The search for a new bile acid receptor
Lisa Kroonen, student number 11671335
abstract
Bile acids have an important signaling role in the modulation of energy metabolism. An increase in bile acid signaling is associated with various positive metabolic effects. Some of these positive effects of bile acid signaling are still present in absence of G-protein-coupled bile acid receptor 1 (TGR5), which suggests that there is another receptor involved. A G protein-coupled receptor screen will be performed in order to discover which cell surface receptors are activated by bile acids. By looking into how to (over)activate these receptors that are reactive to bile acids, the positive metabolic effects of bile acid signaling could possibly be enlarged.
Introduction
Over the past few years, obesity has transformed into a major public health issue, with one third of the world’s adults being either obese or overweight [1]. Given the enormous physical and social impact of obesity, different methods of treating obesity have been investigated [2]. One method used to treat obese individuals is bariatric surgery. Bariatric surgery can lead to a decrease in body weight, which is associated with increased plasma bile acid concentrations and a reduced expression of Na+ taurocholate co-transporting polypeptide (NTCP) [3]. NTCP is the main bile acid uptake transporter in the liver [4].
Bile acids, which are produced in the liver from cholesterol, have an important role in the
emulsification and digestion of dietary fats, fat-soluble drugs and vitamins from the intestine. Bile acids are the main constitute of bile, together with cholesterol, bilirubin and phospholipids. After synthesis, bile is stored in the gall bladder, from where it will flow into the duodenum when food is ingested. In the terminal ileum, bile acids are absorbed and transported back to the liver via the portal vein, from where they will be taken up into the hepatocytes by NTCP [4].
After a meal, bile acid levels are increased in both the intestine and the liver, as well as in plasma. It has been shown that an increase in plasma bile acid levels can lead to a reduction in body weight and lower serum cholesterol [5-7].
To study the effects of prolonged postprandial plasma bile acid elevations, Donkers et al. (2019) intended to briefly activate bile acid signaling by inhibiting the hepatic reuptake of bile acids [6, 8]. A knockout (KO) of NTCP in mice resulted in a delay in plasma clearance of conjugated bile acids. These are bile acids which are conjugated by bacteria in the intestine with either glycine or taurine, and are often referred to as bile salts because of their acid-base properties [9]. In addition, conjugated bile acids are much more water soluble than unconjugated bile acids, which enables them to better fulfill their fat-emulsifying function.
It was found that the NTCP KO mice had a lower body weight than wild type (WT) mice [6]. This could be explained by an increase in energy expenditure. It was discovered that NTCP KO mice had a decreased caloric extraction from the high fat diet (HFD) and an increased energy expenditure compared to WT controls. In addition, it was shown that HFD-fed NTCP KO mice had a lower fat mass relative to their body weight, compared to HFD-fed WT mice.
The increase in energy expenditure was found to be the result of an increase in brown adipose tissue (BAT) thermogenesis [6]. BAT is specialized in burning fat as fuel through the uncoupling of
supplementation [10]. NTCP inhibition causes a systemic overflow of bile acids, which can lead to an increase in energy expenditure by BAT thermogenesis, likely resulting from increased mitochondrial uncoupling [6].
It has previously been discovered that bile acids are able to activate an assortment of receptors, in- and outside the enterohepatic system [11]. An important receptor that is activated by bile acids is the G-protein-coupled bile acid receptor 1 (GPBAR1 / TGR5). Activation of TGR5 has shown to decrease body weight and improve glucose tolerance [12, 13]. In addition, TGR5 is a well-established bile acid receptor affecting bile acid induced energy expenditure [14, 15]. However, continuous activation of this receptor has shown to cause side effects because it is in conflict with the
physiological bile acid dynamics, which follows a meal-dependent rhythm [16, 17]. To find out the role of TGR5 in the changes of the metabolic phenotype observed in the NTCP KO mice, TGR5-NTCP double KO (dKO) mice were compared to the NTCP KO mice [6]. It was discovered that TGR5-NTCP dKO mice were equally protected against diet induced obesity as NTCP KO mice.
It is still unclear how bile acids signal to decrease body weight gain in the absence of TGR5, and this might involve another bile salt receptor. In this project, it will be investigated how an increase in plasma bile acids can lead to a decrease in body weight gain. To find out which receptors can explain the metabolic phenotype observed in the NTCP KO mouse model, a G protein-coupled receptor (GPCR) screen will be performed, in order to discover which receptors are activated by bile salts [18].
Methods and Materials
Design of the screen
The GPCR screen will be performed using the PRESTO-Tango assay. This is a method for the simultaneous and parallel interrogation of the entire druggable human GPCR-ome. The principle behind the PRESTO-Tango screen is a G
protein-independent β-arrestin recruitment assay. The PRESTO-Tango kit contains a Tango construct for each GPCR. Kroeze et al. (2015) have described the all of the different elements present in the construct [18]. The principle behind this screen is schematically shown in figure 1. After the GPCR is activated by an agonist (1 in Figure 1), β-arrestin attached to a TEV-protease is recruited to the C-terminus of the receptor (2 in Figure 1). Following this, the GPCR fusion protein is cleaved at the TEV protease site (3 in Figure 1). Cleavage leads to the release of the tTA transcription factor, which is able to activate transcription of the luciferase reporter gene (5 in Figure 1), after being transported to the nucleus (4 in Figure 1). This will result in a measurable luminescence signal as a readout for receptor activation.
In addition to the GPCRs included in the screen, other receptors were also investigated. Mouse Tas2r receptors are bitter receptors. These receptors are mainly expressed in the tongue, but are also expressed in other parts of the body [19]. The Tas2r117, Tas2r123 and Tas2r144 have shown to be activated by taurocholic acid [20]. To investigate whether these receptors are responsible for the metabolic effects of increased bile acid levels, the receptors will also be added to the screen. In this project, the first few steps of the GPCR screen will be made. Because of the limited time of the project, only certain experiments of the screen could be performed. Only the experiments that
Figure 1
Schematic representation of the G protein-independent β-arrestin recruitment assay, edited from Kroeze et al. (2015)[18].
were performed during the time of the project will be extensively acknowledged in this report. The rest of the experiments that will need to be performed to finish the screen will be briefly introduced. Plasmid DNA purification
The PRESTO-Tango plasmid kit was obtained from Addgene Bryan (Addgene kit # 1000000068, created by Bryan Roth). The frozen glycerol stocks were pricked with a pipette tip and cultured in 2ml Luria-Bertani medium (LB-medium) with 1:1000 ampcilline (AMP, sigma) overnight. For the purification of the plasmid DNA, the Macherey-Nagel kit was used according to manufacturers instructions. DNA concentration and purity was assesed spectrophotometrically at 260 and 280nm using a Nanodrop 1000 (Thermo Scientific, Wilmington, US). To verify the isolated plasmid,
restriction digestions with Pst1 (New England Biolabs) were perfomed according to manufacturers instructions.
The pINDUCER13 (miR-LUP) construct was obtained from addgene (Addgene plasmid # 46936 ; http://n2t.net/addgene:46936 ; RRID:Addgene_46936, created by Thomas Westbrook). The
pRetroX-Tight-Pur Vector was obtained from Clontech, and the luciferase construct was cloned into the vector by Wouter Smit. The pCDNA3.1(+)-CMV-bArrestin2-TEV was obtained from Addgene (Addgene plasmid # 107245 ; http://n2t.net/addgene:107245 ; RRID:Addgene_107245, created by Bryan Roth). After transfer to an LB-agar plate, a colony was pricked and cultured in 2ml LB-medium with 1:1000 AMP overnight. For the purification of the plasmid DNA, the LabNed Plasmid Maxiprep Kit was used according to manufacturers instructions.
Cell culture, transfection and luciferase assay
Human Bone Osteosarcoma Epithelial (U2OS) cells were grown in Dulbecco's Modified Eagle Medium (DMEM, Lonza) supplemented with 2mM L-glutamine, 100 U/L penicillin/streptomycin (pen/strep, Lonza) and 10% fetal calf serum (FCS, Gibco). For transfection, cells were seeded in indicated density in 96-wells plate suitable for luciferase assay (3917, Corning)(day 1). On day 2, cells were transiently transfected with indicated amounts of plasmids complexed with polyethylenimine (PEI 1mg/ml; Polyscience) at a ratio of 1:5 (µg DNA: µg PEI). When indicated, the cells were treated with taurochenodeoxycholate (TCDCA) (T6260, Sigma), and/or doxycycline (DOX, Sigma). The reason DOX is added is because it is needed for the activation of the transcription of the luciferase gene. In the luciferase assay, every condition was done in triplicates. One Glo (Promega) was used as a luciferase reagent for the luciferase assay readout (day 4).
Different constructs in various combinations were transfected for the luciferase assay: • P-retro-x-tight luciferase: rtTA dependent luciferase gene
• pInducer13: rtTA independent luciferase gene (positive control) • pLenti-rtTA3: transcription factor
• TGR5-TANGO: construct for TGR5 from the PRESTO-TANGO kit (Name of TGR5 in the PRESTO-Tango plasmid kit: G-Protein Coupled Receptor-19 (GPR19))
• pCDNA3.1(+)-CMV-bArrestin2-TEV (ß-arrestin-TEV): β-arrestin attached to a TEV-protease PCR, gel extraction and TOPO-cloning
A PCR (polymerase chain reaction) was performed on mouse genomic DNA to obtain the constructs of the Tas2r117, Tas2r123 and Tas2r144 bitter taste receptors. The PCR reaction was performed using Dreamtaq HS Master mix according to manufacturer’s instructions (K9022, ThermoFisher scientific). A nested PCR was performed as an intermediate step to generate PCR products that can be used for development of a vector with the desired bitter taste receptor insert. This nested PCR was performed for Tas2r117 and Tas2r144.
Tas2r117 PCR Primers Tas2r144 PCR Primers
Fw 5’ TATGCACCAGCACAGGAGAG 3’ Rv 5’ TTGTGTGGAGAATGGAAAAGG 3’
Fw 5’ GCAAGAGAATGGAAGGCTGA 3’ Rv 5’ ATAACCGCCAGTTGTTCCAG 3’
The PCR-product was loaded on an agarose gel, and the band on the expected height was isolated using the zymoclean Gel DNA Recovery Kit according to manufacturer’s instructions (Zymo
Research). On the DNA recovered from the gel, a PCR was performed using the primers with the full gene and the CACC-overhang required for the TOPO-cloning with the pENTR™ Directional TOPO® Cloning Kit (Invitrogen).
Tas2r117 PCR Primers TOPO Tas2r123 PCR Primers TOPO
Fw 5’ CACCATGAAGCACTTTTGGAAGAT 3’ Rv 5’ GAATATACAACATAATCTAA 3’
Fw 5’ CACCATGTTTTCACAGAAAATAAA 3’ Rv 5’ GAGACCCATGGTGTCCATAT 3’
Tas2r144 PCR Primers TOPO
Fw 5’ CACCATGGCAATAATTACCACAAA 3’ Rv 5’ CCTTTTAAGGTAAAGATGAA 3’
The PCR-product was loaded on an agarose gel, and the band on the expected height was isolated using the zymoclean Gel DNA Recovery Kit according to manufacturer’s instructions.
For all PCR’s, the following gradient PCR program was used:
Step Temperature, ֯C Time Number of cycles
Initial denaturation 95 5 min 1
Denaturation 95 30 s
35
Annealing 50-60 30 s
Extension 72 1 min
Final extension 72 5 min 1
Transformation was perfomed by electroporation. For this, the TOPO reagent mix from the Zero Blunt™ TOPO™ PCR Cloning Kit (#450245) was prepared according to manufacurers protocol and added to 40µL of electrocompetent cells, and pulsed at 2.50kV. Correct transformation of the DNA inserts into the TOPO pENTRY vector was checked by using restriction enzymes (New England Biolabs). Restriction enzymes were selected with help of the software SnapGene.
Results
Optimizing the luciferase reporter assay
The cells treated with 500ng/mL of DOX (doxycycline) produced a higher luminescence signal compared to cells treated with 1µg/mL of DOX, independent of the amount of DNA added to the cells (45ng of P-retro-x-tight luciferase and 45ng of pLenti-rtTA3, or 20ng of P-retro-x-tight luciferase and 60ng of pLenti-rtTA3, Figure 2A). The cells seeded in a density of 0,2*105 cells/well
demonstrated a higher luminescence signal compared to cells seeded in a density of 0,1*105 cells/well (Figure 2B).
The cells incubated in medium with charcoal-treated FCS (C-FCS medium) resulted in a higher luminesce signal compared to cells incubated in DMEM+++ in all of the tested conditions (20ng or 30 ng of each construct (TGR5, P-retro-x-tight luciferase, β-arrestin-TEV (mix 1)) added, 4 hour or 24 hour incubation with 100µM TCDCA, Figure 3A). Cells transfected with 30ng of each construct of mix 1 per well resulted in a higher luminescence signal compared to cells transfected with 20ng of each construct of mix 1 per well, in all of the tested conditions (4 hour or 24 hour incubation with 100µM TCDCA, incubation in DMEM+++ or C-FCS medium, Figure 3B). Cells treated with no bile acids gave a
higher luminescence signal compared to cells incubated with TCDCA for 4 hours. Cells incubated in DMEM+++ with TCDCA for 24 hours gave a higher luminescence signal compared to cells without TCDCA treatment, while cells in the C-FCS medium with a TCDCA treatment for 24 hours had a lower luminescence signal compared to the cells without any TCDCA treatment (Figure 3C). Cells with similar treatments (transfection with 30ng of each construct of mix 1, 4 hour incubation with 100µM TCDCA in DMEM+++) displayed a higher signal in absence of DOX, compared to cells where DOX was added (Figure 3D). Cells transfected with pInducer13 demonstrated a higher luminescence signal in a dose-dependent matter if more of the pInducer13 construct was added (20 ng/well, 50 ng/well and 70ng/well, Figure 3E). Cells transfected with this construct gave a higher luminescence signal if DOX was added, compared to cells where no DOX was added.
Nested PCR and TOPO-cloning
The Tas2r117, Tas2r123 and Tas2r144 constructs obtained using TOPO-primers were transformed into electrocompetent cells together with the pEntry vector. Incubation of the transformed electrocompetent cells on agar plates led to the development of only small, sparse colonies. After incubation of these colonies in LB-medium, only the medium with the bacteria transformed with the Tas2r123 gene and the control was cloudy, the bacteria transformed with Tas2r117 and Tas2r144 did not grow. The Tas2r123 and control cultures were miniprepped and the constructs were validated using several restrictions (Supplemental Figure 1). The bands on the gel were generally as expected, analysis of the data can be found in Supplemental Figure 2.
Discussion
In this project, the first steps in the search towards a new bile acid receptor were made. Previously, it has been demonstrated that activation of bile acid receptors can lead to a decrease in body weight and an increase in glucose tolerance [5, 7, 13]. TGR5 is a well-established bile acid receptor affecting bile acid induced energy expenditure [14, 15]. However, it was discovered that TGR5-NTCP dKO mice were equally protected against diet induced obesity as NTCP KO mice [6]. Therefore, bile acid
Figure 2: The optimal amount of DOX and the optimal cell seeding density
(A, B) U2OS cells were seeded at day 1 in different cell seeding densities. On day 2, the cells were transiently transfected with different amounts of p-lenti-rtTA3
and p-x-retro-tight luciferase and different amounts of DOX were added. The luminescence is corrected for the background signal (the average value of the negative control is subtracted from the value of the sample). Lum: Luminescence, AU: Arbitrary units.
1:1 DNA = 45ng p-x-retro-tight-luciferase : 45ng p-lenti-rtTA3 1:3 DNA = 20ng p-x-retro-tight-luciferase : 60ng p-lenti-rtTA3
(A) Luminescence (AU) of cells transfected with 1:1 DNA or 1:3 DNA, and treated with 500ng/mL DOX or 1µg/mL DOX in a cell seeding density of 0,2*105 cells per well. (B) Luminescence of cells in a cell seeding density of 0,1*105 or 0,2*105 cells per well. The cells are transfected with 1:1 DNA or 1:3 DNA, and treated with 500ng/mL DOX or 1µg/mL DOX.
signaling related to body weight gain and energy expenditure might involve a different bile acid receptor than TGR5. In this project, a start was made in the search for a different bile acid receptor that could explain the metabolic effects of increased bile acid signaling.
Different conditions within the luciferase assay were investigated, and the assay was optimised. In the first optimization, the optimal amount of DOX and the optimal cell seeding density were found. However, the background signal of the assay was very high. Some of the samples of which was expected that they should have had a relatively high signal, had a lower value than the negative control (no transcription factor construct added). In retrospect, it could be that the construct for the transcription factor (pLenti-rtTA3) was not correct. After the ambiguous results of the transfection, there were several attempts to digest the transcription factor construct, in order to validate it. Several different enzymes were tried, but none resulted in the fragments that could be expected. Therefore, it could be that the ambiguous results of this assay can be explained by a faulty transcription factor construct.
In the second assay, a lower background signal was achieved. In addition, more negative controls were added (untransfected cells). In this optimization assay, the optimal amount of DNA to be added
Figure 3 The optimal medium and the optimal amount of DNA
(A-E) U2OS cells were seeded on day 1, in DMEM+++. On day 2, the old medium was removed and the cells were transiently transfected with different amounts
of DNA (TGR5-TANGO, β-arrestin-TEV and p-retro-x-tight luciferase for the samples, and pInducer13 for the positive control) in different media. All cells were seeded in a cell seeding density of 0,2*105 cells per well. TCDCA (100uM) and/or DOX (500ng/well) were added to the wells. The transfection mix was refreshed after 4 hours or 24 hours. After this time, the same medium as was in the transfection mix was added again. The luminescence is corrected for the background signal (the average value of the negative control is subtracted from the value of the sample) (A) The luminescence of cells incubated in either DMEM+++ or medium with C-FCS. The cells were transfected with 20ng or 30ng of each construct in mix 1, and the cells were treated for 4 hours or 24 hours with TCDCA. All of the cells were treated with DOX. (B) The luminescence of cells transfected with either 20ng or 30ng of each construct in mix 1. The cells were incubated in DMEM+++ or C-FCS medium, and treated with TCDCA for either 4 hours or 24 hours. All cells were treated with DOX. (C) Luminescence of cells treated with TCDCA and DOX for either 4 hours or 24 hours, and incubated in DMEM+++ or C-FCS medium. All cells were transfected with 30ng of each construct in mix 1. (D) Luminescence of cells treated with 30ng of each construct in mix 1, and incubated with TCDCA for 4 hours in DMEM+++. (E) Luminescence of cells transfected with pInducer13.
TCDCA 100 uM 4 hours 4 hours 24 hours 24 hours DMEM+++ + - + - C-FCS medium - + - +
was determined. Interestingly, the cells grown in medium with charcoal-treated FCS gave a higher luminescence signal compared to cells grown in DMEM+++. Because bile acids activate TGR5 and this leads to a luminescence signal, one could expect that cells grown in medium with FCS that included some bile salts would give off in a higher luminescence signal compared to cells grown in medium stripped of all bile salts normally present in the FCS. However, the opposite was observed during the optimization assay. In addition, cells without any bile salt treatment gave a higher luminescence signal compared to cells treated with TCDCA. Further optimization and repetition of the assay is necessary to explain these results.
Surprisingly, DOX addition did not result in an increased luminescence signal compared to a negative control with no addition of DOX. DOX is necessary for the transcription of the luciferase gene, without addition of DOX one would expect no transcription of the luciferase gene and therefore no luminescence signal. Interference of the high luciferase expression in the neighbouring wells, the positive controls, could explain this observation. In further assays, problems like this could be solved by randomising the plate layout. However, the plates that were used were designed especially for these kinds of luminescence assays, so one could expect that there would be little to no interference of the luminescence signal between different wells.
In preparation for the TOPO-cloning, electrocompetent cells were transformed with the Tas-receptor expression vector or a control construct and the pEntry-vector provided in the kit. Only the bacteria transformed with the control construct and the Tas2r123 construct grew, the bacteria transformed with the Tas2r117 and the Tas2r144 construct did not grow in the LB-medium. It could be that the transformation of these two genes was not successful, and therefore the resistance gene was not expressed.
Now that these first steps in the search for a new bile acid receptor have been made, further steps in the development of the luciferase assay regarding the GPCR screen can be taken. First, the the optimization of the luciferase assay has to be continued, in order to explain some of the ambigues results discovered during this project. After that, the PRESTO-Tango luciferase assay can be perfomed, likely resulting in the discovery of several receptors activated by bile acids. After the reactivity of these receptors has been validated, it would be interesting to investigate the expression and activity in different tissues and cell types. It would be especially interesting to investigate the expression of the bile acid reactive receptors in the brown adipose tissue, to find out the role of these receptors in energy expenditure. The ultimate aim is to find the bile acid receptor(s) that is/are responsible for the metabolic effects of (increased) bile acid signaling. By then looking into how to (over)activate these receptors, the positive metabolic effects of bile acid signaling can be enlarged.
Supplemental Figure 1 Validation of transformed constructs
An agarose gel was loaded with several digestions of the Tas2r123 construct and the control construct in the pEntry vector. On both sides, a smartladder is loaded.
1. control miniprep+ PvuII: expected: band ~1350bp (with the insert in it) and
~2000bp
result: as expected
2. Tas2r123 miniprep + ScaI: expected: band ~192bp (cuts in insert) and band
~3500bp
result: enzyme has not cut in insert. Sample looks similar to unrestricted sample
3. Tas2r123 miniprep + PvuII: expected: band ~1600 bp (with the insert in it) and
~2000bp
result: as expected
4. Tas2r123 insert: expected: band ~1000bp
result: as expected
5. control insert: expected: band ~750bp
result: as expected
6. Tas2r123 + pEntry vector (mininprep): expected: band ~ 3500bp
result: as expected, with second lower band, possibly because the DNA is circular
7. control + pEntry vector (miniprep): expected: band ~3250bp
result: as expected, with second lower band, possibly because the DNA is circular
Supplemental Figure 2 Validations of Tas2r123 and control construct
Expected band sizes and results of the digestions of the Tas2r123 construct and the control construct in the pEntry vector.
1000 2000
400 Band size (bp)
References
[1] J.C. Seidell, J. Halberstadt, The global burden of obesity and the challenges of prevention, Ann Nutr Metab, 66 Suppl 2 (2015) 7-12.
[2] V. Narayanaswami, L.P. Dwoskin, Obesity: Current and potential pharmacotherapeutics and targets, Pharmacol Ther, 170 (2017) 116-147.
[3] H. Ma, M.E. Patti, Bile acids, obesity, and the metabolic syndrome, Best Pract Res Clin Gastroenterol, 28 (2014) 573-583.
[4] C. Thomas, R. Pellicciari, M. Pruzanski, J. Auwerx, K. Schoonjans, Targeting bile-acid signalling for metabolic diseases, Nat Rev Drug Discov, 7 (2008) 678-693.
[5] M. Watanabe, S.M. Houten, C. Mataki, M.A. Christoffolete, B.W. Kim, H. Sato, N. Messaddeq, J.W. Harney, O. Ezaki, T. Kodama, K. Schoonjans, A.C. Bianco, J. Auwerx, Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation, Nature, 439 (2006) 484-489. [6] J.M. Donkers, S. Kooijman, D. Slijepcevic, R.F. Kunst, R.L. Roscam Abbing, L. Haazen, D.R. de Waart, J.H. Levels, K. Schoonjans, P.C. Rensen, R.P. Oude Elferink, S.F. van de Graaf, NTCP deficiency in mice protects against obesity and hepatosteatosis, JCI Insight, 5 (2019).
[7] V. Salem, C. Izzi-Engbeaya, C. Coello, D.B. Thomas, E.S. Chambers, A.N. Comninos, A. Buckley, Z. Win, A. Al-Nahhas, E.A. Rabiner, R.N. Gunn, H. Budge, M.E. Symonds, S.R. Bloom, T.M. Tan, W.S. Dhillo, Glucagon increases energy expenditure independently of brown adipose tissue activation in humans, Diabetes Obes Metab, 18 (2016) 72-81.
[8] D. Slijepcevic, C. Kaufman, C.G. Wichers, E.H. Gilglioni, F.A. Lempp, S. Duijst, D.R. de Waart, R.P. Elferink, W. Mier, B. Stieger, U. Beuers, S. Urban, S.F. van de Graaf, Impaired uptake of conjugated bile acids and hepatitis b virus pres1-binding in na(+) -taurocholate cotransporting polypeptide knockout mice, Hepatology, 62 (2015) 207-219.
[9] A.F. Hofmann, L.R. Hagey, Key discoveries in bile acid chemistry and biology and their clinical applications: history of the last eight decades, J Lipid Res, 55 (2014) 1553-1595.
[10] E.P. Broeders, E.B. Nascimento, B. Havekes, B. Brans, K.H. Roumans, A. Tailleux, G. Schaart, M. Kouach, J. Charton, B. Deprez, N.D. Bouvy, F. Mottaghy, B. Staels, W.D. van Marken Lichtenbelt, P. Schrauwen, The Bile Acid Chenodeoxycholic Acid Increases Human Brown Adipose Tissue Activity, Cell Metab, 22 (2015) 418-426.
[11] L. Vitek, M. Haluzik, The role of bile acids in metabolic regulation, J Endocrinol, 228 (2016) R85-96.
[12] F.S. van Nierop, M.J. Scheltema, H.M. Eggink, T.W. Pols, D.P. Sonne, F.K. Knop, M.R. Soeters, Clinical relevance of the bile acid receptor TGR5 in metabolism, Lancet Diabetes Endocrinol, 5 (2017) 224-233.
[13] S. Fang, J.M. Suh, S.M. Reilly, E. Yu, O. Osborn, D. Lackey, E. Yoshihara, A. Perino, S. Jacinto, Y. Lukasheva, A.R. Atkins, A. Khvat, B. Schnabl, R.T. Yu, D.A. Brenner, S. Coulter, C. Liddle, K.
Schoonjans, J.M. Olefsky, A.R. Saltiel, M. Downes, R.M. Evans, Intestinal FXR agonism promotes adipose tissue browning and reduces obesity and insulin resistance, Nat Med, 21 (2015) 159-165. [14] M. Zhong, TGR5 as a therapeutic target for treating obesity, Curr Top Med Chem, 10 (2010) 386-396.
[15] A. Tiwari, P. Maiti, TGR5: an emerging bile acid G-protein-coupled receptor target for the potential treatment of metabolic disorders, Drug Discov Today, 14 (2009) 523-530.
[16] D.A. Briere, X. Ruan, C.C. Cheng, A.M. Siesky, T.E. Fitch, C. Dominguez, S.G. Sanfeliciano, C. Montero, C.S. Suen, Y. Xu, T. Coskun, M.D. Michael, Novel Small Molecule Agonist of TGR5 Possesses Anti-Diabetic Effects but Causes Gallbladder Filling in Mice, PLoS One, 10 (2015) e0136873.
[17] A.H. Ali, E.J. Carey, K.D. Lindor, Recent advances in the development of farnesoid X receptor agonists, Ann Transl Med, 3 (2015) 5.
[18] W.K. Kroeze, M.F. Sassano, X.P. Huang, K. Lansu, J.D. McCorvy, P.M. Giguere, N. Sciaky, B.L. Roth, PRESTO-Tango as an open-source resource for interrogation of the druggable human GPCRome, Nat Struct Mol Biol, 22 (2015) 362-369.
[19] M. Behrens, S. Foerster, F. Staehler, J.D. Raguse, W. Meyerhof, Gustatory expression pattern of the human TAS2R bitter receptor gene family reveals a heterogenous population of bitter responsive taste receptor cells, J Neurosci, 27 (2007) 12630-12640.
[20] K. Lossow, S. Hubner, N. Roudnitzky, J.P. Slack, F. Pollastro, M. Behrens, W. Meyerhof, Comprehensive Analysis of Mouse Bitter Taste Receptors Reveals Different Molecular Receptive Ranges for Orthologous Receptors in Mice and Humans, J Biol Chem, 291 (2016) 15358-15377.
