UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)
UvA-DARE (Digital Academic Repository)
Genetic profiling of the peripheral nervous system
de Jonge, R.R.
Publication date
2003
Link to publication
Citation for published version (APA):
de Jonge, R. R. (2003). Genetic profiling of the peripheral nervous system.
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)
and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open
content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please
let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material
inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter
to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You
will be contacted as soon as possible.
C h a p t e r 4
N-myc downstream regulated gene I is m u t a t e d in
hereditary m o t o r and sensory neuropathy - Lorn
R.R de Jonge I.N van Schaik M.Vermeulen
M.S.G. Kwa F.Baas
A b s t r a c t
Hereditary motor and sensory neuropathies, to which Charcot-Marie-Tooth (CMT) disease belongs, are a common cause of disability in adult life. Growing awareness that axonal loss, rather than demyelination per se, is responsible for the neurological deficit in demyelinating CMT disease, has focused research on the mechanisms of early development, cell differentiation and cell-cell interactions in the peripheral nervous system. Autosomal recessive peripheral neuropathies are relatively rare but clinically more severe, and understanding their molecular basis may provide a new perspective on these mechanisms. Here we report the identification of the gene responsible for Hereditary Motor and Sensory Neuropathy-Lorn (HMSNL). HMSNL shows features of Schwann cell dysfunction and a concomitant early axonal involvement, suggesting that impaired axon-glia interactions play a major role in its pathogenesis. The gene was previously mapped to 8q24.3, where conserved disease haplotypes suggested genetic homogeneity and a single founder mutation. We have reduced the HMSNL interval to 200 kb and characterised it by large scale genomic sequencing. Sequence analysis of patients and controls for the two genes, which are located in the critical region identified the founder HMSNL mutation: a premature termination codon at position 148 of the N-myc Downstream Regulated Gene I (NDRGI). NDRGI is ubiquitously expressed and has been proposed to play a role in growth arrest and cell differentiation, possibly as a signalling protein shuttling between the cytoplasm and the nucleus. We have studied expression in peripheral nerve and detected particularly high levels in the Schwann cell. Together, these findings point to an important role of NDRGI in the peripheral nervous system, possibly in the Schwann cell signalling necessary for axonal survival.
Introduction 83
I n t r o d u c t i o n
Hereditary Motor and Sensory Neuropathy Lorn (HMSNL) (MIM 601455) is an auto-somal recessive form of Charcot-Marie-Tooth disease, which occurs in divergent Romani (Gypsy) groups descended from a small founder population, the Vlax or Danubian Roma.The disorder was first described in affected families from Bulgaria [ I ] and subsequently diagnosed in Italy [2], Slovenia [3], Germany [4], Spain [5], France and Rumania. HMSNL is an early-onset peripheral neuropathy that progresses to severe disability in adulthood. Clinically, it presents with muscle weakness and wast-ing, tendon areflexia, skeletal and foot deformities, sensory loss affecting all modali-ties and severe reduction in nerve conduction velocimodali-ties [2-4, 6]. Neural deafness develops during the second or third decade of life, with abnormalities in the brain stem auditory evoked potentials suggesting involvement of the entire tract, including the central auditory pathways [3, 6].The neuropathological observations in HMSNL [3, 4, 6, 7] point to Schwann cell dysfunction, manifested by hypomyelination and demyelination/ remyelination, failure of compaction of the innermost myelin lamellae and poor hypertrophic response (onion bulb formation) t o the demyelination process. A t the same time, axonal involvement is documented by the early, severe and progressive axonal loss and by the presence of curvilinear intra-axonal inclusions, similar to those seen in the dying-back type of distal axonopathy in experimental vitamin E deficiency.
A number of recent clinical and experimental studies of the common autosomal dom-inant demyelinating forms of Charcot-Marie-Tooth (CMT) disease have indicated that the neurological deficit in demyelinating neuropathies is related to the axonal loss, rather than to demyelination per se [8-12] features of HMSNL make it impossible to pinpoint the primary defect to either Schwann cells or neurons, and strongly suggest that impairment of SC-axonal interaction is a major component of the pathogenesis of this disease. The molecular basis of HMSNL may thus be of relevance t o the general understanding of the pathogenetic mechanisms and causes of disability in demyelinating neuropathies.
The disease gene was mapped to a 3 cM interval on 8q24.3 where closely related dis-ease haplotypes and strong linkage disequilibrium values suggested a single founder mutation [ I ] . Similar polymorphic haplotypes were subsequently identified in HMSNL chromosomes across Europe, supporting the assumption of genetic homogeneity and founder effect [I 3]. We now report the identification of the HMSNL gene and the founder mutation causing the disease.
84 Chapter 4
Subjects and Methods
Physical m a p p i n g of the H M S N L region
A contig of genomic clones spanning the HMSNL interval was assembled by screening BAC and PAC libraries for the known STSs in the region and for the end sequences of clones identified in previous rounds of our library screening. The screening was performed by PCR amplification (Research Genetics CITB human BAC library) or fil-ter hybridisation (Piefil-ter de Jonge PAC library #709, RPCI6, obtained through the Resource Centre of the German Human Genome Project). Clone orientation was obtained by STS content mapping and by halo-FISH [14]. Non-overlapping clone ends were used as STSs in the next round of library walking.
Refined genetic mapping
For the identification of new polymorphic microsatellites, BAC and PAC contig clones were digested with frequent cutter restriction endonucleases and shotgun cloned into pBluescript. A replica membrane of the gridded colonies was hybridised with a cocktail of [3 2P] y-ATP end-labelled di/tri/tetranucleotide repeat sequences and
pos-itive clones were sequenced. Markers available from the public databases (D8S558, D8S529, D8S378 and D8S256) were PCR-amplified using fluorescently labelled primers (Research Genetics Map Pair Set), length-separated on a PE Biosystems 373 XL D N A analyser and analysed using the PE Biosystems Genotyper software. AFM I I 6yh8 and all newly identified microsatellites were analysed through incorpora-tion of [3 2P] OC-dCTP into the PCR product during amplification.The PCR primers for
the newly identified markers were as described [I 3].Vertical gel electrophoresis, per-formed in a Hoeffer Pokerface II apparatus, was followed by autoradiography for 2-12 hours. Allele calling was performed manually. Haplotypes were constructed manu-ally and examined for recent and historical recombinations. The marker positions were determined by the STS content mapping of the contig clones.
A total of 174 individuals were genotyped for 24 markers in the HMSNL region. Informed consent was obtained from all participants in the study.
Sequencing
BAC/PAC D N A isolation and purification with the QIAfilter Plasmid Midi kits fol-lowed the manufacturer's protocols (QIAGEN News Issue # 4, 1996). End sequenc-ing was performed ussequenc-ing universal primers T7 and SP6.
Sequencing analysis of the WISPI and NDRGI genes included all coding regions and at least 100 bp of flanking intronic sequences. PCR amplification was performed using the primers shown in Table I. The PCR products were purified with the Qiagen QIAquick spin columns. Both strands were sequenced with the same primers as used for the PCR amplification.
Subjects a n d M e t h o d s 8 5
Table I. PCR primers for the sequencing analysis of NDRCI and WISPI
Forward Reverse NDRGI Exon I Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10 Exon I I Exon 12 Exon Exon Exon Exon WISPI Exon I Exon 2 Exon 3 Exon 4 Exon 5 GACTGCGAGGGTCTGGGAG CTTCTTGCCATTGGTCTTG GATTCAGGTCATAGAAAGG CACGCGGATGCCATGAAC CTTTGCCACCGAGACACC CTAATGGCTTCTCTGTGTC AGGCTCCCGTCACTCTG CCTAGTGTTTCAGATTGCTG GGAGTCCAGCAATGCCAC GAGTAGTGACCAGCTCAG ACAGGGCCTCTCTCAAGTTG CAGGCCTGGGAGTGGGACAATC CAAGCCACATCTGCTGAATCC GACACCAGCAGCCTTGCCTG GGAAACTGGCTCAGACAGG GTGGACATGGAGAGGACG CATATCTGGTGCTCCTGATGG GACAGGAATGCAATGGCAG GCATGGTCCACATGGAGCC GTGTGGTGAAAGTGAGGGTTG GTAAGGTGGAATGCTCCCAC CTTACTCCTGGAGTACGC GCATGCCCATAAGTACAAG AGAGAAGACGGGATGAGG G C ATTTCTG G CTTTTCC AG GAGCAAAGCACCTGAACC GTCAGTCCAGATCAAAGC GTCTTCCTTCATCTTAAAATG GAGAGCTCGTAGCTCCAG CTGAGCACCACACAATGC CAAACTCAGAGCCTGCCTCTTC CTGGGTAATGCTCAGTCTC GCAGGCAGGGCCACTTCAAC CTTTGCAGCCTCAGATCACC CCTAGGGAATCAGAGTCCTC CATGCCCTCCACACACCTAAC GTCTCCACCAGAGCTCACTC GTAGCAGGACCCAGTAGAGAAG GGTGTATCTCCTGCTGAAC GGTGGTCAGAGTTCCAGG GCTTGTGAAGTCTAGACATCC CAGATCAGGGTAACTAAGGC
Sequencing of end clones and PCR products was performed using PE Biosystems BigDye Terminator reagents. The reactions were run on a PE Biosystems ABI 377 sequencer and analysed using the Sequence Navigator software vs 1.0.1.
For large-scale genomic sequencing, BAC/PAC D N A was isolated using the double acetate method [I 5]. The closed-circle band was sonicated and 1.5-2 kb fragments were size-selected by agarose electrophoresis and ligated into the Smal site of M I 3mp 18 vector. M I 3 templates were prepared by the Triton method [16]. Shotgun sequencing was performed usingThermoSequenase (Amersham) and Dye-Terminator chemistry (PE Biosystems). Data were collected using ABI 377 automated sequencers and assembled with the program phrap/cross_match.
C o m p u t a t i o n a l analysis The genomic sequence data were analysed using the RUMMAGE-DP program of the Institute of Molecular Biotechnology, Jena, Germany, which combines more than 25 different programs (references available at the URL of the Jena Institute of Molecular Biotechnology), including five for exon prediction, REPEATMASKER for tagging repet-itive sequences, programs for prediction of CpG islands, and homology searches using BLAST version 1.4 and FASTA version 2.0. Recognition of promoter regions and
tran-scription start positions was performed using both Ghosh/Prestridge (TSSG) and Wigender (TSSW) motif databases.
Screening for t h e R I 48X m u t a t i o n
Exon 7 of NDRG\ was PCR amplified as a I 76 bp product using the following primers 5'AGGCTCCCGTCACTCTG3' (forward) and 5'GTCTCCTTCATCTTAA AATG3' (reverse). Restriction digests were performed for 4 h at 65°C in a mix containing I X Taq\ buffer, 10 ul PCR product and I OU of Taq\ (Promega).The restriction products (104 and 72 bp in length) were separated in 4% agarose gels stained with ethidium bromide and visualised under UV light.
Expression studies
SAGE library data were obtained through screening of our own libraries construct-ed from peripheral nerve, glioblastoma and fetal brain RNA [17] and through search-ing SAGE public databases.The sequence of the NDRG\ SAGE tag is GGACTTTCCT. Expression levels are given as number of tags/106.
N o r t h e r n blot analysis was conducted on RNA extracted from total peripheral nerve and from cultured non-myelinating Schwann cells and hNT2 cells following standard protocols [18]. RT-PCR of NDRGI of RNA derived from the same sources as above, was p e r f o r m e d using p r i m e r s A A C C C A C A C A G T C A C C C T ( f o r w a r d ) and GAAGTACTTGAAGGCCTC (reverse).The 189 bp products were run on a 1% agarose gel in IXTBE, blotted and hybridised with the PCR product obtained with the same primers.
Analysis for tissue-specific transcripts was performed by 5'-RACE and by RT-PCR of t w o fragments spanning the entire coding region of NDRG\. 5'-RACE (Boehringer Mannheim 573' RACE kit) was performed on total RNA from human fetal brain, adult peripheral nerve and lymphocytes, using the following NDRG I -specific primers: NDRG I -RI 5'ACACAGCGTGACGTGAACAG3' (for the reverse transcription step), and N D R G I - R 2 5'CAGAGCCATGTAAAGTCTCG3' and NDRI-R3 5'ATGTCCT-GCTCCTGGACATC3' for the 5'-RACE reactions. The products were tested on agarose gels and sequenced with primer NDRGI-R3. One-step RT-PCR was per-formed on the same sources of RNA as the 5'-RACE, using the following t w o primer pairs: NDRG I 5'UTR-F 5'GAAGCTCGTCAGTTCACC3' and NDRG I Exon4-R 5'GTGATCTCCTGCATGTCCTC3'; NDRG I Ex4-F 5'GAGGA CATGCAGGAGAT-CAC3' and N D R I Exl5-R 5'CCAGAGGCTGTGCGGGACC3'.
Radiation hybrid mapping
The chromosomal location of NDRG2 was determined by radiation hybrid (RH) map-ping. PCR screening of the GeneBridge RH panel was performed using primers select-ed from the unique 3'UTR sequence of KIAAI248, showing no homology to NDRG\
Subjects and Methods 87
* °
2 S 1. Q. i/l rt >^ O - ° -Q. OO -o « 2 -= o e tt * o ^ Q « b Z a. c "o ü g g B t l S 00= 1
g • 2 * 8 o ^ O u o .«•?IS
o. ra r u H U 1 E 0 * < a 0 •-» o rt X " .= < c i_ c • J f O S JQ o c -> ° c « ~ u 2 5 a> <u o E CO CO CO t o r - COO lO CO CO ^T88 Chapter 4 o a a c F
2
>
-C 0 )—
•o c c 0 X « J o - C 5 a*
C l 5 V I _oi<
É
• o^
o 'c " v. w _ O < H X g co V CC2
-•3 §- ^
•S e 2 3 0 ° < < Ei " h-— o O CJ 0 0 m — u c S ral
S 0) oc o z . : £ 2 * ' oo-b i - . o ? •= o o oo _* ra 0) _ , i-^ Z £ x 8 S <= 9. § 5 8 -2 •? !T" C .- « -2 < ..- — -. «ü ° £ ë
Hs
£ 5 ra S t g 0 K-g g - i j c £ -2 ra0 « 0 ra -=5 S o « 2 "ra - P S. fc y o Q. 3 -J S - o -z £ 2 '° 5 ?Results 89
or NDRG3.The primer sequences were as follows: NDRG2RH-F2 5'-CTGGGGCTC-CATTCACCAAAGC and NDRG2RH-R2 5'-AGCCCAGCCCAAGCTTAGCTC. The results were submitted for calculation t o the RH server of the Whitehead Institute / MIT Center for Genome Research.
Results
Physical and refined genetic mapping We have assembled a I Mb contig of genomic BAC, PAC and cosmid clones, with a minimum tiling path shown in Figure I.The contig spans the entire HMSNL region as defined by the recombinations identified in the initial study [ I ] . The contig was anchored to the four known markers in this region on 8q24, following the order pro-vided by public databases (cen-D8S529/D8S378-AFM I I 6yh8-D8S256-tel). Our subse-quent findings have shown the correct orientation to be cen-AFM I I 6yh8-D8S378-D8S529-D8S256-tel.The contig clones were used for the physical mapping of ESTs roughly positioned in this region and for the identification of new polymorphic markers. The refined genetic mapping included 174 individuals (60 patients and I 14 unaffected relatives) from seven European countries, genotyped for 24 polymorphic microsatel-lites, of which 19 were identified in our study [13]. Ten recombinant haplotypes, whose distribution differed between disease chromosomes originating from the diverse Romani groups, helped to narrow down the HMSNL gene region (Figure lb). In 5 of the 7 centromeric recombinations (bottom of Figure lb) the breakpoints mapped t o the same 90 kb interval between markers pJIO and 458b 14, thus placing the centromeric boundary of the region at pj I 0. Haplotype analysis of the telomeric recombinants placed the distal boundary at marker 369CA3 (right hand side of Figure I b). W i t h i n the pJi0-369CA3 interval, all HMSNL chromosomes shared an identical haplotype for markers 458a I 3-458b57-369a89.This haplotype was not found in any of the 88 normal chromosomes studied. Marker 458b 14 presented with three differ-ent alleles in the disease chromosomes, however on the basis of the conserved flank-ing haplotypes this variation was assumed t o result from microsatellite mutations (similar to those observed in 339CA2, I 8 9 C A I 7 and especially D8S378; green boxes in Figure lb).
The critical HMSNL gene interval was thus defined on the basis of recombination and homozygosity mapping to be located between newly identified markers pj 10 and 369CA3. The entire region was contained in 3 overlapping genomic clones, PAC 709A2498Q2 and BACs 458A3 and 369M3 (Figure I). Large-scale sequencing of these clones identified the final exons of thyroglobulin in PAC 709A2498Q2 and the full length of two known genes: Wntl-inducible signalling protein I, W/SPI [19] in BAC 458A3 and N-myc downstream regulated gene I, N D R G I , aliases RTP, NOR I, ORG I, CAP43 [20-24] in BACs 458A3 and 369M3 (Figure I a). WISP I and NDRG\ are located tail
t o tail, in opposite orientations and separated by a small distance of about 3 kb.The W/SPI gene spans about 38 kb of genomic DNA, with coding regions split into 5 exons. NDRG\ is spread over 60 kb of genomic D N A and consists of 16 exons, includ-ing an untranslated first exon (Figure 2).
T h e H M S N L mutation
The search f o r the mutation was conducted by sequencing the untranslated and p r o m o t e r regions, all exons and at least 100 nucleotides of the flanking introns of W/SPI and NDRGI in a panel of D N A samples from HMSNL patients and unaffected controls from the same population.
This analysis revealed a total of 13 single nucleotide polymorphisms (SNPs) in the t w o genes (Table 2), of which only one was in W/SPI .The difference is due to the fact that sequence variation in NDRG\ was investigated more extensively in individuals of diverse ethnic background whereas W/SPI was analysed only in the Roma. Our results so far show that SNPs in the NDRGI gene occur with a frequency of at least I per 423 nucleotides. In HMSNL patients, the WISP I gene sequence was identical to the published wild-type sequence.
The analysis of NDRG\ in the HMSNL affected individuals identified a C-»T transition in exon 7, at nucleotide position 564 (following the numbering of the RTP sequence published under accession # D87953).This substitution results in the replacement of arginine by a translation termination signal at codon position 148 (Figure 2). The RI48X mutation was found in the homozygous state in all 60 HMSNL patients includ-ed in our study.
The C-»T substitution abolishes a Taq\ site and a restriction assay was designed as a screening test for the RI48X mutation. In the HMSNL families, the mutation segre-gated in 100% agreement with the carrier status predicted by haplotype analysis.The analysis of 69 additional unaffected members of the extended kindred where the disease was first described (the Lorn pedigree), detected 24 carriers.
The RI48X mutation screening also included 10 Romani families with unspecified autosomal recessive peripheral neuropathies from Rumania.The RI48X mutation was found in 6 of these families, where it co-segregated with the disease phenotype and occurred in the homozygous state in the affected patients.
We did not find the RI48X mutation among 101 unrelated unaffected control indi-viduals, including 68 non-Romani Bulgarians and 33 Roma who originate from the same groups as the HMSNL patients but belong to kindreds with other genetic dis-orders.
The SNP positions are designated as proposed byAntonarkis et al. [25], with positive IVS (intronic) numbers starting from the G of the donor site invariant GT, and the negative IVS numbers starting from the G of the acceptor site invariant AG.
T h e N-myc d o w n s t r e a m regulated gene family NDRG\ is a known gene that has been identified previously by several independent in-vitro studies of human cell lines [20-22, 24]. The encoded protein is highly con-served in evolution [26-28]. The genomic organisation of NDRG\ revealed in our study (Figure 2), is also conserved and closely related to that of the mouse gene [26]. Previous experiments suggested that NDRG\ is a unique gene [20, 29], however a recent study has demonstrated the existence of a Ndr gene family in the mouse [30]. Since the existence of homologous genes in humans could affect the specificity and hence reliability of expression studies, we have used the novel mouse sequences to search the human genome databases. This search has confirmed the existence of related human genes, which we will refer t o as NDRG2 and NDRG3 respectively, for the genes homologous to mouse Ndr2 and Ndr3.
NDRG2 was found to be represented by 147 ESTs and t w o c D N A sequences. To determine its chromosomal localisation, we have performed radiation hybrid mapping using the GeneBridge panel. NDRG2 was localised t o chromosome I4ql 1.2, at 6.72 cR from DI4S264, with a lod score of 15.0.
The NDRG3 gene was represented by 86 ESTs and a genomic clone from chromo-some 20ql l . 2 l - q l I-23. This provisional chromosomal localisation was confirmed by electronic PCR. This search identified four STSs in the same genomic clone (three flanking NDRG3 and one located in its 3'UTR) that have also been independently localised to chromosome 20 by radiation hybrid mapping.
The BLAST comparison showed considerable homology between the three human NDR genes, with greater divergence in the terminal parts of the sequences. A t the protein level, the identity (similarity) is 54% (70%) between NDRG\ and NDRG2, 67% (81%) between NDRG\ and NDRG3 and 58%(7I%) between NDRG2 and NDRG3. These values are very similar t o the percent homology reported for the members of the mouse Ndr family [27]. Both mouse [27] and human NDRG2 and 3 lack the high-ly hydrophilic amino acid sequence motif (GTRSRSHTSE) typical of NDRG\ and repeated three times at its C-terminus.
Expression analysis of N D R G I The ubiquitous expression of NDRG\ is documented by 343 entries in UniGene Cluster Hs.75789 and by the previous studies using various experimental systems [20-24, 29]. No information has been published to date on the peripheral nervous system.To obtain a quantitative comparison of the levels of NDRG\ expression in dif-ferent tissues, we have performed SAGE library screening and database searches.The following results, presented as tags/106, were obtained: peripheral nerve 400;
colorec-tal cancer (HCTI 16) 213; glioblastoma multiformae libraries 210 and 99; brain 146; normal colon and some primary colon tumours 81-105; and prostate cancer 139,158.The above values indicate that NDRG I is abundantly expressed in peripheral nerve, where the levels of expression are significantly in excess of those in the other tissues examined.
Table 2. Single Nucleotide Polymorphisms (SNPs) Identified in NDRGI and VV/SP/
Gene SNP Nucleotide Position Ethnic background
NDRGI T/G 5'UTR; ntl5a Afro-American
C/T 5'UTR, nt3^ Dutch; Roma C/T Intronic; IVSI+48 Dutch; Roma C/T Intronic; IVS2-5 Afro-American C/T Intronic; IVS6-33 Afro-American; Dutch; Roma A/G Intronic; IVS10+83 Dutch
A/C Intronic; IVS 10-50 Afro-American; Dutch; Roma C/T Intronic; IVS I 1-7 Roma
C/T Intronic; IVS 13+147 Afro-American; Dutch; Roma A/G (293Pro^Pro) E x o n l 4 ; 9 8 9b Afro-American
A/C Intronic; IVS 14-1 24 Afro-American A/G 3'UTR 1395b Afro-American WISP I C/T(307Asn^Asn) Exon 5; 1009^ Roma
aPosition relative to N D R G I 5'UTR novel sequence (GenBank Accession #AF230380) bPosition relative t o m R N A for RTP (GenBank Accession number D87953)
cPosition relative to m R N A WISP I (GenBank Accession number AFI 00779
N o r t h e r n blot analysis, comparing total adult peripheral nerve RNA, cultured non-myelinating Schwann cells and hNT2 cells, which can be induced to neuronal differ-entiation showed strong signal in total peripheral nerve and Schwann cells; expres-sion was lower in undifferentiated hNT2 cells; no signal was obtained in differentiated hNT2. In view of the high sequence homology between the genes of the NDRG fami-ly and the possibility of cross-hybridisation, these results were verified and confirmed by RT-PCR using NDRGI-specific primers (Figure 3). Our preliminary immunocyto-chemistry findings in peripheral nerve point to NDRG\ localisation in the Schwann cell cytoplasm, with no evidence of axonal expression (not shown).
We have used 5'-RACE and RT-PCR to check for the presence of tissue-specific N D R G I transcripts in peripheral nerve, fetal brain and lymphocytes. 5'-RACE did not provide evidence of different transcription start sites: these experiments identified a short (15 nt) novel additional sequence immediately upstream of the 5'UTR of longest published NDRGI sequence [21], which however was common to all three transcripts. RT-PCR, followed by sequencing, of the entire coding region of NDRG\ in peripheral nerve, fetal brain and lymphocytes revealed a single transcript, identical to the published c D N A sequence, with no evidence of tissue-specific alternatively spliced forms.
D i s c u s s i o n 93
Figure 3 RT-PCR using specific NDRGI primers in I) hNT2 cells, not differentiated, 2) hNT2 cells induced to neuronal differentiation, 3) in vitro cultured non-myelinating Schwann cells, 4) total adult peripheral nerve, 5) fetal brain. NDRGI specificity was confirmed by transferring the RT-PCR products t o a membrane and back hybridising w i t h the PCR product.
Discussion
The heterogeneous category of hereditary motor and sensory neuropathies consists of a large number of clinically and genetically distinct conditions (recently reviewed in [31, 32], including autosomal recessive forms, some of which have been placed on the human genetic map [33-37]. Relative to autosomal dominant CMT disease, these conditions are rare. However, they are clinically more severe [38] and less likely to result from mutations in structural myelin proteins, therefore understanding their genetic basis may provide an insight into hitherto unknown molecular mechanisms of peripheral nervous system development and axon-glia interactions. The genetic het-erogeneity of autosomal recessive peripheral neuropathies and the limited number and size of families affected by any single disorder, have presented a major obstacle t o molecular research and gene identification. In the case of HMSNL, positional cloning was facilitated by the substantial number of patients identified over a short period of time after the initial description of the disease, as well as by the history of the disease-causing mutation. HMSNL occurs in an ethnic group that is marginalised by most health care systems, therefore ascertainment can be predicted to be limited. The number of affected individuals already diagnosed suggests that the disease is relatively common and may be the prevalent form of peripheral neuropathy among the Roma. On the other hand, the origin of the HMSNL mutation has been estimated to pre-date the arrival of the proto-Roma in Europe [ I ] , indicating that the mutation was present in the ancestral population before it split into numerous small groups separated by geographic dispersal, social pressures and rules of endogamy.The independent evolution and diversification of disease haplotypes in the different Romani groups across Europe has provided a powerful tool for the refined mapping of the HMSNL gene.
The molecular defect shared by all affected individuals was found to be a truncating mutation in N-myc downstream regulated gene I. This gene encodes a highly con-served protein with a high degree of homology to the proteins in other species.The
94 Chapter 4
amino acid similarity is 44% t o the Drosophila protein, 48% to sunflower [27], 75% to rat 8dm I [28] and 96% to mouse Ndrl [26]. These proteins show no homology to known motifs, except for a putative phosphopantetheine-binding site [20, 2 1, 29] and a 46% similarity t o the ligand-binding domain of the inositol 1,4,5-triphosphate receptor [27].
The evolutionary conservation of NDRG I -related proteins points to an important biological role. The previously proposed functions of human NDRG\ are based on studies of non-neural tissues. NDRG I has been shown to be repressed in cell trans-formation [20, 24] and upregulated in growth-arrested differentiating cells [20, 24, 29] and under conditions of cellular stress [21-23]. Inducing agents include p-" [24], increased intracellular Ca2 + and forskolin [22], retinoic acid and vitamin D [29].
NDRG\ expression has been shown to cycle with cell division [24] and studies of the intracellular localisation of the protein suggest translocation between the cytoplasm and the nucleus [20, 24, 29]. A role as a developmental gene has been documented for Ndr I, which, in the mouse embryo, is repressed, by N-myc and upregulated in cells committed to terminal differentiation [26].The accumulated data suggest involvement in growth arrest and cell differentiation during development, and in the maintenance of the differentiated state in the adult, possibly as a signalling protein shuttling between the cytoplasm and the nucleus.
In terms of patterns of expression and proposed general functions, NDRG I clearly resembles PMP22/gas3. PMP22 is also widely expressed in embryonic and adult tis-sues [39,40] and believed t o be involved in growth arrest and cell differentiation [41, 42].The highest levels of expression are found in the myelinating Schwann cell where PMP22 is a component of compact myelin [43]. PMP22 is now known to be respon-sible for CMT disease type I A, hereditary neuropathy with liability t o pressure palsies and some forms of Dejerine-Sottas syndrome in humans [39, 44-47] and for natural-ly occurring models of peripheral neuropathy in the mouse [48, 49]. A number of studies of affected humans, as well as of natural and transgenic rodent models, have pointed t o the complex pathogenesis of these disorders where altered myelin stabil-ity and demyelination are only one aspect. The observed significant phenotypic changes in both Schwann cells and axons [9-12, 50] have suggested that, in addition t o its function as a myelin protein, PMP22 plays a role in early PNS development and differentiation and in Schwann cell-axonal interactions (reviewed in [51]).
Axons and glia in the peripheral nervous system are involved in a most complex system of communication, whose integrity is essential for the differentiation, survival and normal function of both types of cell [52-54].The involvement of NDRG\ in these mechanisms, and a possible functional link to PMP22, remain to be investigated in functional studies, as well as through the identification of NDRG\ mutations in other peripheral neuropathies.The high levels of NDRGI expression in peripheral nerve and specifically in the Schwann cell, together with the characteristics of the HMSNL
phe-Discussion 95
notype point to a possible involvement of NDRG\ in the Schwann cell differentiation and the signalling necessary for axonal survival.The role of NDRG\ in growth arrest and cell differentiation, proposed for other tissues, may thus be conserved in the PNS and related to the complex developmental transitions marking the stages of differen-tiation of the Schwann cell lineage and Schwann cell-axonal interactions [53, 54]. A t the same time, the abundant expression in adult peripheral nerve, and the putative phosphopantetheine-binding domain present in the NDRG\ protein, point to a possi-ble dual role and additional involvement in the lipid biosynthetic pathways operating in the myelinating Schwann cell.
A c k n o w l e d g m e n t s
We thank all affected families for their participation in the study; clinical colleagues for referring patients for genetic analysis; Jeroen Vreijling, Danielle Dye and Anthony Akkari for expert technical assistance and Garth Nicholson for providing normal peripheral nerve tissue. The study was supported by the Australian National Health & Medical Research Council, the Muscular Dystrophy Association of the USA and The Wellcome Trust.
Electronic database information The URLs and accession numbers for data in this article are as follows:
Online Mendelian Inheritance in Man (OMIM), http://www.ncbi.nlm.nih.gov/Omim/ (for HMSNL [MIM 601455]) http://www.genome.washington.edu/UWGC/ analysistools/phrap.htm/ http://genome.imb-jena.de/~schattev/ http://ftp.genome.washington.edu/RM/RepeatMasker.html/ http://dot.imgen.bcm.tmc.edu.-933 I /gene-finder/gf.html/ http://www.ncbi.nlm.nih.gov/sage/ http://www.ncbi.nlm.nih.gov/STS/elecpcr.cgi/ http://www.genome.wi.mit.edu/
GenBank, http://www.ncbi.nlm.nih.gov/Genbank (for BAC369M3 [AF I 86 I 90]; BAC 458A3 [ A F I 9 2 3 0 4 ] ; N D R G I (RTP) mRNA [D87953]; NDRG I 5'UTR novel sequence [AF230380]; NDRG I UniGene cluster [Hs 75789]; NDRG I LocusLink [ID 10397]; sunflower SF2I [AF 189148]; D.melanogaster BcDNA.GH02439 [AF 145594]; Rattus norvegicus Bdm I [AF045564]; mouse N d r l [U60593); Ndr2 [AB03392I]; Ndr3 [AB033922]; sequences representing human NDRG2 [AF I 59092 and AB033074] and NDRG3 [AL03I662]
1. Kalaydjieva, L , et al., Gene mapping in Gypsies identifies a novel demyelinating neuropathy o n c h r o m o s o m e 8 q 2 4 . Nature Genetics, 1996. 14(2): p. 214-7.
2. M e r l i n i , L . et al.. Hereditary m o t o r and sensory n e u r o p a t h y Lorn type in an Italian Gypsy family. N e u r o m u s c u l a r Disorders, I 9 9 8 . 8 ( 3 - 4 ) : p. 182-5.
3. Butinar, D., et al.. Hereditary a u d i t o r y , vestibular, m o t o r , and sensory n e u r o p a t h y in a Slovenian R o m a (Gypsy) k i n d r e d . Annals of N e u r o l o g y , 1999. 46(1): p. 3 6 - 4 4 .
4. Baethmann, M.. et al., HMSNL in a 13-year-old Bulgarian g i r l . N e u r o m u s c u l a r D i s o r d e r s , 1998. 8(2): p. 9 0 - 9 4 .
5. C o l o m e r , j . , et al.. Hereditary m o t o r and sensory n e u r o p a t h y - L o r n ( H M S N L ) in a Spanish family: clinical, electrophysiological, pathological and genetic studies. N e u r o m u s c u l a r D i s o r d e r s , 2000.
10(8): p. 5 7 8 - 8 3 .
6. Kalaydjieva. L , et al.. H e r e d i t a r y m o t o r and sensory n e u r o p a t h y - - L o m . a novel demyelinating n e u r o p a t h y associated with deafness in gypsies. Clinical, electrophysiological and nerve biopsy findings. Brain. 1998. 121 (Pc 3 ) : p. 399-408.
7. K i n g , R., et al., U l t r a s t r u c t u r a l changes in peripheral nerve in h e r e d i t a r y m o t o r and sensory n e u r o p a t h y - L o r n . N e u r o p a t h o l o g y & A p p l i e d N e u r o b i o l o g y , I 999. 25(4): p. 306-1 2. 8. Killian, J., et al.. Longitudinal studies o f the d u p l i c a t i o n f o r m o f C h a r c o t - M a r i e - T o o t h
p o l y n e u r o p a t h y . Muscle and N e r v e , 1996. 19(1): p. 74-8.
9. Garcia, A., et al., C h a r c o t - M a r i e - T o o t h disease type I A w i t h I 7p d u p l i c a t i o n in infancy and early c h i l d h o o d . A longitudinal clinical and electrophysiologic study. N e u r o l o g y , I 998. 50(4): p. 106 I -67. I 0. Sancho, S., et al. Distal axonopathy in peripheral nerves of PMP22-mutant mice. Brain, 1999.
l 2 2 ( P t . 8 ) : p . 1563-1577.
I I. Sahenk, Z.. A b n o r m a l Schwann cell-axon i n t e r a c t i o n s in C M T neuropathies. T h e effect of m u t a n t Schwann cells o n the axonal c y t o s k e l e t o n and regeneration-associated m y e l i n a t i o n . Annals o f t h e N e w Y o r k A c a d e m y of Sciences, 1999. 883: p. 4 1 5 - 4 2 6 .
12. R o b e r t s o n , A . , et al.. Development of early postnatal p e r i p h e r a l nerve a b n o r m a l i t i e s i n T r e m b l e r - J and PMP22 transgenic mice. Journal of A n a t o m y , 1999. 195: p. 3 3 1 - 3 3 9 .
13. Chandler, D., et al.. Hereditary m o t o r and sensory neuropathy—Lorn ( H M S N L ) : refined genetic mapping in Romani (Gypsy) families f r o m several European c o u n t r i e s . N e u r o m u s c u l a r D i s o r d e r s , 2 0 0 0 . 10(8): p. 5 8 4 - 9 1 .
14. Raap, A . and J.Wiegant, Use o f D N A - h a l o preparations f o r h i g h - r e s o l u t i o n D N A in-situ H y b r i d i z a t i o n . M e t h o d s in Molecular B i o l o g y , 1994. 33: p. 123-130.
I 5. B i r n b o i m , H. and J. Doly, A rapid alkaline e x t r a c t i o n p r o c e d u r e f o r screening r e c o m b i n a n t plasmid D N A . N u c l e i c A c i d s Research, 1979. 7 ( 6 ) : p. 1513-23.
16. Mardis, E., H i g h - t h r o u g h p u t d e t e r g e n t e x t r a c t i o n of M I 3 subclones for f l u o r e s c e n t D N A sequencing. N u c l e i c Acids Research, I 994. 22: p. 21 73-75.
17. Michiels, E„ et al., Genes differentially expressed in m e d u l l o b l a s t o m a and fetal brain. Physiological G e n o m i c s , 1999. I: p. 83-91.
18. S a m b r o o k . J . , E. F r i t s c h . a n d T Maniatis, Molecular cloning: a l a b o r a t o r y manual. C o l d Spring H a r b o r L a b o r a t o r y Press, 1989.
References 9 7
19. Pennica, D., et o/.,WISP genes are m e m b e r s of the connective tissue g r o w t h f a c t o r family t h a t are upregulated in w n t - 1 - t r a n s f o r m e d cells and aberrantly expressed in human c o l o n t u m o r s . Proceeding N a t i o n a l Academy Science U S A , I 998. 9 5 ( 2 5 ) : p. 14717-22.
20. van Belzen, N., et a/., A novel gene w h i c h is upregulated d u r i n g c o l o n epithelial cell d i f f e r e n t i a t i o n and d o w n r e g u l a t e d in c o l o r e c t a l neoplasms. L a b o r a t o r y Investigation, 1997. 77( I ) : p. 8 5 - 9 2 . 2 1 . K o k a m e , K., H. K a t o , and T. Miyata, H o m o c y s t e i n e - r e s p o n d e n t genes in vascular endothelial cells
identified by differential display analysis. Journal of Biological Chemistry, 1996. 271 (47): p. 29659-29665. 22. Z h o u , D., K. Salnikow, and M. C o s t a , Cap43, a novel gene specifically induced by N i 2 + c o m p o u n d s .
Cancer Research, I 998. 58( 10): p. 2182-2189.
23. X u , B-, L. Lin, and N . Rote, Identification o f a stress-induced p r o t e i n d u r i n g human t r o p h o b l a s t d i f f e r e n t i a t i o n by differential display analysis. Biology o f R e p r o d u c t i o n , 1999. 61(3): p. 6 8 1 - 6 8 6 . 24. K u r d i s t a n i , S., et a/., Inhibition of t u m o r cell g r o w t h by RTP/rit42 and its responsiveness t o p53 and
D N A damage. Cancer Research, 1998. 58( 19): p. 4 4 3 9 - 4 4 4 4 .
25. A n t o n a r a k i s , S. and t . N . W . G r o u p . , R e c o m m e n d a t i o n s f o r a n o m e n c l a t u r e system f o r human gene m u t a t i o n s . H u m a n M u t a t i o n s , 1998. I I: p. 1-3.
26. S h i m o n o , A . , T . O k u d a . and H. K o n d o h , N - m y c - d e p e n d e n t repression o f N d r l , a gene identified by d i r e c t s u b t r a c t i o n of w h o l e mouse e m b r y o c D N A s b e t w e e n w i l d type and N-myc m u t a n t . Mechanisms o f D e v e l o p m e n t , 1999. 8 3 ( 1 - 2 ) : p. 39-52.
27. K r a u t e r - C a n h a m , R., et a/., A t r a n s m i t t i n g tissue- and pollen-expressed p r o t e i n f r o m s u n f l o w e r w i t h sequence similarity t o the human RTP p r o t e i n . Plant Science. 1997. 129: p. 191-202. 28. Yamauchi.Y, et a/.. Molecular cloning and c h a r a c t e r i z a t i o n o f a novel developmentally regulated
gene, Bdm I. showing p r e d o m i n a n t expression in postnatal rat brain. Brain Research and M o l e c u l a r Brain Research. 1999. 68(1-2): p. 149-158.
29. Piquemal. D., et a/., Differential expression of the RTP/Drg I / N d r l gene p r o d u c t in p r o l i f e r a t i n g and g r o w t h - a r r e s t e d cells. Biochimica Biophysica A c t a , 1999. 1450(3): p. 364-373.
30. O k u d a , T . and H. K o n d o h , Identification of new genes N d r 2 and N d r 3 w h i c h are related t o N d r l / R T P / D r g I but show distinct tissue specificity and response t o N - m y c . Biochemical and Biophysical Research C o m m u n i c a t i o n s , 1999. 2 6 6 ( 1 ) : p. 208-15.
3 I. Schenone, A . and G. Mancardi, Molecular basis o f i n h e r i t e d n e u r o p a t h i e s . C u r r e n t O p i n i o n in N e u r o l o g y , 1999. 12: p. 6 0 3 - 6 1 6 .
32. Keller, M. and P. Chance, Inherited peripheral neuropathy. Seminars in Neurology, 1999. 19: p. 353-62. 33. Ben O t h m a n e , K., et a/., Linkage o f a locus ( C M T 4 A ) f o r autosomal recessive C h a r c o t - M a r i e - T o o t h
disease t o c h r o m o s o m e 8 q . H u m a n Molecular Genetics, 1993. 2(10): p. 1625-8.
34. L e G u e r n , E., et a/., H o m o z y g o s i t y mapping of an autosomal recessive f o r m of demyelinating C h a r c o t - M a r i e - T o o t h disease t o c h r o m o s o m e 5q23-q33. Human Molecular Genetics, 1996. 5(10): p. 1685-8.
35. Bolino, A., et o/., Localization o f a gene responsible f o r a u t o s o m a l recessive demyelinating n e u r o p a t h y w i t h focally folded myelin sheaths t o c h r o m o s o m e I Iq23 by h o m o z y g o s i t y mapping and haplotype sharing. H u m a n M o l e c u l a r Genetics, 1996. 5(7): p. 1051-54.
9 8 C h a p t e r 4
o f t h e c o r p u s callosum maps t o c h r o m o s o m e I 5q. A m e r i c a n Journal of H u m a n Genetics, I 996. 5 8 ( 1 ) : p. 2 8 - 3 4 .
37. B o u h o u c h e . A . , et al., A locus f o r an axonal f o r m of a u t o s o m a l recessive C h a r c o t - M a r i e - T o o t h disease maps t o chromosome I q21.2-q21.3.American Journal of Human Genetics, 1999. 65(3): p. 722-777. 38. H a r d i n g , A . and P.Thomas, A u t o s o m a l recessive f o r m s o f h e r e d i t a r y m o t o r and sensory
neuropathy. Journal o f N e u r o l o g y N e u r o s u r g e r y and Psychiatry, 1980. 43(8): p. 669-678. 39. Patel, P., et a/.,The gene for t h e peripheral myelin p r o t e i n PMP22 is a candidate f o r C h a r c o t
-M a r i e - T o o t h disease type I A . N a t u r e Genetics, 1992. I (3): p. 159-65.
40. Baechner, D.. et o/., W i d e s p r e a d expression of the p e r i p h e r a l myelin p r o t e i n - 2 2 gene (PMP22) in the neural and nnon-neural tissues d u r i n g m u r i n e d e v e l o p m e n t . Journal of N e u r o s c i e n c e Research, 1995. 4 2 ( 6 ) : p. 7 3 3 - 4 1 .
4 1 . Z o i d l , G., et al.. Influence of elevated expression of rat w i l d - t y p e PMP22 and its m u t a n t PMP22Trembler on cell growth o f N I H 3 T 3 fibroblasts. CellularTissue Research, 1997.287(3): p. 459-470. 4 2 . M a n f i o l e t t i , G., et al., A growth arrest-specific (gas) gene codes f o r a m e m b r a n e p r o t e i n . M o l e c u l a r
& C e l l u l a r Biology. 1990. 10(3): p. 2 9 2 4 - 3 0 .
4 3 . Snipes, G., et al., C h a r a c t e r i z a t i o n of a novel peripheral nervous system myelin p r o t e i n ( P M P - 2 2 / S R I 3 ) . J o u r n a l of C e l l Biology, 1992. I 17(1): p. 2 2 5 - 2 3 8 .
4 4 . V a l e n t i j n , L . e t a/.,The peripheral myelin gene PMP-22/GAS-3 is duplicated in C h a r c o t - M a r i e - T o o t h disease type I A . N a t u r e Genetics, 1992. 1(3): p. 166-170.
4 5 . T i m m e r m a n , V . , et a/.,The peripheral myelin p r o t e i n gene PMP22 is c o n t a i n e d w i t h i n the C h a r c o t -M a r i e - T o o t h disease type I A d u p l i c a t i o n . N a t u r e Genetics, 1992. 1(3): p. 171-75.
4 6 . Roa, B., et al., Dejerine-Sottas s y n d r o m e associated w i t h p o i n t m u t a t i o n in the peripheral myelin p r o t e i n 22 (PMP22) gene. N a t u r e Genetics. 1993. 5 ( 3 ) : p. 2 6 9 - 2 7 2 .
4 7 . C h a n c e , P., et al., D N A deletion associated w i t h h e r e d i t a r y n e u r o p a t h y w i t h liability t o pressure palsies. C e l l , 1993. 7 2 ( 1 ) : p. 1 4 3 - 1 5 1 .
4 8 . Suter, U., et al, A leucine-to-proline m u t a t i o n in the putative first t r a n s m e m b r a n e d o m a i n o f the 2 2 - k D a p e r i p h e r a l myelin p r o t e i n in the trembler-J m o u s e . Proceeding National Academy Science U S A , 1992. 8 9 ( 1 0 ) : p. 4382-6.
4 9 . Suter, U., et al.,Trembler mouse carries a point mutation in a myelin gene. Nature, 1992. 356(6366): p. 241 -4. 50. H a n e m a n n , C , et o/., Schwann cell d i f f e r e n t i a t i o n in C h a r c o t - M a r i e - T o o t h disease t y p e I A
( C M T I A ) : n o r m a l number of myelinating Schwann cells in young C M T I A patients and neural cell adhesion m o l e c u l e expression in o n i o n bulbs. Acta N e u r o p a t h o l o g i c a ( B e r l ) , 1997, 94: p. 310-15. 5 I. Naef, R. and U. Suter, Many facets of the peripheral myelin p r o t e i n PMP22 in myelination and
disease. Miscroscopy Reasearch Techniques. I 998. 41 (5): p. 3 5 9 - 7 1 .
52. Snipes, G . and U. Suter, Signaling pathways mediating axon—Schwann cell i n t e r a c t i o n s . T r e n d s in N e u r o s c i e n c e , 1994. 17(10): p. 3 9 9 - 4 0 1 .
53. Jessen, K. and R. Mirsky, Origin and early d e v e l o p m e n t of Schwann cells. M i c r o s c o p y Research & T e c h n i q u e . I 998. 41 (5): p. 393-402.
54. Jessen, K. and R. Mirsky, Schwann cells and t h e i r p r e c u r s o r s emerge as m a j o r regulators of n e r v e d e v e l o p m e n t . T r e n d s in N e u r o s c i e n c e s . 1999. 22(9): p. 402-10.
