UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)
UvA-DARE (Digital Academic Repository)
The role of C-type lectin receptors in human skin immunity: immunological
interactions between dendritic cells, Langerhans cells and keratinocytes
van den Berg, L.M.
Publication date
2013
Link to publication
Citation for published version (APA):
van den Berg, L. M. (2013). The role of C-type lectin receptors in human skin immunity:
immunological interactions between dendritic cells, Langerhans cells and keratinocytes.
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.
CHAPTER 6
H
YALURONIDASES
REGULATE
DYNAMIC
CELLULAR
INTERACTIONS
AND
MIGRATION
OF
HUMAN
L
ANGERHANS
CELLS
Manuscript in preparation
Linda M. van den Berg
Esther M. Zijlstra-Willems
Teunis B.H. Geijtenbeek
6
A
BSTRACTEpidermal Langerhans cells (LCs) express the C-type lectin receptor langerin that is an adhesion receptor for hyaluronic acid (HA). HA is expressed by epidermal keratinocytes (KCs) and here we investigated whether langerin mediates interactions with KCs and how these interactions are regulated. LCs interacted with KCs through langerin-HA. Notably, loss of HA on KCs induced LC migration in an ex vivo skin culture model, suggesting that langerin-HA interactions control LC localization and migration. Maturation of LCs, led to upregulation of hyaluronidase-1 (hyal-1) and hyal-2, which cleaved HA and enabled LC migration. Hyaluronidase upregulation is a general mechanism to regulate langerin interactions since hyal-2 upregulation in dendritic cells (DCs) after LC-DC clustering cleaved HA from the DC surface and decreased LC-DC interaction. Th us, our data show that langerin-HA interaction controls the localization of LCs, and that hyaluronidases regulate dynamic cellular interactions. Vaccination strategies inducing hyaluronidase expression in epidermis could facilitate LC maturation and migration and might enhance immunogenicity.
I
NTRODUCTIONLangerhans cells (LCs) are professional antigen presenting cells residing in close proximity of keratinocytes (KCs) in human epidermis. LCs act as sentinels of the immune system and sample the surrounding for intruding pathogens, which are captured and subsequently, antigens are presented by LCs to T cells in the lymph nodes 1. In the
epidermis, LCs interact with KCs via E-cadherin/E-cadherin adherence junctions 2.
However, the homophilic E-cadherin interaction between LCs and KCs turned out to be dispensable for LC maintenance in the epidermis 31. Th erefore, we studied the
mechanisms by which LCs interact with other cell types in epidermis and dermis, and how LC migration is regulated.
Human LCs exclusively express the C-type lectin receptor (CLR) langerin 3,
which functions as pathogen recognition receptor (PRR) by recognizing pathogenic saccharides on viruses, fungi and bacteria, such as mannose, N-acetyl-glucosamine (GlcNAc), fucose and beta-glucans 4, 5. Recently, we showed that langerin interacts
with the glycosaminoglycan hyaluronic acid (HA) on DCs 32. In addition, HA is also
expressed by other cells including KCs, which suggest that LCs might be able to interact via langerin with diff erent cell types.
KCs produce HA via HA synthases and subsequently extrude the polymer via a transporter into the extracellular matrix 6, 7. HA metabolism is regulated by hyaluronidase
enzymes in tissues and skin. HA high molecular weight (HA HMW) (> 1*106 kDa) is
digested into low molecular weight (LMW 20-40 kDa) by hyaluronidase-2 (hyal-2), which is glycosylphosphatidylinositol-anchored to the cell membrane 8. Subsequently,
HA is endocytosed and intracellular processed by hyal-1 9, 10. Hyal-1 is also found
in serum and urine and is larger than intracellular hyal-1 (57 kDa and 45 kDa, respectively 9, 11). Knocking out hyal-2 is lethal for mice 12 highlighting the importance
6
Regulation of Langerin - HA interactions
83 of HA and HA metabolism for systemic homeostasis.
Since HA is abundantly expressed in epidermis and dermis, the process of langerin-HA binding should be highly regulated. Here we showed that LCs upregulate both hyal-1 and -2 that digest HA and release LCs from the environment. Upon LC-DC clustering, LC-DCs mature and upregulate hyal-2, which subsequently degraded HA from the DC cell surface and decreased clustering. Th us, HA expression and cellular LC interactions via langerin are highly regulated by the expression of hyal-1 and hyal-2. Control of HA by hyaluronidases regulates LC migration and cellular interactions, and therefore, manipulation of these mechanisms might provide novel strategies to regulate immune activation.
R
ESULTSLangerin binding pattern in human skin follows HA expression
Here we investigated the interaction of LCs with KCs in human epidermis. LCs resided in close proximity of KCs (Fig 1a). Keratin+ KCs expressed HA (Fig 1a, b), which is
a ligand for langerin. Besides epidermis, we observed HA positive cells in the dermis (Fig 1c), which were identifi ed as DCs (data not shown, chapter 5 32). Next we
investigated whether langerin interacts with HA expressed in epidermis and dermis using FITCylated soluble langerin 4. Th e pattern of soluble langerin binding in skin
was the same as the expression pattern of HA (Fig 1c, d) and we observed binding of langerin to KCs in the epidermis and to CD11c+ HA+ DCs in dermis (Fig 1d). Th ese
data strongly suggest that HA expressed by KCs is a ligand for langerin.
É Ê Ë ÌÍÎ Ï Ð Ñ Î ÍÒ ÓÔÕ Ö × Ê Ë ÌØ ÍÎ Î Õ Ð Ê Ù Ú Ò Ö × Ò Õ Ø Î ÍÔÕ Û ÔÕ Ï ÔÕ Ø ÔÕ Ë Ñ ÔÕ Ü Ý ÞÝ Ü ß ßà á â ã äå æ äç è é ê ë ç ìí ê î ï ðñ Ý É Ê Ë ÌØ ÍÎ Î Õ Ð ò ó Ò ôõ Íö Õ Ô÷ ø ÷ ÔÏ Ö × Ê Ë ÌÍÎ Ï Ð Ê Ù Ú Ò Ö A B C D ò ó Ò ôõ Íö Õ Ô÷ ø ÷ ÔÏ
Figure 1: Langerhans cells reside with keratinocytes in epidermis
Skin sections were snap frozen and cryo sections were stained for pankeratin and CD1a (A) and for HA (B,C). Soluble langerin binding in skin was determined by incubating cryo sections with soluble Langerin-FITC (D). Sections were counterstained with CD11c to identify DCs. Sections were subsequently analyzed by confocal scanning laser microscopy; bars represent 50 µm.
6
Langerin binds to HA on KCs
Primary human KCs were isolated from human skin and we investigated the interaction with langerin. KCs were incubated with unlabeled soluble langerin, and binding was detected by anti-langerin antibodies. Soluble langerin bound effi ciently to KCs, which was blocked by mannan and blocking antibody to langerin (10E2) (Fig 2a). KCs expressed HA on the cell surface, which could be removed by treatment of KCs by the enzyme hyaluronidase (Fig 2c). Langerin binds to HA expressed by KCs, since removal of HA by hyaluronidase diminished langerin binding (Fig 2b). To investigate the role of hyaluronidases in LC migration, human epidermis was fl oated onto PBS supplemented with or without hyaluronidase for 5 hours. We observed enhanced LCs migration out of epidermis in the presence of hyaluronidase (Fig 2d) whereas no KCs were observed in the supernatant (data not shown). Th ese data show that enzymatic degradation of HA on KCs facilitates LC migration out of the epidermis, strongly suggesting HA-langerin interaction is retaining LCs in epidermis and loss of the interaction induces migration.
Figure 2: langerin interacts with HA on KCs
Soluble langerin was incubated with KCs and binding was determined with an anti-langerin antibody by fl ow cytometry. Langerin specifi city was determined by blocking langerin antibody 10E2 and mannan; graph is representative for 3 donors (A). KCs were control-treated or hyaluronidase treated at pH5.2 and langerin binding was determined by fl ow cytometry; graph is representative for 3 donors (B). HA CD44Fc coupled to fl uorescent beads was used in a beads-binding assay to determine the HA expression level at the KC cell surface; mean and SD of 3 donors; experiments in duplicates (C). Epidermal sheets of one square centimetre were fl oated onto PBS pH5.2 supplemented with or without hyaluronidase. LC migration was determined as absolute number of migrating cells by fl ow cytometry; mean and SD of 3 donors; experiments in hexaplicates (D). Paired student’s t-test; p<0.01.
ù ú û ü ý þÿû ÿû ÿû ü ý þ ý ÿ û !" # $ %&#'( ) *)) +)) ,)) -)) .)) /)) 0 12 3 45 67 85 9 17 : 3 ; 9 <= : > 6 3 : ? @ A2 BC 9 ** D E FF E F G H I J F K LMN E F OP LQF MR E ST LK FQUE VP WK FXLK SXLP EXP U Y F K LM NE F OP LQF XLPEXPU Z [ \ ] ^ ù ú û ü ý þÿû ÿû ÿû ü _ ` a bc` d e fgdh c` a ij gkl m n om on pm pn qm rs t us v wx ys z { | | } ~ v ~ v y **
6
Regulation of Langerin - HA interactions
85 LCs upregulate hyal-1 and hyal-2 for migration out of epidermis
We investigated how the interaction between LCs and KCs is regulated upon migration. We analyzed the expression of hyal-1 and hyal-2 in LCs and KCs. We mimicked infection with pathogens by stimulating KCs with TNF or Poly(I:C), ligands for TNF receptors and TLR3 respectively. KCs responded to these triggers by the production of pro-infl ammatory cytokine interleukin-8 (IL-8; data not shown). However, KCs did neither upregulate expression of hyal-1 nor hyal-2 upon stimulation (Fig 3a), and HA expression levels on KCs remained stable upon Poly(I:C) and TNF stimulation (Fig 3b).
Figure 3: Upregulation of hyal-1 and hyal-2 in mature LCs. Keratinocytes were stimulated with TNF and poly(I:C) and were immuno-blotted for hyal-1 and hyal-2; graph is representative for 2 donors (A). CD44Fc coupled to fl uorescent beads was used in a beads-binding assay to determine the HA expression level at the KC cell surface after TNF and poly(I:C) stimulation; mean and SD of 3 donors in duplicates (B). Immature and mature LCs were isolated from the same donor. Hyal-1 and hyal-2 expression was determined by immuno-blotting cell lysates; graph is representative for 3 donors (C). Mature LCs were fi xed and stained for langerin and hyal-2 and were analyzed by confocal scanning laser microscopy; pictures are representative for 3 donors; bars represent 10 µm (D). Langerin was immuno-precipitated from mature LC lysates and immuno-blotted for langerin and hyal-2; representative for 2 donors (E).
¡ ¢ £¤ ¥ ¦ § ¨ © ª « ¬ § ¨ ® ª ¯¯ ° ª «§ ± ²¨ ³ ® ´ ±ª µ ¶ · ¸ ¹ ¶ º º » ¼ ½ ¾ ¿ÀÁ  à ÄÅ ÆÇÈÉ Ê Ë Ì Í Î ÏÎ Ð Î Ñ Î Ò Î Ó Î ÔÕ Ö ×Õ Ø ÙÚ ÛÕ Ü Ý Þ Þ ß à Ø á à Ø Û â ã ¶ ¹ ä ¶ ¹ ¶ å ¶ ¹ £¡ æ ¶ ¶ ç º ¶ ¹ æ ¶ ¶ ç º
6
Th ese data suggest that KC activation by itself does not downregulate HA to facilitate LC migration out of epidermis. Next we prepared immature LCs and mature migratory LCs from the same donor to compare hyaluronidase expression levels. In general, immature LCs are MHC class II intermediate and CD86 negative, whereas mature LCs express high MHC class II and CD86 (data not shown) . Compared to immature LCs, mature LCs have increased levels of both hyal-1 and hyal-2 (Fig 3c) suggesting that maturation increased hyal-1 and -2 levels. Hyal-2 upregulation might cleave cell surface HA from neighbouring KCs, which is subsequently internalised and degraded by hyal-1. Next, we investigated the localization of hyal-2 in mature LCs by confocal scanning laser microscopy. Hyal-2 was present at the cell surface of mature LCs. At the surface, langerin and hyal-2 partly colocalized (Fig 3d). Indeed, co-immuno-precipitation showed that hyal-2 co-immuno-precipitated with langerin (Fig 3e), which confi rms langerin and hyal-2 colocalization observed in the cell membrane (Fig 3d). Th ese data strongly suggest that hyal-2 cleaves HA to liberate LCs for migration toward the dermis. DCs downregulate HA upon maturation
Besides interactions with KCs, LCs also cluster with DCs for antigen transfer and induction of immune responses, as described in chapter 5 32. Although mature LCs
express hyal-2, they strongly clustered with DCs in vitro (Fig 4B). Immature DCs expressed high levels of HA (Fig 4a), which was downregulated after maturation with TLR4 and -3 ligands LPS and Poly(I:C), respectively (Fig 4a). LC-DC interaction was followed in time and was markedly reduced upon DC maturation strongly suggesting downregulation of HA on DCs disables LC-DC clustering (Fig 4b). Th erefore, we investigated the expression of hyaluronidases by DCs. DCs constitutively expressed hyal-1 (Fig 4c), which might degrade short HA that have been generated by hyal-2. Hyal-1 expression levels were independent of the maturation status of DCs (Fig 4c). Notably, hyal-2 protein levels rapidly increased upon DC maturation (Fig 4c). Hyal-2 was measured at diff erent time points and after 16 hours hyal-2 levels started to increase, which further increased up to 48 hours (Fig 4c, lower part). To investigate whether hyal-2 in DCs is responsible for downregulation of extracellular HA, hyal-2 mRNA was silenced with RNAi in DCs (supplementary fi gure 1). HA expression decreased after DC maturation with LPS (Fig 4d) but hyal-2 silencing completely rescued the expression of HA (Fig 4d). Next, we investigated soluble langerin binding to DCs. Langerin binding to LPS-matured DCs decreased, whereas silencing of hyal-2 resulted in a signifi cant rescue of langerin binding. Th erefore our data strongly suggest that maturation of DCs and subsequent upregulation of hyal-2 results in downregulation of HA expression and subsequent loss of LC-DC clustering.
Mature LCs induce maturation and hyal-2 upregulation in DCs
We have shown that LCs and DCs transfer antigens during clustering (chapter 5) 32 and
that DC maturation abrogates LC-DC clustering (Fig 4B). To investigate whether LCs can induce DC maturation, LCs were co-cultured with DCs and expression of maturation markers was investigated by fl ow cytometry. Co-culturing of DCs with LCs led to
6
Regulation of Langerin - HA interactions
87
Figure 4: DCs upregulate hyal-1 to downregulate HA expression
CD44Fc coupled to fl uorescent beads was used in a beads-binding assay to determine the HA expression level at the DC cell surface after LPS and poly(I:C) stimulation; graph is representative for at least 5 donors; mean and SD of experiment in duplicates (A). LCs were labelled with hydroethidium and DCs were labelled with CFSE and clustering was monitored in time by fl ow cytometry (B). DCs were stimulated for diff erent time point with LPS and poly(I:C). Cell lysates were immuno-blotted for hyal-1 and hyal-2; graph is representative for at least 3 donors (C). DCs were silenced for hyal-2 and stimulated with LPS. HA expression was determined using CD44Fc fl uorescent beads by fl ow cytometry analysis; mean and SD of 3 donors (D). DCs were silenced for hyal-2 and stimulated with LPS and soluble langerin binding was determined by fl ow cytometry; mean and SD of 5 donors; paired student’s t-test; p<0.05 (E).
è é êë é ì íî ï ðñ òóô õ ö÷ ø÷ ù÷ ÷ ú û÷ ûú ü÷ üú ý þ ÿ ý þ ý þ þ ! " #$ % & " ' ( ) * + , - . /, 0 0 12 3 2 3 4 5 0 6 76 86 96 :6 ;6 <6 = 6 >6 ?@ A B CDEFG H IJEKL @ MIN OPQR S T U V W X Y Z [\] ^ _ ` _ abcd e f g hi g j k g k f g lm n op q r s t u n v wx y z { | } ~ } ¡ ¢£ ¤ ¥ ¦ § § ¨ ©ª « © ª ¬ ®¯ ° ±¯ ² ³´ µ¯ ¶ · ¸ ¸ ¹ º ² » º ² µ ¼ ½ ¾ ¿ À Á  à ÄÅÁ Æ ÅÁ Ç ÅÁ  ÈÉ Ê Ë Ì ÍÎ ÏÐÑ Ò Ó Ô ÕÖ×Ø ÏÐÑ Ò Ó ÙÚÙ ÙÚ Ø ÙÚÛ ÙÚÜ ÙÚÝ ÞÚÙ ÞÚ Ø ß àáâãä åæ ç èé ê ëì í îé ï ð í ñ ð í ò ð í î ** j k g k f g lm n op q r s t u n v wx ó W XY Z [\] ^ _ ` _ abcd e
increased expression of CD86 and partial upregulation of CD80 and HLA-DR to the same levels as LPS-matured DCs (Fig 5a). Although LCs were already activated upon migration, we observed a strong upregulation of CD80, and a slight upregulation of CD86 and HLA-DR by co-culturing LCs with DCs (Fig 5b). Th ese data suggest that the interaction between LCs and DCs is bidirectional and induces maturation of both DC subsets. Th e DC subsets were isolated after co-culture for 20 hours into two
6
Figure 5: LCs induce maturation of DCs and upregulation of hyal-2, and vice versa
LCs and DCs were co-cultured overnight and analysed for expression of maturation markers CD86, CD80 and HLA-DR by fl ow cytometry; graphs are representative for 3 donors (A) and 2 donors (B). LCs and DCs were co-cultured overnight and separated by MACS microbeads cell separation based on DC-SIGN expression. Cells were lysed and immuno-blotted for hyal-1 and hyal-2; graph is representative for 2 LC donors with 2 DC donors (C).
populations based on DC-SIGN expression and expression of hyal-1 and hyal-2 was analysed. Co-culture of LCs even further upregulated both hyal-1 and hyal-2 expression after interaction with DCs (Fig 5c). In addition, co-culture of DCs with LCs upregulated the hyal-2 protein to the same extent as LPS (Fig 5c). Th erefore our data suggest that LCs and DCs regulate their clustering by reciprocal upregulation of hyaluronidases upon maturation. Hyaluronidases downregulated HA expression on DCs, and decreased LC-DC clustering following maturation.
ô õ ö ÷ø ù ú û üú û üýþ ÿ ô õ ö ÷ ù ú û üú û üýþ ÿ ô ! ö ü" #ö üýþ ÿ þ $ % ! ö ü" #ö üýþ ÿ þ $ % ô
6
Regulation of Langerin - HA interactions
89
D
ISCUSSIONLangerin is a cellular adhesion receptor that interacted with HA expressed on the surface of both KCs and DCs and here we identifi ed the molecular mechanisms regulating these interactions. Maturation of LCs induced upregulation of both hyal-1 and hyal-2, which decreased HA expression on KCs releasing LCs from the interaction with KCs. Similarly, hyaluronidases control LC-DC interactions. During LC-DC clustering, LCs induced maturation of DCs, upregulation of hyal-2 on DCs. Th e expression of hyal-2 by DCs induced cleavage of HA and downregulation of HA expression on the DC cell surface, which could be reverted by hyal-2 silencing. In addition, hyal-2 expression downregulated HA on the DC cell surface, which abrogated LC-DC clustering. Th us, cellular interactions of LCs are mediated by HA and controlled by hyaluronidases.
HA is not only expressed by KCs and DCs, but also by fi broblasts, endothelial cells, activated T cells and tumor cells 7, 13, 14. Langerin could therefore also facilitate
interaction between LCs and a broad spectrum of other cell types in the body. Here we described langerin binding to HA on KCs, which could be crucial for retaining the LC network in epidermis. Next to langerin-HA binding, LCs also interact with KCs via homophilic E-cadherin adherence junctions and therefore, it had been assumed that E-cadherin interaction between KCs and LCs regulates adhesion and migration from epidermis 2, 15, 16. However, a murine DC-Ecaddel model, showed that the homophilic
E-cadherin interaction between LCs and KCs is dispensable for LC maintenance in the epidermis 31. By treating human skin with hyaluronidase, we showed enhanced LC
migration from epidermis. Th us, our data suggest that HA retains LCs in the epidermis via the cellular attachment receptor langerin and degradation of HA in the epidermis leads to migration.
HA is highly conserved among vertebrates and also present in the capsule of bacteria, such as streptococci 17. HA is a unique glycosaminoglycan (GAG), since it is the
only major GAG that is not sulphated and the only GAG not attached to a core protein12.
HA is produced by HA synthases and extruded though the extracellular matrix, where it can reach high molecular weight sizes (HMW) more than 1*106 kDa. Th e turnover
rate of HA in skin is between 0.5-3 days. After injury or during infl ammation, HA is degraded or broken down into LMW fractions (20-40kDa), which recruit and activate leukocytes via CD44, TLR4 and TLR2 18-20. HA LMW might function as danger signal
for LCs via langerin or TLR2 increasing maturation and migration. It has been reported that HA plays a role in DC - T cell interactions 7 probably via CD44 interactions.
We here showed that HA is involved in LC-KC and LC-DC interactions via the CLR langerin expressed by LCs.
Catabolism of HA in somatic tissues is regulated for the greater part by hyal-1 and hyal-2. Hyal-2 is GPI-anchored to the cell membrane and cleaves HA HMW into LMW fragments (20 kDa) 12. Th en, HA fragments are further degraded intracellular
by hyal-1. Th e importance of HA catabolism is highlighted by the fact that hyal-2 knock out mice are not viable 12. We showed both hyal-1 and hyal-2 are upregulated
in mature LCs. Hyal-2 on LCs supposedly cleaves HA expressed by KCs to enable LC migration and hyal-1 clears the HA LMW fragments from the surrounding,
6
minimizing local infl ammation. For hyal-1 it has been shown that its gene has a transcription factor binding site for NF-& B, Egr-1 and AP-2
21.
NF-& B is activated
upon DC maturation via TLR or CLR stimuli 22, 23 and therefore,
NF-& B could account
for hyal-1 upregulation in mature LCs. Little is known about transcriptional control of hyal-2, however our data suggest that transcription factors involved in LC or DC maturation, such as NF-& B, could also be involved in hyal-2 transcription.
We analyzed expression of hyal-1 and hyal-2 by immuno-blotting. We observed in both LCs and DCs a putative hyal-1 form of 45 kDa, which matches with the predicted size for intracellular hyal-1 11. For both LCs and DCs we found a hyal-2 band
of ~40 kDa, which is slightly smaller than expected (50-52 kDa 8). Th is smaller hyal-2
could be specifi c for LCs and DCs due to alternative splicing or diff erent glycosylation of the protein. Most research on hyal-2 so far focussed on hyal-2 (over)expression in cell lines 8, 10, 24, hyal-2 expression in animal models 25, or in epithelial human cells
and platelets 26, 27. In human chondrocytes two bands for hyal-2 are observed, ~40kDa
and ~55 kDa 28. We hypothesize hyal-2 detected in LCs and DCs is functional, but
diff erently glycosylated, or even a smaller isoform than the hyal-2 described so far. We have indentifi ed the physiological molecular mechanism for the regulation of interaction between LCs and KCs as well as DCs. Th ese data are relevant for the design of vaccination strategies to improve LC migration. Furthermore, inhibition of hyaluronidases might provide a strategy to prevent over activation by LCs and retain them in skin. ' ( ) * + , - ./ 0 1 2 3 4 56 78 9 : ; <= >? 678 9 : @ A B C D EF G HI J G KL E M N ' ( ) / + , - ./ 0 1 2 3 45 678 9 : ; <=>? 678 9 : @ A B C D EF G HI J G KL E M N A B C ' ( ) O + , - ./ 0 1 2 3 4 5678 9 : ; <= >? 678 9 : @ A B C EF G HI J G KL E M N P QRSTU VW X P QRSTU VW X P QRSTU VW X
S
UPPLEMENTARYFIGURESupplementary Figure 1: RNAi silences hyal-2 mRNA
DCs were silenced for hyal-1 and were stimulated with LPS. mRNA was isolated from cell lysates and copied to cDNA. Hyal-1 mRNA expression was quantifi ed by real time PCR (A, B, C).
A
CKNOWLEDGEMENTSWe are grateful to the members of the Host Defense group for their valuable input. We would like to thank the Boerhaave Medical Center (Amsterdam, the Netherlands), Dr. A. Knottenbelt (Flevoclinic, Almere, the Netherlands) and Prof. Dr. C.M.A.M. van der Horst (Academic Medical Center, Amsterdam, the Netherlands) for their valuable support. We would like to thank Dr. M.E. Taylor for providing us with soluble-langerin-FITC. Th is work was supported by the Dutch Burns Foundation (08.109, LMvdB) and the Dutch Scientifi c Organization (NWO; VICI 918.10.619, EZW; TBHG).
6
Regulation of Langerin - HA interactions
91
M
ATERIALANDM
ETHODSAntibodies, proteins and enzymes
anti-cytokeratin (AE1/AE3; Dako); anti-CD1a (NA1/34; SantaCruz); 10E2 (anti-Langerin 29); rabbit-anti-Hyal1,
rabbit-anti-Hyal-2 (both Abcam); goat-anti-langerin (R&D); Goat-anti-Human-Fc-biotin (Jackson); anti-CD11c-PE (S-HCL-3; BD); DCGM4-PE (anti-Langerin-PE; Beckman Coulter); anti-DC-SIGN-FITC (R&D), anti-CD86-PE; anti-CD80-anti-CD86-PE; anti-HLA-DR-PE (all BD); soluble Langerin-FITC (kind gift from M.E. Taylor); rhLangerin; rhCD44Fc (both R&D); Hyaluonic Acid Binding Protein-biotin (Immunosource); Isotype-specifi c goat-anti-mouse Alexa-488, -546 and Streptavidin-488 (all: Invitrogen); Hyaluronidase type IV S (Sigma Aldrich); Poly(I:C) (Sigma Aldrich); TNF-Y (R&D); MACS CD1a and DC-SIGN microbeads (Miltenyi). carboxyfl uorescein succinimidyl ester
(CFSE, Sigma Aldrich); Hydroethidium (HE; Invitrogen); dispase II; DNAse I (both: Roche)
TSM buff er (Tris buff er (20 mM Tris–HCl, pH 7, 150 mM NaCl, 1 mM CaCl2, 2 mM MgCl2); TSM); TSA buff er (TSM supplemented with 1% BSA); PBA buff er (PBS supplemented with 0.5-1% BSA and 0.02% Azide); Hyaluronidase treatment buff er (115 mM NaCl; 0.2 mM Na2HPO4∙2H2O; 7.7 mM KH2PO4; pH5.2)
Langerhans cell and keratinocyte isolation
Human skin tissue was obtained from healthy donors undergoing corrective breast or abdominal surgery after informed consent in accordance with our institutional guidelines. Split-skin grafts of 0.3 mm were harvested using a dermatome (Zimmer) and were treated with dispase (1 U/ml) at 37oC for 45 minutes to separate dermis from epidermis. Th e
epidermis was either fl oated onto medium for 48 hours before mature LCs were harvested from the supernatant. To isolate immature LCs and KCs, epidermis was enzymatically degraded by trypsin and DNAse I, and the single cell suspension was layered on a lymphoprep (fi coll; Axis-shield) gradient. Th e pellet contained KCs and the fi coll fraction (10% LC, 90%KC) was further separated by CD1a MACS magnetic microbeads, following the manufacturer’s protocol. Cells were maintained in Iscoves Modifi ed Dulbecco’s Medium (IMDM), 10% FCS, pen/strep (10 U/ml and 10 Z g/ml,
respectively; Invitrogen,) and gentamycine (20 µg/ml; Centrafarm). Monocyte isolation and DC diff erentiation
Monocytes were isolated from buff ycoats. Buff ycoats were mixed with Hank’s Balanced Salt Solution (HBSS) and 1500 I.U. heparin (Leo Pharmaceuticals) and peripheral blood mononuclear cells (PBMC) were isolated by a lymphoprep gradient step. Monocytes were isolated from the PBMCs by a Percoll (Amersham Biosciences) gradient step. Monocytes were cultured in the presence of IL-4 and GM-CSF (500 and 800 IU/ml; Biosource/Invitrogen) for 6 days to allow monocyte derived DC (moDC) diff erentiation. Th en, DCs were stimulated for 24 hours with LPS (10 ng/ml) or Poly(I:C) (10 µg/ml).
FACS analysis
All cells were washed in PBA or TSA and were incubated with specifi c antibodies, HABP-bio (5 Z g/ml) or isotype
controls for 30 minutes at 4°C. Or cells were incubated with soluble langerin (rh langerin; R&D) for 30 minutes at RT. Subsequently cells were washed and incubated with Alexa 488 secondary antibody (5 Z g/ml) for 30 minutes at 4°C. Or
cells were stained with directly labelled antibodies for 30 minutes at 4°C. Cells were labelled with 5 µM CFSE in TSA for 10 minutes at 37oC or with 10µg/ml HE in medium for 30 minutes at 37oC. After extensive washing, fl uorescence was
measured using fl ow cytometry: FACScan or FACSCalibur (BD) with Cellquest software. LC-DC Cluster experiment
CFSE labelled moDCs were mixed with HE labelled THP, THP-Langerin or LCs in a 1:1 ratio. Cells were co-incubated for 30, 45, 60, 90, 120 minutes in medium at 37oC before FACS analysis. Double positive events were considered as
clustering cells. Th e percentage of clustering LCs and DCs (n) was calculated relative to the number of single positive LCs (o) and single positive DCs (p) as follows: 2∙n/((2∙n)+o+p)) ∙ 100%.
Fluorescent bead adhesion assay
We performed the fl uorescent bead adhesion assay as described before 30. In short: for HA expression profi ling, we coated
streptavidine beads with 5 µg of biotinylated goat-a-human-Fc and rhCD44Fc. Cells and beads were co-incubated in TSA for 45 minutes.
Confocal Laser Scanning Microscopy
5-µm Cryosections of human skin were air-dried and fi xed in acetone for 10 minutes. Sections were preincubated with 10% normal goat serum for 10 minutes before sections were incubated with soluble Langerin-FITC 4, anti-CD1a,
anti-cytokeratin, anti-CD11b or HABP-bio for 1 hour at room temperature. Th en sections were incubated with isotype-matched secondary antibodies or Streptavidin-Alexa 488 for 30 minutes at room temperature. Finally, tissue sections were counterstained with Hoechst for 2 minutes. Between all incubation steps, sections were extensively washed with PBS supplemented with Ca2+ (pH 7.4). Matched isotype antibodies served as negative control and all controls were
essentially blank. Cryosections were analyzed by a Confocal Laser Scanning Microscope (Leica).
Or LCs were fi xed with 4% PFA and permeabilized in PBS with 0.5% saponin / 1% BSA, before cells were incubated with primary antibody for 60 minutes at room temperature. Th en cells were incubated with isotype-matched secondary antibodies for 30 minutes at room temperature. Finally, the slides were counterstained with Hoechst for 2 minutes. Between all incubation steps, cells were extensively washed with PBS (pH 7.4). Matched isotype antibodies served as negative control and all controls were essentially blank. Cells were analyzed by a Confocal Laser Scanning Microscope (Leica).
Immuno-precipitation and immuno-blotting
6
(anti-langerin). Langerin was precipitated with prot A/G plus agarose beads. Lysates were resolved by SDS-PAGE, and detected by immuno-blotting with goat-anti-langerin or rabbit anti-hyal-2 antibodies. Or cells were lysed in lysis buff er (Cell Signaling) and lysates were resolved by SDS-PAGE, and detected by immuno-blotting with rabbit-anti-hyal-1 and -2 antibodies.
RNA isolation and quantitative real-time PCR
mRNA was isolated with an mRNA Capture kit (Roche) and cDNA was synthesized with a reverse-transcriptase kit (Promega). Samples were amplifi ed by PCR with SYBR Green as described before 33. Specifi c primers
were designed with Primer Express 2.0 (Applied Biosystems) for Hyal-2 and housekeeping gene GAPDH. Hyal-2: FW: TGGCCTCCAGACCGCATA; REV: TCCAGCATGAACTGCTGTGC; GAPDH: FW: CCATGTTCGTCATGGGTGTG; REV: GGTGCTAAGCAGTTGGTGGTG . Th e cycling threshold (CT) value is defi ned as the number of PCR cycles in which the fl uorescence signal exceeds the detection threshold value. Relative expression levels of hyal-2 were calculated from the CT values obtained for both hyal-2 and GAPDH mRNA with the equation [Relative hyal-2 mRNA] = 2 CT(GAPDH) − CT(hyal-2)
RNAi
DCs were transfected on day 4 with 25 nM siRNA with the transfection reagent DF4 (Dharmacon) in the presence or absence of 2 ng/ml LPS, and were used for experiments 48 h after transfection. Th e siRNA (SMARTpool; Dharmacon) was specifi c for hyal-2 (M-013689-00; Dharmacon) and nontargeting (nt) siRNA (D-001206-13; Dharmacon) served as control. Silencing of expression was verifi ed by real-time PCR.
R
EFERENCES1. Banchereau, J. & Steinman,R.M. Dendritic cells and the control of immunity. Nature 392, 245-252 (1998).
2. Tang, A., Amagai, M., Granger, L.G., Stanley, J.R., & Udey,M.C. Adhesion of epidermal Langerhans cells to keratinocytes mediated by E-cadherin. Nature 361, 82-85 (1993). 3. Valladeau, J. et al. Langerin, a novel C-type lectin
specifi c to Langerhans cells, is an endocytic receptor that induces the formation of Birbeck granules. Immunity 12, 71-81 (2000). 4. Stambach, N.S. & Taylor,M.E. Characterization of
carbohydrate recognition by langerin, a C-type lectin of Langerhans cells. Glycobiology 13, 401-410 (2003).
5. de Jong, M.A.W.P. et al. C-type lectin Langerin is a beta-glucan receptor on human Langerhans cells that recognizes opportunistic and pathogenic fungi. Molecular Immunology 47, 1216-1225 (2010).
6. Sayo, T. et al. Hyaluronan synthase 3 regulates hyaluronan synthesis in cultured human keratinocytes. J. Invest Dermatol. 118, 43-48 (2002).
7. Mummert, M.E. et al. Synthesis and surface expression of hyaluronan by dendritic cells and its potential role in antigen presentation. J. Immunol. 169, 4322-4331 (2002).
8. Andre, B. et al. Hyal2 is a glycosylphosphatidylinositol-anchored, lipid raft-associated hyaluronidase. Biochem. Biophys. Res. Commun. 411, 175-179 (2011).
9. Csoka, A.B., Frost, G.I., & Stern, R. Th e six hyaluronidase-like genes in the human and mouse genomes. Matrix Biol. 20, 499-508 (2001).
10. Harada, H. & Takahashi, M. CD44-dependent intracellular and extracellular catabolism of hyaluronic acid by hyaluronidase-1 and -2. J. Biol. Chem. 282, 5597-5607 (2007).
11. Csoka, A.B., Frost,G.I., Wong,T., & Stern,R. Purifi cation and microsequencing of hyaluronidase isozymes from human urine. FEBS Lett. 417, 307-310 (1997).
12. Stern, R. Devising a pathway for hyaluronan catabolism: are we there yet? Glycobiology 13, 105R-115R (2003).
13. Taylor, K.R. & Gallo,R.L. Glycosaminoglycans and their proteoglycans: host-associated molecular patterns for initiation and modulation of infl ammation. FASEB J. 20, 9-22 (2006). 14. Simpson, M.A. Concurrent expression of hyaluronan
biosynthetic and processing enzymes promotes growth and vascularization of prostate tumors in mice. Am. J. Pathol. 169, 247-257 (2006).
15. Leenen, P.J. & Egeler,R.M. Langerhans’ cell histiocytosis is caused by dysregulation of the E-cadherin-beta-catenin cascade: a hypothesis. Immunol. Cell Biol. 77, 460-467 (1999).
16. Jakob, T. & Udey,M.C. Regulation of E-cadherin- mediated adhesion in Langerhans cell-like dendritic cells by infl ammatory mediators that mobilize Langerhans cells in vivo. J. Immunol. 160, 4067-4073 (1998).
17. Humphrey, J.H. Antigenic properties of hyaluronic acid. Biochem. J. 37, 460-463 (1943). 18. Termeer, C. et al. Oligosaccharides of Hyaluronan
activate dendritic cells via toll-like receptor 4. J. Exp. Med. 195, 99-111 (2002).
19. Scheibner, K.A. et al. Hyaluronan fragments act as an endogenous danger signal by engaging TLR2. J. Immunol. 177, 1272-1281 (2006). 20. Noble, P.W. Hyaluronan and its catabolic products
in tissue injury and repair. Matrix Biol. 21, 25-29 (2002).
21. Lokeshwar, V.B. et al. Epigenetic regulation of HYAL-1 hyaluronidase expression. identifi cation of HYAL-1 promoter. J. Biol. Chem. 283, 29215-29227 (2008).
6
Regulation of Langerin - HA interactions
93
28. Chow, G., Knudson,C.B., & Knudson,W. Expression and cellular localization of human hyaluronidase-2 in articular chondrocytes and cultured cell lines. Osteoarthritis. Cartilage. 14, 849-858 (2006).
29. de Witte, L. et al. Langerin is a natural barrier to HIV-1 transmission by Langerhans cells. Nature Medicine 13, 367-371 (2007). 30. Geijtenbeek, T.B.H. et al. Identifi cation of
DC-SIGN, a novel dendritic cell-specifi c ICAM-3 receptor that supports primary immune responses. Cell 100, 575-585 (2000). 31. Zahner, P. et al. Chapter 2: E-cadherin binding is
dispensable for maintain an intact LC cell network in the epidermis. In: Who controls the controllers? [ -Catenin and E-cadherin
signalling in DC function. Amsterdam (2012). ISBN: 9789461820693
32. van den Berg, L.M. et al. Chapter 5: Langerhans cell-dendritic cell interactions through langerin and hyaluronic acid mediate HIV-1 antigen transfer. In: Th e role of C-type lectin receptors in skin immunity. Amsterdam (2013). submitted for publication
33. Gringhuis, S.I., den Dunnen, J. et al. C-type lectin receptor DC-SIGN modulates Toll-like receptor signaling via Raf-1 kinase-dependent acetylation of transcription factor NF-kappa B. Immunity. 26, 605-616 (2007).
22. Gringhuis, S.I. & Geijtenbeek,T.B.H. Carbohydrate Signaling by C-Type Lectin DC-SIGN Aff ects Nf-Kappa B Activity. Methods in Enzymology, Vol 480: Glycobiology 480, 151-164 (2010).
23. Gringhuis, S.I. et al. Dectin-1 directs T helper cell diff erentiation by controlling noncanonical NF-kappa B activation through Raf-1 and Syk. Nature Immunology 10, 203-213 (2009). 24. Duterme, C., Mertens-Strijthagen,J., Tammi,M.,
& Flamion,B. Two novel functions of hyaluronidase-2 (Hyal2) are formation of the glycocalyx and control of CD44-ERM interactions. J. Biol. Chem. 284, 33495-33508 (2009).
25. Vigdorovich, V., Miller,A.D., & Strong,R.K. Ability of hyaluronidase 2 to degrade extracellular hyaluronan is not required for its function as a receptor for jaagsiekte sheep retrovirus. J. Virol. 81, 3124-3129 (2007).
26. Monzon, M.E. et al. Reactive oxygen species and hyaluronidase 2 regulate airway epithelial hyaluronan fragmentation. J. Biol. Chem. 285, 26126-26134 (2010).
27. de la Motte, C. et al. Platelet-derived hyaluronidase 2 cleaves hyaluronan into fragments that trigger monocyte-mediated production of proinfl ammatory cytokines. Am. J. Pathol. 174, 2254-2264 (2009).
