The role of intracellular thyroid hormone metabolism in innate immune cells

(1)

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

van der Spek, A.H.

Publication date

2018

Document Version

Other version

License

Other

Link to publication

Citation for published version (APA):

van der Spek, A. H. (2018). The role of intracellular thyroid hormone metabolism in innate

immune cells.

General rights

It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)

and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open

content license (like Creative Commons).

Disclaimer/Complaints regulations

If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please

let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material

inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter

to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You

will be contacted as soon as possible.

(2)

516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek Processed on: 16-5-2018 Processed on: 16-5-2018 Processed on: 16-5-2018

Processed on: 16-5-2018 PDF page: 34PDF page: 34PDF page: 34PDF page: 34

ENZYME TYPE 3 DEIODINASE IS PRESENT

IN BACTERICIDAL GRANULES AND THE

CYTOPLASM OF HUMAN NEUTROPHILS

Anne H. van der Spek, Flavia F. Bloise, Wikky Tichgelaar, Monica Dentice,

Domenico Salvatore, Nicole N. van der Wel, Eric Fliers, Anita Boelen

Endocrinology 2016 Aug;157(8):3293-305

ENZYME TYPE 3 DEIODINASE IS PRESENT

IN BACTERICIDAL GRANULES AND THE

CYTOPLASM OF HUMAN NEUTROPHILS

Anne H. van der Spek, Flavia F. Bloise, Wikky Tichgelaar, Monica Dentice,

Domenico Salvatore, Nicole N. van der Wel, Eric Fliers, Anita Boelen

(3)

36

Abstract

Neutrophils are important effector cells of the innate immune system. Thyroid hormone is thought to play an important role in their function. Intracellular thyroid hormone levels are regulated by the deiodinating enzymes. The thyroid hormone inactivating type 3 deiodinase (D3) is expressed in infiltrating murine neutrophils and D3 knockout mice show impaired bacterial killing upon infection. This suggests that D3 plays an important role in the bacterial killing capacity of neutrophils. The mechanism behind this effect is unknown. We aimed to assess the presence of D3 in human neutrophils, and determine its subcellular localization using confocal and electron microscopy as this could give important clues about its function in these cells. D3 appeared to be present in the cytoplasm and in myeloperoxidase (MPO) containing azurophilic granules and as well as lactoferrin containing specific granules within human neutrophils. This subcellular localization did not change upon activation of the cells. D3 is observed intracellularly during neutrophil extracellular trap (NET) formation, followed by a reduction of D3 staining after release of the NETs into the extracellular space. At the transcriptional level, human neutrophils expressed additional essential elements of thyroid hormone metabolism, including thyroid hormone transporters and thyroid hormone receptors. Here we demonstrate the presence and subcellular location of D3 in human neutrophils for the first time and propose a model in which D3 plays a role in the bacterial killing capacity of neutrophils either through generation of iodide for the MPO system or through modulation of intracellular thyroid hormone bioavailability.

37

3 Introduction

Thyroid hormone metabolism is known to undergo profound changes during illness and infection, collectively known as non thyroidal illness syndrome (NTIS) (Docter et al., 1993, Boelen et al., 2011). These changes are characterized by low serum triiodothyronine (T₃) and, in prolonged illness, low serum thyroxine (T₄) concentrations (Bello et al., 2010, Gangemi et al., 2008). NTIS is present in a wide range of diseases including critical illness (Bello et al., 2010), myocardial infarction (Lazzeri et al., 2012, Ozcan et al., 2014), Crohn’s disease (Liu et al., 2013b) and stroke (Alevizaki et al., 2007) and is correlated with both disease severity and outcome. Besides alterations in systemic thyroid hormone (TH) levels, NTIS is also known to affect TH metabolism at the tissue and cellular level, resulting in changes in local T₃ concentration (Boelen et al., 2011). One of the cell types in which TH metabolism appears to play a role during infection is neutrophils (Boelen et al., 2005).

Neutrophils are important effector cells of the innate immune system that phagocytose and kill bacteria and other pathogens. They are the most abundant type of blood leukocyte and, as the first cells to arrive at the site of infection, a key component of the inflammatory response (Bardoel et al., 2014, Borregaard, 2010, Kolaczkowska and Kubes, 2013). Research from the 1970s has shown that phagocytosing human leukocytes can actively degrade significant amounts of TH, both T₃ and T₄ (Woeber and Ingbar, 1973, Woeber et al., 1972, Klebanoff and Green, 1973). The mechanism behind this is not fully understood. TH can be metabolized by the deiodinase enzymes. Deiodinases regulate the availability of biologically active TH at the cellular and tissue level by removing an iodine atom from the TH molecule, resulting in the production of free iodide (I-_{) (Bianco and Kim, 2006, Bianco et al., 2002). The activating deiodinases} types 1 and 2 convert the prohormone T₄ to the active hormone T₃ while the TH inactivating deiodinase type 3 (D3) is responsible for the intracellular conversion of T₃ and T₄ to the biologically inactive diiodothyronine (T₂) and reverse (r)T₃ respectively. The expression of the different types of deiodinases is cell type specific (Bianco and Kim, 2006, Bianco et al., 2002).

Various mouse models have suggested that D3 plays a role in neutrophils during infection and inflammation. Infiltrating neutrophils in sections of inflamed lung from mice with pulmonary infection with Streptococcus pneumoniae markedly expressed D3 protein (Boelen et al., 2008). Furthermore, in a model for chronic local inflammation in which mice were subcutaneously injected with turpentine resulting in a sterile abscess, infiltrating neutrophils showed strong D3 protein expression while D3 activity was significantly increased in hind limb tissue containing the abscess compared to control tissue (Boelen et al., 2005). Finally, D3 knockout mice showed impaired bacterial killing following Streptococcus pneumoniae infection compared to wildtype mice (Boelen et al., 2009). These results suggest that D3 plays an important role in the bacterial killing capacity of neutrophils.

Although D3 is known to be present in infiltrating murine neutrophils, its presence in human neutrophils has not been previously studied. Furthermore, nothing is currently known on its subcellular location in neutrophils. The location of D3 within the cell could give important clues as to its functional role. We aimed to determine the presence and subcellular location of D3 in resting and activated human

(4)

36

Abstract

Neutrophils are important effector cells of the innate immune system. Thyroid hormone is thought to play an important role in their function. Intracellular thyroid hormone levels are regulated by the deiodinating enzymes. The thyroid hormone inactivating type 3 deiodinase (D3) is expressed in infiltrating murine neutrophils and D3 knockout mice show impaired bacterial killing upon infection. This suggests that D3 plays an important role in the bacterial killing capacity of neutrophils. The mechanism behind this effect is unknown. We aimed to assess the presence of D3 in human neutrophils, and determine its subcellular localization using confocal and electron microscopy as this could give important clues about its function in these cells. D3 appeared to be present in the cytoplasm and in myeloperoxidase (MPO) containing azurophilic granules and as well as lactoferrin containing specific granules within human neutrophils. This subcellular localization did not change upon activation of the cells. D3 is observed intracellularly during neutrophil extracellular trap (NET) formation, followed by a reduction of D3 staining after release of the NETs into the extracellular space. At the transcriptional level, human neutrophils expressed additional essential elements of thyroid hormone metabolism, including thyroid hormone transporters and thyroid hormone receptors. Here we demonstrate the presence and subcellular location of D3 in human neutrophils for the first time and propose a model in which D3 plays a role in the bacterial killing capacity of neutrophils either through generation of iodide for the MPO system or through modulation of intracellular thyroid hormone bioavailability.

37

3 Introduction

Thyroid hormone metabolism is known to undergo profound changes during illness and infection, collectively known as non thyroidal illness syndrome (NTIS) (Docter et al., 1993, Boelen et al., 2011). These changes are characterized by low serum triiodothyronine (T₃) and, in prolonged illness, low serum thyroxine (T₄) concentrations (Bello et al., 2010, Gangemi et al., 2008). NTIS is present in a wide range of diseases including critical illness (Bello et al., 2010), myocardial infarction (Lazzeri et al., 2012, Ozcan et al., 2014), Crohn’s disease (Liu et al., 2013b) and stroke (Alevizaki et al., 2007) and is correlated with both disease severity and outcome. Besides alterations in systemic thyroid hormone (TH) levels, NTIS is also known to affect TH metabolism at the tissue and cellular level, resulting in changes in local T₃ concentration (Boelen et al., 2011). One of the cell types in which TH metabolism appears to play a role during infection is neutrophils (Boelen et al., 2005).

Neutrophils are important effector cells of the innate immune system that phagocytose and kill bacteria and other pathogens. They are the most abundant type of blood leukocyte and, as the first cells to arrive at the site of infection, a key component of the inflammatory response (Bardoel et al., 2014, Borregaard, 2010, Kolaczkowska and Kubes, 2013). Research from the 1970s has shown that phagocytosing human leukocytes can actively degrade significant amounts of TH, both T₃ and T₄ (Woeber and Ingbar, 1973, Woeber et al., 1972, Klebanoff and Green, 1973). The mechanism behind this is not fully understood. TH can be metabolized by the deiodinase enzymes. Deiodinases regulate the availability of biologically active TH at the cellular and tissue level by removing an iodine atom from the TH molecule, resulting in the production of free iodide (I-_{) (Bianco and Kim, 2006, Bianco et al., 2002). The activating deiodinases} types 1 and 2 convert the prohormone T₄ to the active hormone T₃ while the TH inactivating deiodinase type 3 (D3) is responsible for the intracellular conversion of T₃ and T₄ to the biologically inactive diiodothyronine (T₂) and reverse (r)T₃ respectively. The expression of the different types of deiodinases is cell type specific (Bianco and Kim, 2006, Bianco et al., 2002).

Various mouse models have suggested that D3 plays a role in neutrophils during infection and inflammation. Infiltrating neutrophils in sections of inflamed lung from mice with pulmonary infection with Streptococcus pneumoniae markedly expressed D3 protein (Boelen et al., 2008). Furthermore, in a model for chronic local inflammation in which mice were subcutaneously injected with turpentine resulting in a sterile abscess, infiltrating neutrophils showed strong D3 protein expression while D3 activity was significantly increased in hind limb tissue containing the abscess compared to control tissue (Boelen et al., 2005). Finally, D3 knockout mice showed impaired bacterial killing following Streptococcus pneumoniae infection compared to wildtype mice (Boelen et al., 2009). These results suggest that D3 plays an important role in the bacterial killing capacity of neutrophils.

Although D3 is known to be present in infiltrating murine neutrophils, its presence in human neutrophils has not been previously studied. Furthermore, nothing is currently known on its subcellular location in neutrophils. The location of D3 within the cell could give important clues as to its functional role. We aimed to determine the presence and subcellular location of D3 in resting and activated human

(5)

38

neutrophils to provide important insights into the role of local TH metabolism in the bacterial killing machinery of these essential cells of the innate immune system.

Material and Methods

Neutrophil isolation

Venous blood was obtained from healthy male and female volunteers following written informed consent. This study was approved by the local medical ethical committee of the Academic Medical Center of the University of Amsterdam in accordance with the principles of the Declaration of Helsinki (version Fortaleza, 2013).

Neutrophils were isolated as described previously (Kuijpers et al., 1991, Roos and de Boer, 1986, Roos et al., 2014). Neutrophils were suspended in HEPES buffered medium (Roos et al., 2014) and kept at room temperature (RT) until use. Cell count and viability was assessed using trypan blue. Neutrophil purity was assessed by flow cytometry staining for CD16 (neutrophils) and CD49d (eosinophils) and was always at least 90%.

Neutrophil stimulation

Neutrophils were incubated with stimuli in a shaking water bath at 37⁰C for 15 minutes. Phorbol myristate acetate (PMA) (Sigma-Aldrich) was stored as a stock solution in DMSO and diluted in HEPES-medium at least 1000x immediately prior to use. Zymosan (Sigma-Aldrich) was opsonized with human serum and added to cells at a ratio of 20 particles per cell. Neutrophil extracellular traps (NETs) were generated and visualized as described in Brinkmann et al. (Brinkmann et al., 2010). Briefly, neutrophils were allowed to adhere to glass coverslips after which they were stimulated with PMA for up to 3 hours in a 37⁰C incubator with 5% CO2. Coverslips were then stained and imaged as described under Confocal Microscopy.

Western Blot

Cell lysates of freshly isolated unstimulated neutrophils were produced as previously described (Roos et al., 2014). Lysates were stored at -20⁰C until use. Cell lysates were loaded on a 10% SDS-PAGE gel. Gels were blotted on to PVDF membrane and processed as described previously (de Vries et al., 2014b). Primary antibodies used were polyclonal rabbit anti-D3 #676 (dilution 1:500, kindly provided by prof. dr. T.J.Visser, Erasmus Medical Center, Rotterdam, the Netherlands) and polyclonal goat anti-actin I-19 (dilution 1:5000; Santa Cruz Biotechnology). The #676 D3 antibody was raised against the synthetic peptide (C)RYDEQLHGARPRRV (human D3 amino acid residues 265–278) (Kuiper et al., 2003). Secondary antibodies were horseradish peroxidase-conjugated goat-anti-rabbit (1:10,000) and rabbit-anti-goat (1:20,000) antibodies (Dako). 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek Processed on: 16-5-2018 Processed on: 16-5-2018 Processed on: 16-5-2018

39

3

Confocal Microscopy

Freshly isolated neutrophils were fixed with 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS) at RT for 10 minutes. Cells were blocked with 10% normal goat serum (Abcam) and human FC receptor block (BD Biosciences) in saponin buffer (0,5% [wt/vol] saponin and 0,5% [wt/vol] bovine serum albumin in PBS) for 15 minutes. Neutrophils were incubated for 1 hour at RT with primary antibodies in saponin buffer followed by incubation with appropriate secondary antibodies in saponin buffer for 30 minutes at RT. The stained cell suspension was mounted on a glass slide with Prolong Gold antifade reagent with DAPI (Life Technologies). Slides were imaged by a confocal laser-scanning system (Leica TCS SP8 X) using the Leica DMI6000 inverted microscope and the 63x/1.40 Oil CS2 objective. Images were analyzed using the Leica LAS X software (version 1.1).

The primary D3 antibody used was #718 (dilution 1:500), raised against the synthetic peptide KPEPEVELNSEGEEVP (human D3 amino acid residues 53-68) (Huang et al., 2003). Other primary antibodies used were anti-EEA1 (1:300, BD Biosciences), FITC-conjugated anti-myeloperoxidase (dilution 1:12.5, clone CLB-MPO-1/1, Novus Biologicals), anti-Lactoferrin (1:500, clone 2B8, Abcam), anti-matrix metallopeptidase 9 (1:75, clone 56-2A4, Abcam) and anti-human albumin (1:500, clone HSA-9, Sigma-Aldrich). Secondary antibodies used were Alexa Fluor 568-conjugated goat-anti-rabbit and/or Alexa Fluor 647-conjugated goat-anti-mouse IgG1 (1:500; both Life Technologies). All stainings included a control without primary antibody to assess background staining.

To assess the specificity of D3 staining, the #718 antibody was preincubated with the corresponding peptide. This resulted in the disappearance of all D3 staining (Supplemental Figure 3.1 A-B), supporting the specificity of the staining. The #718 antibody also gave clear staining of SK-N-AS cells, a human neuroblastoma cell line known to contain D3 (Supplemental Figure 3.1 C-D) (Jo et al., 2012, Freitas et al., 2010). The SK-N-AS cell line was a kind gift of dr. F. Ponds (Dept. of Gastroenterology, Academic Medical Center, Amsterdam) and was cultured as described previously (Freitas et al., 2010).

Electron Microscopy

Isolated neutrophils were incubated in a 37⁰C shaking water bath (5x106_{cells/tube) for 15 minutes} with PMA (20ng/ml), serum opsonized zymosan or no stimulus. After stimulation samples were fixed and processed as described in van der Wel et al. (van der Wel et al., 2007). In short: following fixation in 2% PFA for 24 hours, samples were pelleted in 12% gelatin, cut in 2-3 mm2_{blocks and incubated in} 2.3M sucrose overnight. Blocks were snap frozen in liquid nitrogen and 60 nm thick sections were cut at -120⁰C using the Leica microtome UC6 with cryochamber Ultracut EM FC6 and a diamond cryo-immuno knife (35° Diatome). Immunogold labelling was performed using primary antibodies anti-D3 (#718; 1:25), polyclonal rabbit anti-MPO (1:14.000; Dako) and anti-Lactoferrin (1:200; Cappel Laboratories) and 10 or 15 nm gold labelled protein (Aurion) or with rabbit anti-mouse bridging serum (1:200; Dako) and protein-A-conjugated to 10 nm or 15 nm gold (Utrecht University, the Netherlands). Immunogold labelled grids were analyzed using a Tecnai 12 with 2k×2k CCD Camera (Veleta, Olympus).

(6)

38

neutrophils to provide important insights into the role of local TH metabolism in the bacterial killing machinery of these essential cells of the innate immune system.

Material and Methods

Neutrophil isolation

Venous blood was obtained from healthy male and female volunteers following written informed consent. This study was approved by the local medical ethical committee of the Academic Medical Center of the University of Amsterdam in accordance with the principles of the Declaration of Helsinki (version Fortaleza, 2013).

Neutrophils were isolated as described previously (Kuijpers et al., 1991, Roos and de Boer, 1986, Roos et al., 2014). Neutrophils were suspended in HEPES buffered medium (Roos et al., 2014) and kept at room temperature (RT) until use. Cell count and viability was assessed using trypan blue. Neutrophil purity was assessed by flow cytometry staining for CD16 (neutrophils) and CD49d (eosinophils) and was always at least 90%.

Neutrophil stimulation

Neutrophils were incubated with stimuli in a shaking water bath at 37⁰C for 15 minutes. Phorbol myristate acetate (PMA) (Sigma-Aldrich) was stored as a stock solution in DMSO and diluted in HEPES-medium at least 1000x immediately prior to use. Zymosan (Sigma-Aldrich) was opsonized with human serum and added to cells at a ratio of 20 particles per cell. Neutrophil extracellular traps (NETs) were generated and visualized as described in Brinkmann et al. (Brinkmann et al., 2010). Briefly, neutrophils were allowed to adhere to glass coverslips after which they were stimulated with PMA for up to 3 hours in a 37⁰C incubator with 5% CO2. Coverslips were then stained and imaged as described under Confocal Microscopy.

Western Blot

Cell lysates of freshly isolated unstimulated neutrophils were produced as previously described (Roos et al., 2014). Lysates were stored at -20⁰C until use. Cell lysates were loaded on a 10% SDS-PAGE gel. Gels were blotted on to PVDF membrane and processed as described previously (de Vries et al., 2014b). Primary antibodies used were polyclonal rabbit anti-D3 #676 (dilution 1:500, kindly provided by prof. dr. T.J.Visser, Erasmus Medical Center, Rotterdam, the Netherlands) and polyclonal goat anti-actin I-19 (dilution 1:5000; Santa Cruz Biotechnology). The #676 D3 antibody was raised against the synthetic peptide (C)RYDEQLHGARPRRV (human D3 amino acid residues 265–278) (Kuiper et al., 2003). Secondary antibodies were horseradish peroxidase-conjugated goat-anti-rabbit (1:10,000) and rabbit-anti-goat (1:20,000) antibodies (Dako). 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek Processed on: 16-5-2018 Processed on: 16-5-2018 Processed on: 16-5-2018

39

3

Confocal Microscopy

Freshly isolated neutrophils were fixed with 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS) at RT for 10 minutes. Cells were blocked with 10% normal goat serum (Abcam) and human FC receptor block (BD Biosciences) in saponin buffer (0,5% [wt/vol] saponin and 0,5% [wt/vol] bovine serum albumin in PBS) for 15 minutes. Neutrophils were incubated for 1 hour at RT with primary antibodies in saponin buffer followed by incubation with appropriate secondary antibodies in saponin buffer for 30 minutes at RT. The stained cell suspension was mounted on a glass slide with Prolong Gold antifade reagent with DAPI (Life Technologies). Slides were imaged by a confocal laser-scanning system (Leica TCS SP8 X) using the Leica DMI6000 inverted microscope and the 63x/1.40 Oil CS2 objective. Images were analyzed using the Leica LAS X software (version 1.1).

The primary D3 antibody used was #718 (dilution 1:500), raised against the synthetic peptide KPEPEVELNSEGEEVP (human D3 amino acid residues 53-68) (Huang et al., 2003). Other primary antibodies used were anti-EEA1 (1:300, BD Biosciences), FITC-conjugated anti-myeloperoxidase (dilution 1:12.5, clone CLB-MPO-1/1, Novus Biologicals), anti-Lactoferrin (1:500, clone 2B8, Abcam), anti-matrix metallopeptidase 9 (1:75, clone 56-2A4, Abcam) and anti-human albumin (1:500, clone HSA-9, Sigma-Aldrich). Secondary antibodies used were Alexa Fluor 568-conjugated goat-anti-rabbit and/or Alexa Fluor 647-conjugated goat-anti-mouse IgG1 (1:500; both Life Technologies). All stainings included a control without primary antibody to assess background staining.

To assess the specificity of D3 staining, the #718 antibody was preincubated with the corresponding peptide. This resulted in the disappearance of all D3 staining (Supplemental Figure 3.1 A-B), supporting the specificity of the staining. The #718 antibody also gave clear staining of SK-N-AS cells, a human neuroblastoma cell line known to contain D3 (Supplemental Figure 3.1 C-D) (Jo et al., 2012, Freitas et al., 2010). The SK-N-AS cell line was a kind gift of dr. F. Ponds (Dept. of Gastroenterology, Academic Medical Center, Amsterdam) and was cultured as described previously (Freitas et al., 2010).

Electron Microscopy

Isolated neutrophils were incubated in a 37⁰C shaking water bath (5x106_{cells/tube) for 15 minutes} with PMA (20ng/ml), serum opsonized zymosan or no stimulus. After stimulation samples were fixed and processed as described in van der Wel et al. (van der Wel et al., 2007). In short: following fixation in 2% PFA for 24 hours, samples were pelleted in 12% gelatin, cut in 2-3 mm2_{blocks and incubated in} 2.3M sucrose overnight. Blocks were snap frozen in liquid nitrogen and 60 nm thick sections were cut at -120⁰C using the Leica microtome UC6 with cryochamber Ultracut EM FC6 and a diamond cryo-immuno knife (35° Diatome). Immunogold labelling was performed using primary antibodies anti-D3 (#718; 1:25), polyclonal rabbit anti-MPO (1:14.000; Dako) and anti-Lactoferrin (1:200; Cappel Laboratories) and 10 or 15 nm gold labelled protein (Aurion) or with rabbit anti-mouse bridging serum (1:200; Dako) and protein-A-conjugated to 10 nm or 15 nm gold (Utrecht University, the Netherlands). Immunogold labelled grids were analyzed using a Tecnai 12 with 2k×2k CCD Camera (Veleta, Olympus).

(7)

40

their immunogold labelling. Granules were scored as either negative, MPO or LF positive, D3 positive or double positive for D3 and either MPO or LF. A total of 1880 granules were scored in sections double stained for D3 and LF. Granules were only considered positive for LF if they contained at least 2 gold grains. In sections double stained for MPO and D3 a total 678 granules were scored. All scoring was performed by the same person.

Figure 3.1. D3 is present in human neutrophils. (A) Western Blot for D3 (antibody #676) and Beta Actin in whole

cell lysate of unstimulated human neutrophils. (B) Confocal microscopy images of freshly isolated human neutrophils using the differential interference contrast (DIC) setting. (C-D) Human neutrophils show intracellular D3 staining (shown in red; antibody #718 with Alexa Fluor 568-conjugated secondary antibody) in both the cytoplasm and small vesicle-like structures distributed throughout the cytoplasm and in close proximity to the nucleus. Cell nuclei are stained with DAPI (shown in blue). Scale bars are 25 µm (B; C) or 3 µm (D) in length. Stainings were repeated in at least 3 separate donors, representative images are shown.

Flow Cytometry

Neutrophils were incubated in ice cold FACS buffer (PBS with 5% heat-inactivated fetal calf serum (FCS) and 0,5% [wt/vol] sodium azide) with human FC block (eBioscience) for 20 minutes at 4°C. Cells were then either stained directly or fixed and permeabilized first using the eBioscience Intracellular Fixation & Permeabilization Buffer Set_{. Staining with primary antibodies was performed for 30 minutes at 4°C,} followed by staining with secondary antibody for 30 minutes at 4°C. A total of 100,000 events was acquired using a BD FACS Canto II flow cytometer and data was analyzed using FlowJo software (v.10). Viable CD16+CD49- cells were selected for analysis of D3 staining.

41

3

Antibodies used were anti human APC-eFluor780-conjugated CD16 (1:100), anti-human PE-conjugated CD49d (1:100) (both eBioscience) and anti-D3 (#718; 1:250) with Alexa Fluor 647- conjugated donkey anti rabbit (1:250, Biolegend). Cell viability was determined using propidium iodide or fixable viability dye (eFluor 520-conjugated), both from eBioscience.

RNA isolation, cDNA synthesis and qualitative PCR

Neutrophils were lysed in Trizol-Reagent (Life Technologies) at 5x106_{cells/ml. RNA was isolated using} the Nucleospin RNA extraction kit (Machery Nagel). RNA yield was determined using the Nanodrop 2000 and quality was checked on the Bioanalyzer 2100 (Agilent Technologies). cDNA was synthesized with equal RNA input (150 ng) using AMV Reverse Transcriptase enzyme with oligo d(T) primers (Roche). As a control for genomic DNA contamination, a cDNA synthesis reaction without reverse transcriptase was included. Qualitative PCR was carried out using the Lightcycler 480 (Roche) and SensiFAST SYBR No-ROX_{(Bioline). Following amplification, PCR products were analyzed on DNA agarose gel and visualized} on the ImageQuant LAS4000 (GE Healthcare). Published primer sequences were used for all genes (Bakker, 2001, Chan et al., 2006, Kwakkel et al., 2014, Kwakkel et al., 2006, Silva et al., 2002) except SLC16A10 for which primers were obtained from the Harvard Primer Bank (no. 221139821c1). Primer sequences and amplicon lengths are listed in Table 3.1.

Gene Protein Forward primer Reverse primer Amplicon _{length (bp)} Source

Dio1 D3 AGCCACGACAACTGGATACC ACTCCCAAATGTTGCACCTC 160 Kwakkel et al; ₂₀₀₆27

Dio2 D2 CCTCCTCGATGCCTACAAAC TCCTTCTGTACTGGAGACATGC

82 (trans. var. 1&2); 190 (trans. var. 3); 324 (trans. var. 4) 216 (trans. var.5) Kwakkel et al; 201426

Dio3 D1 AACTCCGAGGTGGTTCTGC TTGCGCGTAGTCGAGGAT 60 Kwakkel et al; ₂₀₁₄26

SL-C16A2 MCT8 CAACGCACTTACCGCATCTG GTAGCCCCAATACACACCAAGAG 146 Chan et al; 200625

SL-C16A10 MCT10 ATGCTGGAAACCTTCGGCTC TGAAGACGCTGACTATTGGGC 115

Harvard Primer Bank no. 221139821c1

THRA1 TRα1 CATCTTTGAACTGGGCAAGT CTGAGGCTTTAGACTTCCTGATC 348 Bakker; 200124

THRA2 TRα2 CATCTTTGAACTGGGCAAGT GACCCTGAACAACATGCATT 337 Bakker; 200124

THRB1 TRβ1 AAGTGCCCAGACCTTCCAAA AAAGAAACCCTTGCAGCCTTC 151 Silva et al;

200223

(8)

40

their immunogold labelling. Granules were scored as either negative, MPO or LF positive, D3 positive or double positive for D3 and either MPO or LF. A total of 1880 granules were scored in sections double stained for D3 and LF. Granules were only considered positive for LF if they contained at least 2 gold grains. In sections double stained for MPO and D3 a total 678 granules were scored. All scoring was performed by the same person.

Figure 3.1. D3 is present in human neutrophils. (A) Western Blot for D3 (antibody #676) and Beta Actin in whole

cell lysate of unstimulated human neutrophils. (B) Confocal microscopy images of freshly isolated human neutrophils using the differential interference contrast (DIC) setting. (C-D) Human neutrophils show intracellular D3 staining (shown in red; antibody #718 with Alexa Fluor 568-conjugated secondary antibody) in both the cytoplasm and small vesicle-like structures distributed throughout the cytoplasm and in close proximity to the nucleus. Cell nuclei are stained with DAPI (shown in blue). Scale bars are 25 µm (B; C) or 3 µm (D) in length. Stainings were repeated in at least 3 separate donors, representative images are shown.

Flow Cytometry

Neutrophils were incubated in ice cold FACS buffer (PBS with 5% heat-inactivated fetal calf serum (FCS) and 0,5% [wt/vol] sodium azide) with human FC block (eBioscience) for 20 minutes at 4°C. Cells were then either stained directly or fixed and permeabilized first using the eBioscience Intracellular Fixation & Permeabilization Buffer Set_{. Staining with primary antibodies was performed for 30 minutes at 4°C,} followed by staining with secondary antibody for 30 minutes at 4°C. A total of 100,000 events was acquired using a BD FACS Canto II flow cytometer and data was analyzed using FlowJo software (v.10). Viable CD16+CD49- cells were selected for analysis of D3 staining.

41

3

Antibodies used were anti human APC-eFluor780-conjugated CD16 (1:100), anti-human PE-conjugated CD49d (1:100) (both eBioscience) and anti-D3 (#718; 1:250) with Alexa Fluor 647- conjugated donkey anti rabbit (1:250, Biolegend). Cell viability was determined using propidium iodide or fixable viability dye (eFluor 520-conjugated), both from eBioscience.

RNA isolation, cDNA synthesis and qualitative PCR

Neutrophils were lysed in Trizol-Reagent (Life Technologies) at 5x106_{cells/ml. RNA was isolated using} the Nucleospin RNA extraction kit (Machery Nagel). RNA yield was determined using the Nanodrop 2000 and quality was checked on the Bioanalyzer 2100 (Agilent Technologies). cDNA was synthesized with equal RNA input (150 ng) using AMV Reverse Transcriptase enzyme with oligo d(T) primers (Roche). As a control for genomic DNA contamination, a cDNA synthesis reaction without reverse transcriptase was included. Qualitative PCR was carried out using the Lightcycler 480 (Roche) and SensiFAST SYBR No-ROX_{(Bioline). Following amplification, PCR products were analyzed on DNA agarose gel and visualized} on the ImageQuant LAS4000 (GE Healthcare). Published primer sequences were used for all genes (Bakker, 2001, Chan et al., 2006, Kwakkel et al., 2014, Kwakkel et al., 2006, Silva et al., 2002) except SLC16A10 for which primers were obtained from the Harvard Primer Bank (no. 221139821c1). Primer sequences and amplicon lengths are listed in Table 3.1.

Gene Protein Forward primer Reverse primer Amplicon _{length (bp)} Source

Dio1 D3 AGCCACGACAACTGGATACC ACTCCCAAATGTTGCACCTC 160 Kwakkel et al; ₂₀₀₆27

Dio2 D2 CCTCCTCGATGCCTACAAAC TCCTTCTGTACTGGAGACATGC

82 (trans. var. 1&2); 190 (trans. var. 3); 324 (trans. var. 4) 216 (trans. var.5) Kwakkel et al; 201426

Dio3 D1 AACTCCGAGGTGGTTCTGC TTGCGCGTAGTCGAGGAT 60 Kwakkel et al; ₂₀₁₄26

SL-C16A2 MCT8 CAACGCACTTACCGCATCTG GTAGCCCCAATACACACCAAGAG 146 Chan et al; 200625

SL-C16A10 MCT10 ATGCTGGAAACCTTCGGCTC TGAAGACGCTGACTATTGGGC 115

Harvard Primer Bank no. 221139821c1

THRA1 TRα1 CATCTTTGAACTGGGCAAGT CTGAGGCTTTAGACTTCCTGATC 348 Bakker; 200124

THRA2 TRα2 CATCTTTGAACTGGGCAAGT GACCCTGAACAACATGCATT 337 Bakker; 200124

THRB1 TRβ1 AAGTGCCCAGACCTTCCAAA AAAGAAACCCTTGCAGCCTTC 151 Silva et al;

200223

(9)

42

Results

Type 3 deiodinase is present in the cytosol and in granules of human neutrophils

Whole cell lysates of unstimulated freshly isolated human neutrophils expressed D3 protein as shown by a clear band at 37kD (Figure 3.1A). Confocal microscopy was used to elucidate the subcellular location of D3 in unstimulated human neutrophils. Both diffuse cytoplasmic D3 staining and D3 staining in small intracellular vesicles was seen. D3 did not appear to be present on the plasma membrane (Figure 3.1

B-D). In unstimulated human neutrophils, flow cytometric analysis of D3 expression in unpermeabilized

cells showed fluorescence levels similar to control cells incubated without primary antibody, indicating no D3 surface expression (Figure 3.2A). Permeabilized neutrophils showed strong D3 expression (Figure

3.2A-B), confirming the intracellular location of D3 in these cells.

Figure 3.2. D3 expression measured by flow cytometry. D3 expression following cell surface

staining and intracellular staining in freshly isolated unstimulated human neutrophils measured by flow cytometry. (A) Representative histograms are shown. The dotted line represents the degree of background staining in unpermeabilized cells stained with only fluorescently labelled secondary antibody in the total cell population. The black line represents D3 expression in unpermeabilized live CD16+CD49- human neutrophils (antibody #718 with AlexaFluor 568-conjugated secondary antibody). The filled gray histogram represents D3 expression in fixed and permeabilized live CD16+CD49- human neutrophils. (B) Median fluorescence intensity for D3 staining in live CD16+CD49- human neutrophils after cell surface staining (Surface) and following fixation, permeabilization and intracellular staining (Intracellular). Total data is shown from two separate experiments with different donors.

D3 colocalizes with lactoferrin and myeloperoxidase in intracellular granules, but not with early endosomes

In order to determine the type of intracellular vesicles that stained positive for D3 we performed a series of double-stainings using confocal microscopy. D3 is known to be present in early endosomes in certain cell types (Baqui et al., 2003). Therefore we performed a double-staining for D3 and Early Endosome Antigen 1 (EEA1). The granules in which D3 is located were clearly different in size and amount compared to early endosomes and there was no colocalization between the two markers

(Figure 3.3). 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek 516644-L-bw-spek Processed on: 16-5-2018 Processed on: 16-5-2018 Processed on: 16-5-2018

43

3

Figure 3.3. Colocalization of D3 with granule markers. Confocal microscopy images of freshly isolated human

neutrophils show double immunostaining for D3 (shown in red; antibody #718 with Alexa Fluor 568-conjugated secondary antibody) with early endosome antigen 1 (EEA1) and markers for neutrophil granule subsets: myeloperoxidase (MPO; FITC-labelled), lactoferrin (LF), matrix metallopeptidase 9 (MMP9) and human serum albumin (HSA), all shown in green. All antibodies besides D3 and MPO were stained with an Alexa Fluor 647-conjugated secondary antibody. Enlarged images of areas indicated with a white box are shown in the right-hand column. Colocalization between D3 and other markers is visible as yellow and indicated with white arrows in the enlarged images. Red arrows indicate granules without colocalization. Scale bars are 3 µm in length. Stainings were repeated in at least 3 separate donors with similar results, representative images from 1 donor are shown.

Human neutrophils contain several subsets of granules with proteins that are critical for their bactericidal function. Upon activation of the cell these granules are mobilized sequentially, and fuse

(10)