids each, whereas the fifth domain has a 6 residues insertion and an additional 19 amino acid C-terminal extension. The extra amino acids are responsible for the formation of a large positive charged patch within the fifth domain of β2GPI10 that forms the binding site for anionic phospholipids. The anti-β2GPI antibodies that recognize an epitope located in the first domain correlate better with the thrombotic complications than antibodies directed against other domains11-13. Antibodies directed against β2GPI have become one of the serological markers characterizing the antiphospholipid syndrome (APS)14.
After binding to anionic surfaces, β2GPI exposes a cryptic epitope that is recognized by the auto-antibodies present in the antiphospholipid
24
syndrome11,12,15,16. These antibodies only recognize β2GPI when it is bound to a surface and do not recognize β2GPI in solution. Moreover, no circulating immune complexes between antibodies and β2GPI have been detected in patient plasmas17. This seems not to be due to clearance of these complexes from plasma, because plasma levels of β2GPI in antiphospholipid patients are the same as plasma levels of β2GPI in healthy individuals18. The crystal structure of β2GPI revealed a fishhook-like shape of the molecule9,19. Part of the epitope that is recognized by auto-antibodies consists of amino acids Arg39 and Arg43 in the first domain11,12. The crystal structure indicated that these amino acids are expressed on the surface of domain I of β2GPI and are thus accessible for auto-antibodies. This observation clearly contradicts with the absence of circulating β2GPI-antibody immune complexes in APS patients. The lack of binding of antibodies to β2GPI in solution fits better with a circular structure of β2GPI, a structure that was originally proposed by Koike et al20. In this hypothetical structure this potential epitope for the auto-antibodies was not exposed on the outside of the molecule. The aim of our study was to investigate the structure of β2GPI as it occurs in the circulation and to elucidate the changes that occur within the protein when antiphospholipid antibodies interact with the protein.
RESULTS
To investigate possible structural differences between β2GPI as it circulates in plasma and β2GPI in complex with antibodies, we performed negative staining electron microscopy studies of purified plasma β2GPI in the absence or presence of an anti-domain I β2GPI antibody (figure 1). Purified β2GPI was visible as a circular structure whereas β2GPI in complex with the antibody showed a fishhook-like structure comparable with the published crystal structures of β2GPI. These observations
suggest that plasma β2GPI circulates in a circular (‘closed’) conformation while after interaction with antibodies, β2GPI undergoes a major conformational change into a fishhook-like (open) structure.
Figure 1. Purified human plasma β2GPI was visualized with electron microscopy. (A–D)
Magnifications of purified plasma β2GPI show a circular conformation (graphical
representation of A–D in E–H). (I–L) Purified plasma β2GPI in the presence of antibodies
directed against domain I of β2GPI, show upon magnification an open fishhook-like shape
of β2GPI (graphical representation of I–L in M–P).
To achieve better understanding of these observed conformational differences, we determined conditions that allowed transition of one conformation into the other. When we dialyzed purified plasma β2GPI at high pH and high salt conditions, the circular plasma conformation of β2GPI (figure 2A) was converted into the open conformation (figure 2B). The open conformation of β2GPI could be converted back into the circular conformation of β2GPI by dialysis at low pH, as was shown by electron microscopy (figure 2C). The treatment of β2GPI at low and high
26
pH did not induce an apparent modification of the protein as determined by SDS-PAA gel electrophoresis (figure 2G) and MALDI-TOF MS/MS analysis (not shown).To quantify the number of open and closed β2GPI molecules present, we randomly counted 300 β2GPI molecules of plasma purified β2GPI and plasma purified β2GPI dialyzed against a high and low pH (figure 2H).
Figure 2. Electron microscopy visualization of β2GPI treated at high and low pH. (A)
Purified plasma β2GPI. (B) Plasma β2GPI after dialysis for two days at pH 11.5 with
subsequent neutralization to pH 7.4. (C) Plasma β2GPI, first dialyzed against pH 11.5, then
dialyzed for two days against pH 3.5 and subsequently neutralized to pH 7.4. Graphical representation of A, B and C in D, E and F, respectively. (G) SDS-PAA gel electrophoresis of purified plasma β2GPI (1), β2GPI after dialysis against pH 11.5 (2) and β2GPI first
dialyzed against pH 11.5 followed by dialysis against pH 3.5 (3). All 3 samples show a single band at approximately 43 kDa. (H) The percentages of circular and open conformation in purified plasma β2GPI (A), opened β2GPI (B) and re-closed β2GPI (C).
Plasma purified β2GPI contained 91% circular particles and 9% fishhook-like particles. Plasma purified β2GPI first dialyzed against high salt and pH 11.5 followed by dialysis against pH 7.4, contained 3% circular particles and 97% fishhook-like particles confirming the opening of plasma purified β2GPI. When this open fishhook-like conformation of β2GPI was dialyzed against pH 3.5 followed by a dialysis against pH 7.4, 89% circular particles and 11% fishhook-like particles were found, confirming the re-closing of opened β2GPI.
Figure 3. (A) ELISA plates were coated with purified anti-β2GPI IgGs isolated from APS
patients. Circular or open β2GPI was added and binding of β2GPI was measured with a
polyclonal anti-β2GPI antibody labelled with HRP. Open conformation of β2GPI (black bars),
circular conformation of β2GPI (grey bars). As a control for β2GPI concentration, a mouse
monoclonal anti-domain IV of β2GPI antibody was used. Bars represent means ± SD
(n=3). (B) ELISA plates were coated with cardiolipin and a serial dilution (0.4 – 50 μg/mL) of circular (●) or open (▲) β2GPI was added, subsequently followed by addition of purified
APS patient IgG antibodies.
To confirm that only the open conformation of β2GPI was recognized by patient antibodies, a sandwich ELISA was developed. Microtiter plates were coated with purified APS patient antibodies and incubated with open or circular β2GPI. The amount of β2GPI bound from the solution was detected with a peroxidase-conjugated anti-β2GPI antibody. Patient antibodies bound to open fishhook-like conformation of
28
β2GPI, while they did not recognize the circular conformation (figure 3A). When a mouse monoclonal antibody directed against domain IV of β2GPI was coated, both conformations of β2GPI were recognized. When cardiolipin was coated on the surface and incubated with open or circular β2GPI in the presence of purified APS patient antibodies, the patient antibodies recognized both conformations of β2GPI (figure 3B). To determine the amount of open β2GPI in normal plasma, we also incubated different dilutions of normal plasma with the coated patient antibodies and compared the signal with open β2GPI dissolved in buffer. We found that less than 0.1% of the β2GPI in the circulation was in the open conformation (data not shown). β2GPI is present in high concentration in plasma and depletion of β2GPI from normal plasma does not influence the results of coagulation assays21,22. When antibodies towards β2GPI were added to plasma, clotting times prolonged in a β2GPI dependent way. This effect of anti-β2GPI antibodies is known as lupus anticoagulant activity. We investigated whether the open and circular forms of β2GPI acted differently on coagulation. When circular plasma β2GPI was added to normal plasma (figure 4A) or β2GPI depleted plasma (data not shown), no effect on the dilute aPTT was observed When 15 g/mL open β2GPI was added to plasma or β2GPI depleted plasma, the aPTT prolonged for more than 10 seconds. In order to investigate whether besides opening of β2GPI there was an additional effect of anti-β2GPI antibodies, we studied whether addition of anti-β2GPI could further prolong the clotting time induced by open β2GPI. Addition of antibody and open β2GPI together to normal plasma gave an additional anticoagulant effect on top of the effect of open β2GPI alone (figure 4B) The additional effect of anti-β2GPI antibodies on the aPTT was observed with every concentration of open β2GPI tested (data not shown).
Figure 4. The effects of circular and open β2GPI on the aPTT were determined. Circular and
open β2GPI were added to normal pool plasma (NPP). (A) Control is NPP; circular is NPP
with addition of 15 g/mL plasma β2GPI; circular to open is NPP to which 15 g/mL plasma
β2GPI treated at pH 11.5 was added and circular to open to circular is NPP to which 15
g/mL plasma β2GPI first incubated at pH 11.5 and subsequently treated at pH 3.5 was
added. (B) Control is NPP; anti-β2GPI is NPP to which 15 g/mL purified monoclonal
anti-β2GPI antibody was added; anti-β2GPI + circular β2GPI is NPP with addition of
pre-incubated (5 min) anti-β2GPI antibody and plasma β2GPI and anti-β2GPI + open β2GPI is
NPP with addition of pre-incubated (5 min) anti-β2GPI antibody and plasma β2GPI first
incubated at pH 11.5 and subsequently treated at pH 3.5 (both 15 g/mL). Bars represent means ± SD (n=3).
To better understand the conformational changes of β2GPI, we trypsinized both forms of β2GPI and analyzed the peptides formed with MALDI-TOF MS (data not shown) and LC-MS/MS. Under non-denaturing conditions, specific peptides were more abundantly formed from the open form than the circular form. In particular, the amino acids Lys19, Arg39 and Arg43 in domain I and Lys305 and Lys317 in domain V were not or less accessible to trypsin in the circular form while they were accessible in the open form (figure 5).
30
Figure 5. Comparison of LC-MS surveys of β2GPI. LC-MS analyses of open and circular
β2GPI are depicted. The molecular masses of detected tryptic peptides are indicated.
Comparison of these 2 analyses shows that in the open conformation of β2GPI (top panel)
cleavage has taken place of the amino acids Lys19, Arg39, Arg43 (domain I), Lys305 and Lys317 (domain V) indicated by the black arrows, whereas they are not or less visible in the circular conformation of β2GPI (bottom panel) indicated by the white arrows.
When the digestion with trypsin was performed under denaturing conditions, in the presence of an MS-compatible detergent, an identical panel and abundance of peptides was formed from both conformations of β2GPI (data not shown).
In the circular conformation, interaction between different domains of β2GPI is necessary and from the mass spectrometry data an interaction between domain I and V was suggested. To study this, we have cloned the individual domains of β2GPI and studied their mutual interactions with surface plasmon resonance. As shown in figure 6, domain V interacted with domain I, while no interaction was found between domain I and domain IV of β2GPI. The interaction between domains I and V was found to be completely dependent on the presence of zinc ions. The dissociation constant between domain I and V of β2GPI was ~0.8·10-9 M. These observations suggest that to maintain the circular structure of β2GPI, domain V of β2GPI interacts with domain I (figure 7).
Figure 6. Binding of domain I to domain IV and V was investigated with surface plasmon resonance. Domain I of β2GPI (150 RU) was immobilized to a CM5 sensor chip and
increasing concentrations (25 – 200 nM) of domain IV or domain V were applied to the chip. Binding of domain V (●) to domain I in a concentration dependent manner was observed. No detectable interaction could be observed between domain IV (▲) and domain I.
DISCUSSION
Here we have shown that plasma β2GPI exists in two different conformations. Plasma-derived β2GPI is in a circular conformation, as was shown by electron microscopy observations. Analysis of the different conformations with MALDI-TOF MS, LC-MS/MS and surface plasmon resonance confirmed an interaction between domain I and V. As a result of the interaction with domain V, the epitope on domain I for the auto-antibodies that characterize the antiphospholipid syndrome is not available for binding by the antibodies (see figure 3). This also explains why no circulating immune complexes between β2GPI and the antibodies are observed in APS. After exposure to anionic structures, such as negatively charged phospholipids, β2GPI binds, opens up and exposes the epitope of the auto-antibodies and the antibodies are able to recognize β2GPI12. The interaction with antibodies probably stabilizes β2GPI in the open conformation.
There is a large difference between the (low) affinity of patient antibodies and the (high) affinity of murine monoclonal antibodies for β2GPI23. The affinity of the murine monoclonal antibody 3B7 for domain I is probably higher than the affinity of domain V for domain I, resulting in opening of β2GPI. The affinity of the patient antibodies could be too low to compete with domain V for binding to domain I. Only when anionic phospholipids compete for the binding to domain V with domain I, the affinity of the patient antibodies is sufficient to bind to domain I. This explains why after addition of a monoclonal antibody we could observe the open form with electron microscopy.
We were not able to show an interaction between β2GPI and anionic phospholipids vesicles by electron microscopy, because our efforts to prepare complexes between negatively charged vesicles and β2GPI resulted in agglutination of the vesicles which made the samples inappropriate for electron microscopy. Hammel et al24 mentioned
already that they observed increased turbidity of their solutions of liposomes and β2GPI, and that particle aggregation was responsible for the turbidity increase. Moreover, they observed an unexpected decrease in intensity of the fluorescent signal of the tryptophan residues, which could only be explained by agglutination of β2GPI.27 In addition, in their article they observed with calorimetric and circular dichroism studies, conformational changes when β2GPI was incubated with cardiolipin vesicles. They assumed that a partial loss of tertiary structural elements had taken place upon lipid association which fits with the observations we have made in this manuscript.
Depletion of β2GPI from normal plasma does not influence coagulation22. In contrast to the circular conformation; the open fishhook-like conformation of β2GPI has a profound effect on the aPTT. Therefore, we propose that the conformation of β2GPI in plasma is predominantly circular. When we analyzed β2GPI isolated from plasma we found that less than 0.1% was in the open conformation. Analysis of purified β2GPI with electron microscopy suggested that 9% of the molecules were in the open conformation but this high percentage was probably a technical problem due to adsorption of β2GPI to the copper grids. Addition of β2GPI in a fishhook-like conformation to normal plasma prolonged the aPTT but addition in combination with anti-β2GPI antibodies prolonged the clotting time of normal plasma even more. This suggests that the change in conformation alone can cause prolongation of the aPTT, but upon dimerization of β2GPI by the antibodies the clotting time is further prolonged21. To express lupus anticoagulant activity, a conformational change within β2GPI is essential, whereas dimerization of β2GPI by the antibodies is necessary to express full lupus anticoagulant activity.
In 1998, Koike et al proposed a circular structure for β2GPI which was constructed based on the NMR coordinates of short consensus repeat domains of human factor H20. No attention has been paid to this
34
proposed structure any more once the fishhook-like conformation of β2GPI was published that was deduced from resolution of the crystal structure9,19. Here we show that both conformations can exist and that both conformations can be converted into each other by changing pH and salt concentration. As this interaction can be influenced by changing pH and salt concentration, we speculate that there is a hydrophilic interaction between the two domains.
Figure 7. Depicted are β2GPI with its five domains (DI-DV) as it is in complex with
anti-β2GPI antibodies (A) and a proposed model of plasma β2GPI (B). The black dots indicate
the amino acids not accessible for trypsin. The black arrow indicates the location of the amino acids involved in the recognition of anti-β2GPI antibodies. In the circular
conformation the black circle indicates the concealing of the amino acids involved in the binding site of anti-β2GPI antibodies as a result of interaction between domain I and V of
β2GPI.
The crystallization of β2GPI was performed under extreme buffer and salt conditions, circumstances that probably interfered with the hydrophilic interaction and favoured the open form of β2GPI. The existence of two different conformations has important consequences for functional studies on β2GPI. We have shown that we can change one conformation into the other by changing the in vitro conditions. This means that researchers performing studies with β2GPI have to consider with which conformation of β2GPI their experiments were performed. The presence of β2GPI in a certain conformation is among others dependent on the presence of anionic surfaces but also on the method of purification of β2GPI. Our findings may have impact on the interpretation of research findings in the field of APS as the outcome of many laboratory experiments strongly depends on the conformation of β2GPI as we have shown for the effect of β2GPI on clotting assays.
Schousboe et al25, Brighton et al26, Mori et al27 and Shi et al28 suggested that binding of β2GPI to either FXI or FXII results in inhibition of the intrinsic pathway of coagulation in in vitro systems. A counterargument against these in vitro observations was that the aPTT of normal plasma is independent of the plasma levels of β2GPI; levels that can vary significantly29. Moreover, deficiency of β2GPI did not result in a prolongation of the aPTT30. Here we can provide an explanation for these conflicting results. Apparently, the experiments were performed with β2GPI in an open conformation while plasma β2GPI is in the inactive circular conformation. The open conformation is necessary to express the inhibitory activity on the contact activation of blood coagulation.
We performed direct binding experiments with domain I and domain V. We calculated a dissociation constant of ~0.8 nM, but the fit of the binding curves in the surface plasmon resonance experiments was not optimal. There are theoretical and practical reasons for this suboptimal fit. In the circular conformation, the binding between domain I and V takes place between two domains present in the same molecule,
36
which is incomparable to the interaction between two domains freely present in solution. The concentration of domain I in the vicinity of domain V will be increased, because domain I is via domains II-IV covalently connected to domain V. This will enhance binding through mass action effects. There is also an entropy term that must be considered. Domains I and V present in one molecule have less mutual mobility than domains I and V in solution. This loss of freedom is entropy unfavourable. When domain I and V are part of the same molecule, the entropy of the system has decreased and the interaction between domains I and V becomes thermodynamically favourable. We had also technical problems measuring the kinetics of the interaction of domain I and domain V. At higher concentrations, we observed a mutual interaction between domains V, which interfered with the kinetic measurements. This mutual interaction between domains V might be of interest, because it could explain the increase in binding affinity of β2GPI for anionic phospholipids when it forms a complex with the antibodies. It is possible that after dimerization of β2GPI, that takes place via binding of the antibodies, subsequently two-dimensional array formation can occur31,32 on anionic phospholipids via domain V-domain V interactions. For annexin A5, the formation of these two dimensional aggregates is essential for its inhibitory potential on coagulation33,34.
To better understand the epitopes responsible for the maintenance of the circular conformation of β2GPI, we have performed enzymatic digestions on both forms of β2GPI under both native and denatured conditions and analyzed the peptides formed by LC-MS/MS. The amino acids Lys19, Arg39 and Arg43 in domain I and Lys305 and Lys317 in domain V were not accessible for trypsin in the circular form while they were accessible in the open form. After addition of a detergent prior to digestion, the same panel and abundance of peptides was formed with trypsin from both conformations of β2GPI. These observations suggest that these particular amino acids are hidden from
the solution in the circular form and exposed to the solution in the open form of β2GPI, indicating that epitopes within domain I and domain V are involved in the maintenance of the circular conformation of β2GPI.
Originally we have suggested that patient antibodies are not able to bind to plasma β2GPI because the epitope Arg39-Arg43 in β2GPI for the antibodies is covered by a negatively charged carbohydrate side chain12. The conformational change that is induced in β2GPI after binding to phospholipids should interfere with the intramolecular interaction of the carbohydrate side chain with the epitope for the antibodies, which subsequently results in the exposure of the epitope for the antibodies. This idea was further elaborated by Kondo et al35 who demonstrated increased sialylation of the glycan structures of β2GPI of APS patients, suggesting an altered intramolecular interaction and conformational instability of β2GPI in patients. At the moment we have no information whether differences in sialylation of carbohydrate side chains of β2GPI facilitate the conversion between the open and circular conformation by anti-β2GPI antibodies.
In conclusion, the observations made here on the structural changes that can take place within β2GPI and the subsequent stabilization of this conformation by auto-antibodies can have very important consequences for our understanding of the antiphospholipid syndrome.
MATERIALS AND METHODS
Purification of human plasma β2GPI
Plasma β2GPI was isolated from fresh citrated human plasma as described previously21. Purity of
β2GPI was determined with sodium dodecylsulfate polyacrylamide gel electrophoresis (GE
Healthcare; Piscataway, NJ; USA). Purified plasma β2GPI showed a single band with a molecular
mass of approximately 43 kDa under non-reducing conditions. The concentration of the protein was determined with the bicinchoninic acid protein assay (Thermo Fisher Scientific LSR; Rockford, IL; USA). MALDI-TOF analysis of the purified protein showed that it was more than 99.9% pure.
Negative staining transmission electron microscopy
β2GPI, in 20 mM Hepes buffer, pH 7.4, was analyzed by negative staining electron microscopy as
described previously36. Solutions of β
2GPI (5-10 nM) with or without pre-incubation with mouse
monoclonal antibody 3B7 against domain I of β2GPI were placed on a carbon coated copper grid
and negatively stained with uranyl formate (UF). A 0.75% UF solution was obtained by dissolving 37.5 mg UF (BDH Chemicals Ltd., Poole; UK) in 5 mL boiling water, and stabilized with 5 μL 5 M NaOH. Grids were rinsed for 45 sec with 100 μL 20 mM Tris, 150 mM NaCl, pH 7.4 and blotted on filter paper. Five μL of sample was added to the grid, left for 45 sec and blotted off with a filter paper. The sample was washed twice with 100 μL H2O drops and blotted off after each
wash with a filter paper. Subsequently, the sample was stained for 3 sec with 100 μL 0.75% UF, transferred to another 100 μL drop of 0.75% UF and then stained for an additional 15 to 20 sec. Samples were visualized using a Jeol JEM 1230 transmission electron microscope operated at 60 kV accelerating voltage, and recorded with a Gatan Multiscan 791 CCD camera.
Conformational conversion of β2GPI
Conversion from the closed circular conformation of β2GPI to the open conformation was
performed in a Slide-A-Lyzer 3.5K MWCO dialysis cassette (Thermo Fisher) by dialysis against 20 mM Hepes containing 1.15 M NaCl, pH 11.5, for 48 hours at 4°C followed by dialysis with20 mM Hepes, 150 mM NaCl, pH 7.4. Conversion from the open conformation of β2GPI to the closed
conformation was achieved by dialysis against 20 mM Hepes, 150 mM NaCl, pH 3.4, for 48 hours at 4°C followed by dialysis against 20 mM Hepes, 150 mM NaCl, pH 7.4. Samples were concentrated to a final concentration of 1.0 mg/mL β2GPI with an Ultrafree-0.5 Centrifugal Filter
Unit (Millipore; Billerica, MA; USA). Samples were snapfrozen in liquid nitrogen and stored at -80°C for analysis. After subjection to electron microscopy, 300 randomly selected β2GPI
molecules per treatment were scored for their conformation.
Purification of anti-β2GPI antibodies from APS patients’ sera
Anti-β2GPI antibodies from APS patients’ sera were purified by applying sera, diluted 1:4 in
phosphate buffered saline (PBS), to a HiTrap Protein G column (GE Healthcare). Subsequently, the column was washed with 25 mL PBS and eluted with 25 mL 0.5 M acetic acid, pH 2.8. Eluted
samples were dialyzed against PBS and stored at -20°C for analysis. The patient plasmas used were positive for both lupus anticoagulant and anti-β2GPI antibodies and were not selected for
anti-domain I positivity. The presence of lupus anticoagulant and anti-β2GPI antibodies was
detected as described37. Patient samples were collected with approval of the local ethics
committee. Informed consent was obtained in accordance with the Declaration of Helsinki.
Immunosorbent assay of β2GPI
NUNC MaxiSorpTM High Protein-Binding Capacity ELISA plates (Nalge Nunc International,
Denmark) were coated with 1 µg/mL mouse monoclonal anti-domain IV of β2GPI (21B2) or with
1 µg/mL purified APS patient IgG antibodies by incubation in 50 mM carbonate buffer, pH 9.6, 100 µL in each well for 1 hour at room temperature (RT). After washing with 20 mM Tris, 150 mM NaCl and 0.1% Tween-20, pH 7.4 (wash buffer) the plates were blocked by the addition of 200 µL per well of 3% bovine serum albumin (Sigma) in 20 mM Tris, 150 mM NaCl, pH 7.4 (blocking buffer) for 1 hour at RT. After washing the wells three times with wash buffer, 100 µL of circular or open β2GPI (0 - 1 µg/mL in blocking buffer) or pooled normal plasma was added to
the wells and incubated for 1 hour at RT. Subsequently, after washing three times with wash buffer, 100 µL of peroxidase-conjugated anti-β2GPI antibodies (Affinity Biologicals Inc, Ancaster,
ON; Canada) (1 µg/mL in blocking buffer) was added to the wells and incubated for 1 hour at RT. After the removal of unbound antibodies by washing with wash buffer, peroxidase activity of the bound antibody was measured by addition of 100 µL per well of TMB substrate (Tebu-bio laboratories, Le-Perray-en-Yvelines, France). After 20 minutes, color development was stopped by adding an equal volume of 1.0 M sulphuric acid. The optical density was measured at 450nm with a spectrophotometer (Molecular Devices Ltd, Berkshire, UK).
Cardiolipin and β2GPI binding assay
Fifty µL of a solution of cardiolipin (20 μM) (Sigma) in Tris buffered saline (TBS) pH 7.4, was added to 96 well polyvinyl microtiter plates (Costar, Cambridge, MA; USA) and incubated overnight at 4°C. The plate was blocked by addition of 150 μL per well of 10% bovine serum albumin (Sigma) in TBS (blocking buffer) for 2 hours at 37°C. After washing the wells three times with TBS, 50 μL serial dilutions of closed and open β2GPI (0.4 – 50 μg/mL) was added to
the wells and incubated for 2 hours at 37°C. Subsequently, after washing three times with TBS, 50 μL of purified APS patient IgG antibodies (5 μg/mL in blocking buffer) was added to the wells and incubated for 1 hour at 37°C. After removal of the unbound patient antibodies, 50 μL goat anti-human IgG alkaline phosphatase conjugated antibodies (Invitrogen, Carlsbad, CA; USA), diluted 1:4000 in TBS, was added to the wells and incubated for 1 hour at 37°C. After washing three times with TBS, 50 µL per well of phosphatase substrate (Sigma) was added and color development was stopped after 30 minutes by addition of 50 µL per well 1.0 M sulphuric acid. The optical density was measured at 405nm.
Analysis of anticoagulant activity of β2GPI by aPTT
A diluted activated partial thromboplastin time (aPTT) clotting assay was used to analyze the anticoagulant activity of β2GPI. The aPTT was measured with Pathromtin SL and calcium chloride
reagents (Siemens Healthcare Diagnostics, Marburg; Germany). All coagulation measurements were carried out in a coagulometer (KC 10, Amelung, Lemgo; Germany). First, 80 μL of human pooled plasma (pool from more than 200 healthy volunteers) and 20 μL of β2GPI (final
concentration of 15 µg/mL) were incubated for 1 min at 37°C. Subsequently, 100 μL of Pathromtin SL reagent (five times diluted in Hepes buffer, pH 7.4) was added to the mixture and incubated for 3 min at 37°C. After the incubation, 100 μL of 25 mM CaCl2 was added and the
clotting time was recorded.
Protein digestion and MALDI-TOF MS
For detection of protected residues, equal amounts of open and circular β2GPI in 20 mM Hepes,
150 mM NaCl, pH 7.4, were incubated for 12 hours at 37˚C with 1:10 unmodified, sequence-grade trypsin (Roche Molecular Biochemicals), followed by reduction with 10 mM DTT (30 minutes at 37˚C) and alkylation of cysteines with 25 mM iodoacetamide (30 minutes at RT). For optimal peptide sequence coverage, the proteins were first incubated with 0.1% Rapigest (Waters, Milford, MA; USA) prior to digestion. This MS-compatible, acid cleavable detergent was then removed by acidification (0.5% TFA), followed by incubation at 37˚C for 30 minutes and centrifugation for 10 minutes at 13,000 x g. For MALDI analysis, the resulting peptide mixtures
were dried in a vacuum centrifuge and dissolved in 1% formic acid and 60% acetonitrile. Subsequently, peptides were mixed 1:1 (v/v) with a solution containing 52 mM α-cyano-4-hydroxycinnamic acid (Sigma) in 49% ethanol/49% acetonitrile/2% trifluoroacetic acid and 1 mM ammonium acetate. Prior to dissolving, the α-cyano-4-hydroxycinnamic acid was washed briefly with chilled acetone. The mixture was spotted on a MALDI target plate and allowed to dry at room temperature. Reflectron matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS) spectra were acquired on a Micromass M@LDI (Wythenshawe, Manchester; UK). The acquired peptide spectra were analyzed with Masslynx 3.5 (Micromass).
Peptide and sequence analysis by oMALDI- or LC-MS/MS
MALDI-TOF MS/MS peptide sequencing was performed using a QSTAR-XL equipped with an oMALDI interface (Applied Biosystems/MDS Sciex, Toronto, Canada). The generated peptide mixtures were also analyzed by LC-MS/MS as described38 with an Agilent 1100 series LC system
fitted with a nanoscale reversed-phase HPLC setup, coupled to a QSTAR-XL (Applied Biosystems/MDS Sciex). For peptide identification, MS/MS spectra were searched against the Swiss-Prot database with the online MASCOT (Matrixscience) search engine (both available at http://www.matrixscience.com). For relative comparison of peptide abundance, single MS spectra were acquired and deconvoluted using the BioAnalyst 1.1.5 extension to Analyst QS1.1 (Applied Biosystems).
Construction of individual domains of β2GPI
Human β2GPI cDNA (kindly provided by Dr. T. Kristensen from the University of Aarhus, Aarhus;
Denmark) was used for the construction of domains I, IV and V of β2GPI. cDNA was subcloned
into a PCR - Blunt II - TOPO vector (Invitrogen) and the separate domains were constructed with a set of two primers with BamHI and NotI restriction sites. For domain I the primers GGATCCGGACGGACCTGTCCCA-AGCC and GCGGCCGCTTATACTCTG-GGTGTACATTTCAGAGTG were used. For Domain IV the primers GGATCCAGGGAAGTAAAA-TGCCCATTCC and GCGGCCGC-AGATGCTTTACAACTTGGCATGG and for domain V GATCCGCATCTTGTAAAGTACCTGTGAAAAAAGC and GCGGCCGCTTAGCATGGCTTTACATCGG were used. The PCR product was cloned into a PCR - Blunt II - TOPO vector and sequence analysis was performed to confirm the sequence of domain I, IV and V. From this vector the PCR product was subcloned into the expression vector HisN-Tev (Promega, Madison, WI; USA).
Protein expression and purification
The individual domains were expressed in HEK293E cells and collected by elution from a Nickel-Sepharose column with a buffer containing 25 mM Tris, 500 mM NaCl and 500 mM imidazol, pH 8.2. Purification on size was performed with a Superdex 200 XK26 column (GE Healthcare). The different domains were more than 95% pure as was checked on a 4-15% SDS–PAA gel (GE Healthcare).
Surface plasmon resonance measurements
Surface Plasmon resonance analysis was performed with a BIAcore 2000 (GE Healthcare). Purified domain I was immobilized (150 RU) on an activated CM-5 sensor chip according to manufacturer’s instructions. Specific binding to the individual domains was corrected for non-specific binding to the deactivated control channel. The non-non-specific binding was 6 to 20% of total binding depending on the concentration. Recombinant domains IV and V in various protein concentrations in a buffer containing 20 mM Hepes, 150 mM NaCl, 20 µM ZnCl2, 0.0005%
Tween-20, pH 7.4 (flow buffer), was injected for 3 minutes at a flow rate of 30 μL/min. The dissociation was followed for a period of 5 minutes. Regeneration of the sensor chip was achieved by a 10 µL wash of 4 mM EDTA and subsequent equilibration with flow buffer.
REFERENCES
1. Giannakopoulos B, et al. Blood. 2009; 113: 985-994.
2. Galli M, et al. Lancet. 1990; 335: 1544-1547.
3. McNeil HP, et al. Proc Natl Acad Sci U S A. 1990; 87: 4120-4124. 4. Matsuura E, et al. Lancet. 1990;
336: 177-178.
5. Blank M, et al. Proc Natl Acad Sci U S A. 1991; 88: 3069-3073.
6. Jankowski M, et al. Blood. 2003; 101: 157-162.
7. Pierangeli SS, et al. Circulation. 1999; 99: 1997-2002.
8. Lozier J, et al. Proc Natl Acad Sci U S A. 1984; 81: 3640-3644.
9. Bouma B, et al. EMBO J. 1999; 18: 5166-5174.
10. Hunt JE, et al. Proc Natl Acad Sci U S A. 1993; 90: 2141-2145.
11. Iverson GM, et al. Proc Natl Acad Sci U S A. 1998; 95: 15542-15546. 12. de Laat B, et al. Blood. 2006; 107:
1916-1924.
13. Ioannou Y, et al. J Thromb Haemost. 2009; 7: 833-842. 14. Miyakis S, et al. J Thromb Haemost.
2006; 4: 295-306.
15. Yamaguchi Y, et al. Blood. 2007; 110: 4312-4318.
16. Kuwana M, et al. Blood. 2005; 105: 1552-1557.
17. Biasiolo A, et al. Lupus. 1999; 8: 121-126.
18. Kaburaki J, et al. Lupus. 1995; 4: S27-31.
19. Schwarzenbacher R, et al. EMBO J. 1999; 18: 6228-6239.
20. Koike T, et al. Lupus. 1998; 7: S14-7.
21. Oosting JD, et al. Thromb Haemost. 1992; 67: 499-502
22. Willems GM, et al. Biochemistry. 1996; 35: 13833-13842.
23. Bozic B, et al. Autoimmun Rev. 2005;4(5):303-308.
24. Hammel M, et al. Biochemistry. 2001; 40: 14173-14181.
25. Schousboe I, et al. Thromb Haemost. 1995; 73: 798-804. 26. Brighton TA, et al. Br J Haematol.
1996; 93: 185-194.
27. Mori T, et al. Thromb Haemost. 1996; 75: 49-55.
28. Shi T, et al. Proc Natl Acad Sci U S A. 2004; 101: 3939-3944.
29. Arnout J, et al. Thromb Haemost. 1999; 81: 929-934.
30. Yasuda S, et al. Atherosclerosis. 2000; 152: 337-346.
31. Gamsjaeger R, et al. Biochem J. 2005; 389: 665-673.
32. Rand JH, et al. Blood. 2008; 112: 1687-1695.
33. van Genderen HO, et al. Biochim Biophys Acta. 2008; 1783: 953-963. 34. de Laat B, et al. Blood. 2007; 109:
1490-1494.
35. Kondo A, Miyamoto T, Yonekawa O et al. J Proteomics. 2009; 73: 123-133.
36. Engel J, et al. Methods Enzymol. 1987; 145: 3-78.
37. Urbanus RT, et al. Lancet Neurol. 2009; 8: 998-1005.
38. Kramer G, et al. Mol Cell Proteomics. 2009; 8: 1599-1611.
44
CHAPTER
4
β
2-GLYCOPROTEIN I:
A NOVEL PROTEIN IN INNATE IMMUNITY
Çetin Ağar, Flip de Groot, Matthias Mörgelin, Stephanie Monk, Gwen van Os, Han Levels, Bas de Laat, Rolf Urbanus, Heiko Herwald, Tom
van der Poll, Joost Meijers. Blood. 2011; 117(25): 6939-6947
ABSTRACT
Sepsis is a systemic host response to invasive infection by bacteria. Despite treatment with antibiotics, current mortality rates are in the range of 20-25%, which makes sepsis the most important cause of death in intensive care. Gram-negative bacteria are a prominent cause of sepsis. Lipopolysaccharide (LPS), one of the major constituents of the outer membrane of Gram-negative bacteria, plays a major role in activating the hosts’ immune response by binding to monocytes and other cells. A number of proteins are involved in neutralization and clearance of LPS from the bloodstream. Here we provide evidence that β2-Glycoprotein I (β2GPI) is a scavenger of LPS. In vitro, β2GPI inhibited LPS-induced expression of tissue factor and interleukin-6 from monocytes and endothelial cells. Binding of β2GPI to LPS caused a conformational change in β2GPI, which led to binding of the β2GPI-LPS complex to monocytes and ultimately clearance of this complex. Furthermore, plasma levels of β2GPI were inversely correlated with temperature rise and the response of inflammatory markers after a bolus injection of LPS in healthy individuals. Taken together, these observations provide evidence that β2GPI is involved in the neutralization and clearance of LPS and identify β2GPI as a component of innate immunity.
