Evaluation of the phenotype of Bmal1 KO
mice and modulation of cocaine-induced
reward
Abstract
Brain and Muscle Arnt-like Protein 1 (BMAL1) is an essential component of the molecular clock underlying circadian rhythmicity. However, existing evidence regarding KO mice is limited. In the present study, we investigated the behavioral and neurobiological consequences of Bmal1 gene deletion in mice, as well as how these alterations affect rewarding effects of cocaine. For this purpose, a number of experiments were performed to determine the general phenotype, memory and emotional behaviors. Behavioral testing included spontaneous locomotor activity, elevated plus maze, Y-maze, novel object recognition (NOR), social interaction, social novelty, and tail suspension test. Following, we performed a conditioning place preference, and cocaine sensitization paradigms. Additionally, collected samples of prefrontal cortex were assessed by means of a real-time quantitative PCR. Our results provide evidence of several behavioral alterations experienced by Bmal1 KO mice including: altered locomotor activity with impaired habituation to environments, and social recognition impairment. Furthermore, Bmal1 KO mice experienced standard rewarding effects of cocaine but lower behavioral sensitization to the drug. Lastly, Bmal1 deletion did not influence the expression of other clock related genes in the PFC. Overall, the present article offers a novel and extensive characterization of Bmal1 KO animals. Additionally, we provide further evidence relating first steps into the relationship between circadian rhythm and substance use disorder.
Keywords: Circadian rhythms, substance use disorder, addiction, cocaine, Bmal1 Abbreviations:
BMAL1: Brain and Muscle Arnt-like Protein 1 CCG: Circadian clock genes
CLOCK: Circadian Locomotor Output Cycles Kaput
CPP: Condition place preference
CRSWDs: circadian rhythm sleep-wake disorders CRY: Cryptochrome
D2R: Dopamine 2 receptor DA: Dopamine
EPM: Elevated Plus Maze i.p.: intraperitoneal KD: Knock-down
KO: Knock-out
NOR: Novel object recognition PCR: polymerase chain reaction PER: Period
PFC: Prefrontal cortex
ROREs: Retinoic acid-related orphan receptor response elements
SCN: Suprachiasmatic nucleus SUD: substance use disorder TST: Tail suspension test WT: Wildtype
Introduction
Circadian rhythms are natural cyclical processes that occur in most living organisms. They regulate countless essential metabolic, physiological and behavioral patterns (C. Dibner & Schibler, 2015). Biochemical phenomena like hormone secretion and body temperature fluctuations (Scales et al., 1988; Weitzman, 1976) rely heavily on circadian rhythmicity as well as neurobiological events such as cerebrovascular functioning, brainwave activity and neurotransmitter system regulation (Kiehn et al., 2019; Purawijaya et al., 2015; Videnovic & Zee, 2015).
Importantly, disturbances in circadian rhythms lead to a number of detrimental consequences besides disruption of sleeping patterns (Zhu & Zee, 2012). In fact, epidemiological studies suggest that circadian rhythm disruption is a significant risk factor for the development of cancer, metabolic syndrome and neurodegenerative diseases (Shanmugam et al., 2013; Videnovic & Zee, 2015). Additionally, circadian rhythm sleep-wake disorders (CRSWDs) have been associated to a number of mood diseases like affective and substance use disorders (SUDs) (Hasler et al., 2014; Kripke et al., 2009).
Despite their clear clinical significance, CRSWDs are often overlooked and surprisingly underdiagnosed (Reddy & Sharma, 2020). Research from the late nineties, estimated that 0.72% of the adult population in Norway suffered from a CRSWDs (Schrader et al., 1993). Unfortunately, these data have not been updated since, and thus, extrapolating to modern day conditions might be difficult. A more recent clinical approach has estimated that, 10% of adult patients with sleep disorders suffer from a basal CRSWDs (Barion & Zee, 2007). These numbers are difficult to estimate as CRSWD patients are
often diagnosed with insomnia, leading to a misrepresentation of the authentic incidence (Reddy & Sharma, 2020). Nowadays, data regarding prevalence of circadian rhythm disruption is limited. However, it is estimated to be much higher than in past decades due to, among other reasons, the increase on the use of screen dependent tools at night (Hatori et al., 2017). These devices emit hazardous blue light which disturbs circadian rhythms and gives rise to metabolic abnormalities
(Cajochen et al., 2011; Nagai et al., 2019; Tosini et al., 2016). Common consequences include delayed onset of sleep and circadian misalignment (reviewed in: Cain & Gradisar, 2010). As a result, to cope with sleepiness, individuals might rely on the use of stimulating substances like nicotine, caffeine and other illicit drugs (Paiva et al., 2016; Sivertsen et al., 2015).This immediate threat to circadian functionality increases the need for research that expands our knowledge on the topic.
In order to understand how light and other stimuli can disrupt circadian rhythmicity, we need to understand how circadian rhythms rely on light to synchronize the body’s daily cycle
Molecular mechanisms of the biological clock
Circadian rhythms are synchronized to the 24h day due to external timing cues named Zeitgebers (German: zeit-time and geber-giver). Light is the main Zeitgeber for most mammals and therefore, their biochemical patterns are fundamentally orchestrated by the light–dark (LD) cycle (Daan & Pittendrigh, 1976). Photic information is received by specialized tissues like the retina and processed by the suprachiasmatic nucleus (SCN) (Dibner et al., 2010). This hypothalamic area is in charge of coordinating independent peripheral oscillators in order to synchronize a
coherent rhythm at organismal levels (Yamazaki et al., 2000). At a molecular level, cellular time information is indicated by transcriptional and translational negative feedback loops regulated by the core clock components (Reppert & Weaver, 2002). They are defined as genes coding for essential proteins for circadian rhythms generation within individual cells throughout an individual’s cells (Takahashi, 2004).
In the primary feedback loop, the positive side encompasses the Circadian Locomotor Output Cycles Kaput (CLOCK) and Brain and Muscle Arnt-like Protein 1 (BMAL1) genes (Lowrey & Takahashi, 2011). Their transcription leads to the production of their respective proteins which then bind to form a CLOCK:BMAL1 heterodimer (Huang et al., 2012). During the active cycle, CLOCK:BMAL1 initiates the transcription of a number of target genes with E-box enhancer sequences (Ripperger & Schibler, 2006). It is estimated that the expression levels of 10% of all mammalian genes oscillate with a period of circa 24 hours (Storch et al., 2002). These thousands of circadian clock genes (CCG) modulate multiple essential physiological processes in a tissue- and day-time specific manner (Storch et al., 2002; Yan et al., 2008). Importantly, CLOCK:BMAL1 is indirectly responsible for its own inhibition by initiating the transcription of proteins from the negative side of the feedback loop (Gekakis et al., 1998). These include the Period genes (Per1 and Per2) and the Cryptochrome genes (Cry1 and Cry2) (Kume et al., 1999; Zheng et al., 2001). Their resulting proteins PER1&2 and CRY1&2 come together to form a dimer that reduces the transcription efficiency of CLOCK:BMAL1 (Kume et al., 1999; Sangoram et al., 1998) enabling the cycle to be repeated from a low transcriptional activity level. Afterwards, PER1&2 and CRY1&2 are enzymatically phosphorylated and polyubiquinated, and
therefore, targeted for proteasomal degradation (Busino et al., 2007; Lamia et al., 2009). Their elimination is fundamental to cease the repression phase and reset the transcriptional activity of CLOCK:BMAL1. Secondarily, an additional regulatory loop prompted by CLOCK:BMAL1 occurs simultaneously (Guillaumond et al., 2005). The formation of this heterodimer leads to the activation of the transcription of retinoic acid-related orphan nuclear receptors Rev-erb𝛼 and Ror𝛼 (Sato et al., 2004; Triqueneaux et al., 2004). Once transcribed, their corresponding proteins compete to bind to retinoic acid-related orphan receptor response elements (ROREs) which are present in the Bmal1 promoter region (Guillaumond et al., 2005). In this manner, they are able to regulate BMAL1 expression. On one hand, RORs α, β and γ activate transcription of Bmal1 (Akashi & Takumi, 2005) whereas REV-ERBs (α and β) are able to repress it (Guillaumond et al., 2005; Ikeda et al., 2019). Therefore, the circadian oscillation of BMAL1 expression is positively and negatively regulated by RORs and REV-ERBs, which also depend on its own activation. This is often referred as the BMAL1 loop.
The above described autoregulatory feedback loops (Figure 1) complete a cycle around every 24 hours and constitute the circadian molecular clock (Ko & Takahashi, 2006). All these molecules have been key for circadian rhythm research in the past decades. Along with their role in the control of rhythmicity, clock genes are thought to have a more extensive impact on cognition, mood, anxiety and reward-related behaviors (Wulff et al., 2010). In vivo, a typical approach to studying this topic is to genetically delete or alter particular clock genes in order to assess the resulting phenotypes. For this, series of knock-out (KO) models have been developed and
studied, nevertheless, multiple knowledge gaps remained to be explored in this field. BMAL1 is arguably the most relevant protein contributing to the correct functioning of the master circadian pacemaker in mammals (Bunger et al., 2000). In fact, single gene deletion of most clock genes leads to compensational mechanisms that are able to generate weaker circadian patterns (Liu et al., 2007). However, deletion of Bmal1, exclusively, is sufficient to eliminate the circadian clock function in the whole body (Bunger et al., 2000). Despite this, only a limited amount of studies have investigated the effects of circadian disruption in cognition via ablation of Bmal1 (Haque et al., 2019). Evidence shows that Bmal1 KO mice display arrhythmic circadian behavior, reduced lifespan and early aging (Kondratov et al., 2006A). In addition, these animals also exhibit general health issues including decreased overall activity and decreased body weight (Bunger et al., 2000; Bunger et al., 2005; Sun et al., 2006). Besides, to our knowledge, this phenotype has not been behaviorally assessed and potential cognitive dysfunctions might remain unknown. In particular, the role of BMAL1 in reward behavior has not been investigated.
Circadian rhythms and reward-related behavior
It seems evident that circadian rhythms play a fundamental role in reward related neurophysiology and behavior, which is mediated by its strong link to dopaminergic activity (Abarca et al., 2002; Schade et al., 1995; Shieh et al., 1997). In humans, plasma concentrations of dopamine (DA) have been described to oscillate rhythmically throughout the day (Sowers & Vlachakis, 1984). Additionally, a study of diurnal rhythms of reward responses used a BOLD fMRI paradigm to assess neural reward activation at different times of the day (Jem et al., 2017). They reported a consistent and
systematic rhythmicity in reward-related areas across participants. On this basis, disruption of circadian rhythms can lead to detrimental consequences for the reward system (DePoy et al., 2017). As a result, circadian rhythm disruption has been suggested to contribute to the development of psychiatric disorders like SUD (Conroy & Arnedt, 2014; Parekh et al., 2015).
In order to study this phenomenon, several populations with single nucleotide polymorphisms in central clock genes have been identified (Hawkins et al., 2008). Many of these are associated with affective and SUD (Saffroy et al., 2019). Repeated variation in the human PER2 gene has been described as a new genetic marker related to cocaine addiction and to brain D2 receptor availability (Shumay et al., 2012). Regarding Bmal1, some polymorphisms of its gene are associated with bipolar and depressive disorders (Dmitrzak-Weglarz et al., 2015; Nettle & Bateson, 2012; Utge et al., 2010). Although little to no research has examined its role in drug seeking behavior.
Regarding preclinical studies, extracellular concentrations of DA in rats experience a peak in the NAc and dorsolateral caudate nucleus across the dark period (Paulson & Robinson, 1994). Furthermore, this fluctuation of DA release in the striatum is dependent on circadian oscillations (Castañeda et al., 2004). This is in accordance with the fluctuations in reward-related behavior displayed by animals (Baird & Gauvin, 2000). Studies have distinguished diurnal rhythmicity in electrical cerebral self-stimulation and cocaine-seeking behavior (Terman & Terman, 1975; Webb et al., 2015). Similarly, in associative learning tasks like cocaine place condition place preference (CPP), animals show an increased preference for drug-paired environments depending on the time through the LD cycle (Abarca et al., 2002).
A potential mediator between this two phenomena is DA receptor 2 (D2R), which is known to be involved as target of circadian rhythms (Baba et al., 2017). Signaling mediated by D2Rs enhances CLOCK:BMAL1 transcriptional potential (Yujnovsky et al., 2006). At the same time, 2DR expression is dependent on the circadian cycle, as it is regulated by Per2 (Shumay et al., 2012). Moreover, low striatal D2R count has been described in animal models of addiction and cocaine users (Dalley et al., 2007). Such findings suggest the involvement of circadian rhythms in the control of the mesolimbic circuit in SUD and addiction. Some studies have attempted to create a link between this rewarding rhythmicity and alterations in particular clock genes (Abarca et al., 2002). For example, CLOCK KO mice show increased cocaine reward (McClung et al., 2005). On the same line, Per2 seems to be a potent modulator of the cocaine’s effects in mice (Brager et al., 2013). Alternatively, Cry1 and Cry2 KO mice display altered cognitive function and reduced response to cocaine (De Bundel et al., 2013). Surprisingly, drug reward and sensitization in Bmal1 KO mice remains unexplored. It seems there is a clear knowledge gap regarding functionality of BMAL1 in most scientific fields. Tackling this gap with novel research is essential to expand our knowledge on the functioning of the circadian clock and its consequences to behavior. We must investigate the causal association between circadian rhythm disruption and clock genes.
In the present study, we investigated the behavioral and neurobiological consequences of circadian clock disruption through the deletion of the Bmal1 gene in mice, and how these alterations could affect the rewarding effects of cocaine.
This research aimed to answer three fundamental questions. First, we investigated the effects of ablation of Bmal1 in behavior and cognitive function of KO mice. Specifically, we were interested in changes in locomotor activity, memory function, sociability, as well as anxiety- and despair-like behaviors. Following, we studied the impact of Bmal1 ablation on cocaine reward and sensitization. Lastly, at a molecular level, we researched how deletion of Bmal1 influenced the expression of other clock-related proteins, among them: CLOCK, Per1/2 and D2Rs
Due to the widespread effects circadian rhythm disruption has on behavior, we hypothesized some degree of cognitive deficit in Bmal1 KO mice (Bmal1(-/-)) compared to wild type (Bmal1(+/+)). These may include memory dysfunction, increased anxiety- and despair-like behavior and altered locomotor activity throughout the LD cycle. Regarding reward related behavior, we suspect that lack of Bmal1 gene would increase the vulnerability towards cocaine intake and abuse as well as higher percentages of consumption. Lastly, we expected a disruption in normal expression of PER1/2 due to ablation of Bmal1, a normal expression of the CLOCK protein in KO animals and a reduced expression of D2R in the PFC.
For this purpose, several experiments were conducted. Firstly, KO and wild type (WT) mice were exposed to a series of behavioral tests including: spontaneous locomotor activity, elevated plus maze (EPM), Y-maze, novel object recognition (NOR), social interaction, social novelty, and tail suspension test. Secondly, we performed a conditioning place preference, and cocaine sensitization paradigms. Thirdly, we assessed the collected brain samples corresponding to the mesolimbic area by means of a real-time quantitative polymerase chain reaction (RT-qPCR).
Methods
Animals
30 heterozygous C57BL/6, (Bmal1(+/-)) animals were kindly donated by Dr S.A. Benitah at the Stem Cells and Cancer Lab at the Institute for Research in Biomedicine (IRB) and were received at our animal facility, UBIOMEX, PRBB. The animals were placed in pairs in standard cages at a temperature- (21 ± 1ºC) and humidity- (55% ± 10%) controlled room and subjected to a 12 h LD cycle; lights on from 8:00 to 20:00 h, and ad libitum access to food and water. These mice were used as breeders for a batch of mice for the tests. For each batch of mice, males were introduced in the female cages and housed there for a maximum of 10 consecutive days or until pregnancy was confirmed. Then they were removed and housed individually in standard cages. Offspring were weaned at postnatal day 21 and they were housed in groups by gender. After weaning, the animals were subject to a tail biopsy in order to determine their genotype; homozygous (Bmal1(-/-)), heterozygous (Bmal1 (+/-)) or WT (Bmal1 (+/+)). A total number of 87 mice was included for this work. All experiments were carried out in accordance with the guidelines of the European Communities Directive 88/609/EEC regulating animal research. Procedures were approved by the local ethical committee (CEEA-PRBB) and every effort was made to minimize animal suffering and discomfort as well as the number of animals used.
Genotyping Tail sample biopsy
DNA for the genotyping of the animals was obtained from the tail. For this, animals were placed in a plastic clamp so they remained immobilized during the procedure. A surgery scalpel was used to sever approximately 1cm of tail. Then, an
electric cautery was utilized to burn the wound in the animals tail to prevent infections and facilitate recovery. Samples were immediately stored at 4C.
DNA extraction
Tail samples were mixed with 400 µL of a lysis buffer containing Tris 10mM (pH 8), EDTA 0.5M, NaCl 5M, H2O MiliQ and lyophilized proteinase K (0,2 mg/ml) and left overnight at 56C. The next day, they were vortexed and centrifuged at 10000 rpm for 10 minutes at room temperature. Supernatant was retrieved and relocated to an empty Eppendorf. Then, 350µL of isopropanol were added and the Eppendorfs were agitated until DNA precipitation occurred. The exceeding volume of isopropanol was partially removed and the DNA was washed with 380µL of ethanol 70% and vortexed. Subsequently, DNA was collected with a yellow tip and taken to a new Eppendorf containing 150µL of Tris 10mM (pH 8). Samples were then kept overnight on a rocker platform at 25C. Following that, they were vortex once again and stored at 4C for further analysis.
Primers and PCR
In order to determine whether the animals exhibited a heterozygous, homozygous or wildtype genotype for the Bmal1 gene, a PCR protocol was performed. Three different primers were used: 5’loxPfor (WT/Bmal1-stopFL):
CCCCCTACTCCTCTTCACCT; 3’loxPfor (WTrev): TCAGCCAGAGTAGCCAGACA; and 3’loxPfor (Bmal1-stopFL rev): GCCTGTCCCTCTCACCTTCT.
The DNA samples were preincubated at 95ºC for 4 minutes. During this time a master mix was prepared (Table 1). Total volume was calculated for the amount of samples. Then, the PCR program was run in accordance with the parameters describe in table 2.
Electrophoresis
Once the amplification was completed. The products were prepared and run through electrophoresis to finally obtain the information required about the genotype of the animals. An agarose gel at 1.8% was prepared containing TAE1X, and ethidium bromide (6µg/100mL of gel). 15µ of each sample was pipetted into the wells together with 1.5µL methylene blue. Following, the gel was run at 120V for 35 minutes. In order to visualize the separated DNA fragments, gels were assessed with a BIORAD imaging system. In this way, samples the belonged to WT animals displayed one band (294 pb), samples from homozygotes displayed 1 band at (444pb) and heterozygotes displayed both bands (294 pb and 444 pb). Design
For the behavioral tests, we only used heterozygous and wild type mice. Wild type mice were considered the control group, because BMAL1 expression was not affected; however, the lack expression of the Bmal1 gene in the homozygous animals classified them as the experimental group. It is important to take in count that, because the behavioral Bmal1 ablation. To avoid potential influences of the LD cycle in behavior, we performed the experiments under both conditions; during the light and dark phases. In order to evaluate the possibility of sex differences in behavior, we used both sexes, male and female mice. Behavioral experimentation
Locomotor activity
Animals were placed in an automatized box (24 x 24 x 24 cm) with 14 axes (X and Y) that automatically recorded spontaneous locomotor activity (LE881 IR, Panlab s.l.u., Barcelona, Spain). For 30 minutes, mice were allowed to explore the environment after which, they were returned to their home cages. Two types of movements were registered: ambulations (horizontal), and
rearings (vertical). Data was collected in 6 intervals of 5 minutes which provided information regarding their habituation to the cage as previously described (Gracia-Rubio, Martinez-Laorden, et al., 2016). Elevated Plus Maze
This test is widely performed to measure anxiety responses in animals. For this paradigm, a cross-shaped structure with two closed arms and two open arms was used (16 x 5 cm). The maze was elevated 30 cm above the floor in dim lighting conditions (30 lux). It is understood that mice displaying anxiety-like behaviors tend to spend more time in the closed arms than in the open arms. Contrary, more explorative animals, which spend more time in open arms are thought to have a reduced anxiety-like behavior. Sessions consisted of 5 minutes during which animals were allowed to freely explore the maze. Collected data included: number of entries in closed and open arms, total distance traveled, and time spent in the center and both types of arms.
Step Temperature Time Cycles Initial denaturation 95ºC 3 min 1x 1. Denaturation 95ºC 30 sec 35x 2. Annealing 59ºC 1 min 3. Extension 72ºC 1 min Final extension 72ºC 5 min 1x Storage 4ºC hold ∞ Substance Volume PCR buffer 10X 3 μL MgCl2 (50mM) 0.75 μL dNTPs (25mM) 1.08 μL Primer 5’loxPfor (10 μM) 1.08 μL Primer 3’loxPRv (10 μM) 0.48 μL Primer Bmal1-stop-FL (10 μM) 0.60 μL TaqPol 1.0 μL DNA 2.00 μL dH2O 20.01 μL
Table 1. Master mix for PCR
Y maze
This test is commonly used to assess memory function, concretely working memory. The task was performed by introducing an animal in the center of a Y-shaped maze with two equal arms, each 395 mm long and separated by 120º angles. Mice were allowed to freely explore it for 8 minutes.
It’s been shown that healthy mice, due to their preference for novelty, explore the maze by alternating their entrances in the arms. Theory implies that mice are prone to explore the least recent visited arm, therefore constantly alternating between the three. Hence, an alternation is described as 3 consecutive entries in the 3 different arms. Then, data was used to calculate the percentage of alternation of each animal. Novel Object Recognition (NOR)
The NOR task was performed to evaluate hippocampal memory, as previously reported (Maccarrone et al., 2002), with minor modifications. The test was performed in a white Plexiglas box (50 x 50 x 30 cm) with white vertical walls under dim light intensity (30 lux) in the middle of the field. Briefly, animals were habituated to an open-filed-like box for 15 minutes and returned to their homecages. 24 hours after such habituation phase, the mice continued to the training session. For this, animals were placed back in the box where two equal objects had been introduced in opposite corners of the field. Mice were allowed to freely move and explore the objects for 5 minutes after which they were placed back to their cage. After an intersession interval of 3 hours, they were introduced again in the arena where one of the objects had been replaced by a novel item with different properties. Mice able to explore the novel scenario for a 5-minute period which constituted the test session. It is known that rodents with functioning memory skills spend more time inspecting
the novel item than the familiar one. However, animals with an impaired memory are expected to be unable to discriminate between novel and familiar and, therefore, to explore them similarly. For long-term memory assessment, animals were placed inside the box 24h after the training session. This time, the novel item was again substituted with a different type of object whereas the familiar remained the same in the same position. All sessions were videotaped for further analysis.
Videos where then assessed with the software BORIS (Friard & Gamba, 2016), a specialized program for video coding of animal behavior. Data regarding time spent exploring both objects; in total and separately, was collected and processed in order to calculate the percentage of exploration and the index of discrimination (see formulas). Both units were then assessed and compared among groups to evaluate short- and long-term memory function (3 and 24h of retention time, respectively). Animals that did not explore both objects for a minimum of 20 seconds in total were excluded from the experiment. Three chamber social interaction and social novelty test
It is known that rodents exhibit an important social activity by spending time investigating congeners (sociability) and that they investigate a novel intruder individual more so than a familiar one (social novelty). The three-chamber test helps to identify deficits in sociability and aptitude to recognize novel versus familiar animals. This test was performed in three sessions of 10 minutes each. Necessary materials included a three-chambered box and two pencil holder that allowed visual, tactile and olfactory contact between the inside and outside. After a first session of habituation to the empty box, a different mouse (unknown by the subject) was trapped inside one of the holders and introduced in one of the chambers. Then,
the subject was reintroduced and allowed to explore the box freely. This constituted the second session or the social interaction test. Lastly, during the third session, a second intruder mouse was introduced in the second empty holder. Once again, the subject was reintroduced and allowed to move throughout the chambers. Time spent in each compartment throughout the sessions was recorded by a camera and process by SMART video tracking software. Then, the sociability scores were calculated by subtracting the amount of time spent in the empty compartment from the time exploring the intruder compartment. Alternatively, the social novelty scores were obtained by subtracting the amount of time in the first intruder compartment from the first intruder room.
Tail suspension test
The tail suspension test evaluates hopelessness in rodents by exposing them to unescapable stress (Planchez et al., 2019; Valvassori et al., 2017). Animals underwent the TST as described previously (Gracia-Rubio et al., 2016). In short, each mouse was suspended 50 cm above a bench top in a large metallic structure composed by two perpendicular bars for 6 minutes (using adhesive tape attached 1cm from the tip of the tail). The time (s) animals spent completely immobile was recorded. This immobility is taken as an indication of depression-like behavior (Planchez et al., 2019; Valvassori et al., 2017).
Cocaine conditioned place preference (CPP) Conditioned place preference (CPP) paradigm is an associative learning task for studying the rewarding effects of several psychostimulants. For this, drug administration is paired with a particular environmental context. The apparatus used for this purpose consisted of two compartments (30 x 29 x 35cm each) with different visual and tactile properties (Cibertec S.A., Madrid, Spain). One chamber
had white walls with textured flooring consisting of prism shapes, whereas the other one, had black walls and a smooth floor. Both were equipped with infrared detectors that allowed the location of the animals throughout the procedure. A short corridor (14 x 29 x 35cm) connected the two rooms allowing free bidirectional passage for the mice. All mice were tested during the light phase of the LD cycle.
The procedure was performed as previously described (Simonin et al., 1998). It consisted of three distinct phases: preconditioning (one session), conditioning (eight sessions) and testing day (one session). The preconditioning phase took place on testing day 1. This session was 20 minutes long during which mice were allowed to freely move throughout the apparatus. Animals displaying unconditioned aversion or preference (<33% or >66% of total time, respectively) were excluded from the study. Alternatively, the ones that fulfilled the inclusion requirements continued on the next day to the conditioning training. This phase consisted of 30-minute 8 sessions taking place once a day. This time, fluctuation between compartments was blocked by guillotine doors. Before their confinement in one of the compartments, animals were administered with an i.p. injection of 5mg/kg of cocaine or physiological saline on alternate days (sessions 1, 3, 5, 7 and sessions 2, 4, 6, 8 respectively). For each mouse, each compartment was consistently paired to one of the treatments, however, treatment was counterbalanced between compartments. Animals belonging to the control group received exclusively saline injections throughout the experiment. Testing session took place on day 10, following training phase. This was performed similarly to the preconditioning phase, were subjects were again allowed to freely explore the apparatus for 20 minutes.
The amount of time spent in each compartment during the preconditioning and testing sessions was documented and assessed. The CPP score for each animal was calculated as the difference between the time spent in the drug-paired compartment during both phases.
Cocaine sensitization paradigm
Sensitization refers to the enhancement of behavioral responses to cocaine, in this case, locomotor activity. The paradigm was performed as previously described (Cantacorps et al., 2020). Once again, the procedure consisted of three phases: habituation, acquisition and challenge. All mice were tested during the light phase of the LD cycle. During the first phase, mice were habituated individually to the previously described locomotor activity boxes. They were allowed to explore the box for 30 min after an i.p. administration of saline. On the succeeding five days, the acquisition phase took place. This process was performed similarly to the habituation. However, this time mice were treated with a dose of 10mg/kg of cocaine or saline immediately prior to the daily sessions. Then, mice underwent a drug-free period of 7 days after the last cocaine treatment. After which, the last phase of sensitization took place. During this challenge phase, mice were once again injected with the same cocaine dosing and locomotor activity was
recorded for 30 minutes. Lastly, the Δ Score was calculated by subtracting the activity counts of the habituation.
Animal sacrifice and sample collection Animals were sacrificed by cervical dislocation the day following the TST. Importantly, animals were dislocated during the LD phase corresponding to the one in which they were tested. Then, brains were immediately removed from the skull and placed in a cold plaque. The PFCs of the mice were dissected and stored at -80ºC at once until the biochemical analysis was performed.
RNA isolation and RT-qPCR for CLOCK, PER2 and D2R
RNA extraction from PFC samples was conducted using trizol as previously described (Cardenas-Perez et al., 2018). RT-PCR was performed by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) using random primers and following standardized protocols.
For the qPCR, we used cDNA (20 ng), Light Cycler SBYR green 480 Master Mix (Roche LifeScience, Product No. 04707516001) and the specific primers (Table 3) for clock, Per2 and D2R as well as GAPDH (table X) as housekeeping gene (Integrated DNA
Primer sequence (5’ ⟶ 3’)
CLOCK Forward GGTCAAGGGCTACAGATGTTT
CLOCK Reverse CAGGTGTGAGTTGCTGGATATTA
Per2 Forward CAACAACCCACACACCAAAC
Per2 Reverse CTCGATCAGATCCTGAGGTAGA
D2R Forward CCCAGCAGAAGGAGAAGAAAG
D2R Reverse CAGGATGTGCGTGATGAAGA
GAPDH Forward GGAGAAACCTGCCAAGTATGA
GAPDH Reverse TCCTCAGTGTAGCCCCAAGA
Technologies, Inc.). The qPCR was performed in LightCycler ® 480 Instrument II (Roche LifeScience) using next program: 95°C-10s, 60°C-20s, 72°C-10s for 45 cycles.
Results
First, the results of the behavioral experimentation contributed to the observation of cognitive impairments in the Bmal1 KO strain. Note that, in the cases where no significant differences were found between males and females, data was joint into one group.
Bmal1 KO mice show altered locomotor activity with impaired habituation throughout the LD cycle
Spontaneous locomotor activity was assessed throughout the LD cycle (Figure 2). Data is represented in a line and bar graphs representing activity counts per 5 minute interval and cumulative activity count for 30 minutes respectively. As per the first image (Figure 2A), a three way ANOVA revealed an effect of cycle (F(1, 71)=19.466; p<0.001), where animals tested in the dark accounted for more recorded deambulations (p<0.001). The analysis also identified a time interval (F(5, 67)=19.268; p<0.000) generally, the number of activity counts decreased throughout the 30 minute
session. Specifically, the number of activity counts was significantly higher in the first 5 minutes than during the other 5 intervals (p<0.001). Additionally, a genotype x time interaction was observed (F(1, 71)=19.288); p<0.001). Interestingly, no significant differences were found between WT and KO during the first or second 5 minute intervals (p<0.05), however, we observed that after the third interval, WT animals significantly reduce their activity compared to KO. Lastly, no triple interaction between the factors was found.
Regarding total activity counts (Figure 2B), results show the cumulative counts during the entirety of the session. A two way ANOVA revealed significant differences between the phases at which animals were tested (F(1, 71)=19.466; p<0.000). Mice tested during the dark cycle showed a higher activity counts. Additionally, no effect of genotype (F(1, 71)=3.340; p=0.072) nor interaction between factors were found. Data was also analyzed for sex difference, however statistical effects of sex were not observed (n.s.; data not shown).
Bmal1 KO did not modify anxiety behavior compared to WT.
Mice were tested for anxiety-like behavior by means of the EPM paradigm (Figure 3). A
Figure 1. Spontaneous locomotor activity. Activity counts registered. Data expressed as the mean ± SEM. A) Activity counts per 5 minute interval during the session. B) Total activity counts during the session (30 minutes). ◆ = KO 5min vs. KO 30 min; #=WT 5 min vs. WT 30 min; a=KO vs. WT; * p<0.05; phase effect **p<0.001 ***p<0.001 (Bonferroni post hoc test).
two-way ANOVA indicated a genotype × cycle interaction (F(1, 65)=10.488; p<0.01) for the percentage of time in open arms (Figure 3A). During the light cycle, KO mice spent significantly more time in the open arms compared to WT (p=0.001). Additionally, WT animals spent more time in the open arm during the dark session when compared to the light phase (p<0.01). A three-way ANOVA revealed no differences between sexes (n.s. data not shown). Regarding the number of entries (Figure 3B), a two-way ANOVA showed an effect of genotype (F(1, 63)=5.039; p<0.05) the number of entries in all the arms were assessed. Generally, KO animals displayed a higher number of total entries than WT (p<0.05). Furthermore a non-significant tendency genotype × cycle was identified (F(1, 63)=3.964; p=0.051 n.s.) where it seemed like during the light phase KO mice showed a higher number of entries the WT. The trend also indicated that WT in the light phase seemed to exhibit less total entries than during the dark phase. No sex differences were identified (n.s. data not shown).
Bmal1 KO mice showed normal working memory compared to WT
To assess spatial and working memory, mice were exposed to the Y-maze spontaneous alteration test (Figure 4). A two-way ANOVA reveal no significant effects. The analysis of sex differences between groups did not reveal any significant effect (n.s.; data not shown).
Bmal1 KO mice displayed intact memory function in the NOR test
The novel object recognition was performed
in order to identify memory deficits. When calculating the percentage of preference, no Figure 3. Spontaneous alternation Y-maze test. Data expressed as the mean ± SEM.
Y-maze
Figure 2. Behavioral differences between KO and WR mice in the elevated plus maze. Data expressed as the mean ± SEM. The percentage of time spent in open arms (A) and the number of total entries in arms (b) were assessed. **p<0.01 KO-L vs WT-L; *p<0.05 WT-D vs WT-L, genotype cycle, (Bonferroni post hoc test), *p<0.05 KO vs WT (two-way ANOVA).
A) B)
significant effects or interactions were found (Two-way ANOVA) at neither 3h nor 24h after training (n.s. data not shown). Additionally, no effects of sex were identified. However, with regards to the discrimination index at 3h (Figure 5A), a three-way ANOVA revealed two interactions: genotype × cycle (F(1, 66)=4.042; p<0.05), and genotype × sex (F(1, 66)=5.315; p<0.05). During the light phase, the KO animals displayed a higher discrimination index than WT (p<0.012). Additionally, WT seem to behave differently across the LD cycle, displaying a trend of higher discrimination during the dark phase compared to the light session (p=0.055). Furthermore, KO males showed a higher discrimination index than male WT (p<0.01). Lastly, KO males showed increased discrimination compared to KO females (p<0.05). No triple interaction between the factors was found (F(1, 66)=1.593; p>0.05, n.s.). Lastly, as per the discrimination index at 24h (Figure 5B), no significant differences were found.
Bmal1 KO animals showed normal sociability but impaired social recognition compared to WT
Figure 6 shows the results obtained from the three chamber social interaction test. Since no significant differences were found between sexes (three-way ANOVA; n.s.), results from females and male were analyzed as one group. Regarding the sociability test (Figure 6A), a three-way ANOVA revealed a compartment (F(2,140)=165.038; p<0.001) and cycle (F(1,70)=23.786; p<0.0001) effects. A Bonferroni post hoc test revealed that animals spent significantly higher percentages of time in the compartment that contained an animal (Novel) (p<0.001) than in the other two compartments with no intruders (empty and center) (Figure 6A). Additionally, it was found that animals behaved differently in the light phase compared to the dark phase (p<0.001). Figure 6B displays the difference in time percentage between the empty and the intruder’s compartment. As it can be seen, animals spend around 20-30% more time in the room containing another animal than in Figure 4. Novel Object Recognition test in Bmal1 KO and wild type mice. Data expressed as mean ±SEM. (A) Discrimination index at 3h. B) Discrimination index after 24h. *p<0.05 KO-L vs WT-L (Bonferroni post hoc test).
3h 24h
A) B)
the empty room. However, a two-way ANOVA revealed no significant differences between genotypes or cycles.
With regards to the social novelty test (Figure 6C), a three-way ANOVA revealed a genotype (F(1,70)=5.936; p<0.01), cycle (F(1,70)=34.303; p<0.001), and compartment (F(1,70)= 3; p<0.001), effect, as well as an interaction compartment × genotype (F(2,69)=3.16; p<0.05) and
between compartment × cycle
(F(2,69)=3.211); p<0.05). Post hoc tests regarding the first interaction revealed that WT animals spent significantly higher percentages of time in the novel 2
compartment (p<0.05) and lower percentages in the novel 1 compartment (p<0.05) when compared to Bmal1 KO animals. As per the time difference between novel 2 and novel 1 (Figure 6D), a two-way ANOVA showed a genotype effect (F(1, 70)=6.258); p<0.05). Across phases, WT mice scored significantly higher than KO mice in the social novelty session (p<0.05). No phase effect or interaction between factors were found.
Bmal1 KO mice did not display increased despair-like behavior during the TST In order to assess despair-like behavior, mice were exposed to the tail suspension test
Sociability
Social Novelty
Figure 5. Results of the three chamber social interaction test for KO and WT animals across the LD cycle. A) Percentage of time spent in each compartment during the sociability test. B) Differences in time percentages between the compartment hosting a mouse (novel) and the empty one during the sociability test. C) Percentage of time spent in each compartment during the social novelty test. D) Differences in time percentages between the compartment hosting a novel mouse (novel 2) and the familiar mouse (novel 1) during the social novelty test. Data expressed as mean ± SEM. *<0.05; ***p<0.001; (Bonferroni post hoc test).
A) B)
(Figure 7). A two-way ANOVA reveal no statistical effects nor interaction between factors. Additionally, a three-way ANOVA was performed in order to study sex differences between groups. No significant differences were found (n.s.; data not shown).
Bmal1 KO mice displayed similar behavior to WT during the cocaine CPP The condition place preference was performed in order to study the animal’s reaction to rewarding effects of cocaine. A two-way ANOVA revealed a treatment effect (F(1,13)=16.06; p<0.001). Where cocaine treatment increased the ∆Scores for both WT and KO mice (p<0.001). However, no genotype effect was found.
KO mice exhibited decrease sensitization to cocaine
The cocaine sensitization test was plotted in Figure 9. A three-way ANOVA revealed several effects and interactions between the factors. First, we identified a time effect (F(2, 48)=19.381); p<0.001). In general, animals showed higher activity counts during the challenge compared to Day 1 and 5
(p<0.001). Secondly, a prominent treatment effect was observed (F(1, 48)=59.497; p<0.001). Animals that received cocaine showed a higher number than saline injected mice (p<0.001). Thirdly, a genotype effect (F(1, 48)=13.126); p<0.05) where KO animals displayed significantly lower activity counts than WT (p<0.05). Lastly, two interactions between factors were identified: day × treatment (F(2, 48)=5.544; p<0.01) and day × genotype (F(1, 48)=4.761; p<0.034). Specifically, during day 1 mice receiving cocaine scored higher in activity counts (p<0.001). This difference was also observed in day 5 (p<0.001). However, no significant differences between treatment were found during the challenge day (p=0.081). Additionally, it was observed that WT animals receiving cocaine showed a
Figure 7. Immobility time during the tail suspension test. Data are expressed as mean ± SEM.
TST
Figure 7. Effects of Bmal1 KO in cocaine CPP ∆Scores. CPP induced by 5 mg/kg of cocaine. Data expressed as mean ± SEM. ***p<0.001 cocaine vs saline.
significantly higher activity counts than KO
Figure 9. Behavioral sensitization induced by repeated cocaine administration (10 mg/kg)in of Bmal1 KO and WT animals. Day one represents effects of acute administration of cocaine or saline. Day five represents effects of continued exposure to cocaine or saline. Challenge represents acute administration of cocaine or saline after 7 days without administration. Δ Scores represent activity counts of the session minus activity counts of the habituation session. Data expressed as mean ± SEM. ***p<0.001; challenge vs day 1; challenge vs day 5; WT-cocaine vs WT saline; WT-cocaine vs WT saline.
Figure 9. Effects of Bmal1 KO on gene expression in the PFC. A) Real-time PCR relative expression of CLOCK mRNA in the PFC of WT and KO mice. B) Expression of Per2 C) mRNA expression of D2Rs.
A) B)
significantly higher activity counts than KO animals receiving cocaine (p<0.001).
No differences in expression of clock, per2, nor D2Rs in the PFC were found between Bmal1 KO and WT
In order to investigate the effects of Bmal1 in the expression of other clock genes, a qPCR was performed with the aim of determining levels of CLOCK, PER2 and 2DRs in the PFC (Figure 10). Student t-tests were performed to compare the two groups for each particular gene. No significant differences were observed in the expression of CLOCK, PER2 nor 2DRs between KO and WT animals.
Discussion
In the present study, we investigated the behavioral and neurobiological consequences of the disruption of the circadian clock through deletion of the Bmal1 gene in mice. Our study addressed three fundamental questions. First, the effects of ablation of Bmal1 in behavior and cognitive function of KO mice, specifically: changes in locomotor activity, memory function, sociability, as well as anxiety- and despair-like behaviors. Second, we studied the impact of Bmal1 ablation on cocaine rewarding effects and behavioral sensitization. Third, at a molecular level, we researched how deletion of Bmal1 influenced the expression of other clock-related proteins, like: CLOCK, Per1/2 and D2Rs.
In line with our first hypothesis: we expected to observe a disruption of circadian rhythms and some degree of cognitive deficit in Bmal1 KO mice compared to WT. The disruption of circadian rhythms is confirmed by the hyperlocomotion exhibited by the KO mice throughout the LD cycle. This finding is in accordance with the existing literature
(McDearmon et al., 2006). Additionally, Bmal1 KO mice displayed impaired habituation, which has also been described in the past (Kondratova et al., 2010).
Changes in anxiety-like behavior were not identified in KO mice. In fact, WT seemed to display an increased anxiety-like behavior during the light test. This could be due to the sensibility of the test to stressors, hence, the distress from disturbing the animal’s sleep cycle might have influenced their behavior. In fact, significant behavioral differences have been found between the light and dark phases in rodents. In rats, it has been shown that when animals are tested in the light phase, they display a reduction of 20% in time spent in open arms compared to when tested during the dark phase (Andrade et al., 2003).Another possible explanation is based on the low levels of spontaneous locomotion displayed by the WT during the light phase. This could have promoted an aversion to explore the maze. Accordingly, given the number of arm entries, WT mice seemed to investigate the maze less during the light phase compared to the dark phase. Previous research regarding Bmal1 KO animals concluded that these mice did not show elevated anxiety levels judging by the time spent in the center of an open field arena
(Kondratova et al., 2010). However, no evidence has been reported regarding the behavior of total Bmal1 in the EPM. Snider et al. (2016) studied a knock-down (KD) model via CRE-mediated deletion of Bmal1 in excitatory forebrain neurons. Similarly to our study, when tested in the EPM, these animals did not show significant differences in performance compared to WT.
Regarding the Y-maze test for working and spatial memory functions, KO mice did not show any variations in spontaneous alternation behavior. This is in contradiction with the limited literature available. Snider & Obrietan (2018) have recently shown that Bmal1 KO animals did show a decreased
spontaneous alternation compared to WT animals. Whereas there were no important differences between our protocols, it is important to consider the elevated percentage of alternation exhibited by the WT group (around 67.5%), which is considerably higher than the controls of the present study (53%). However, Bmal1 KO animals did show a relatively similar alternation percentage across experiments (50-54%). This could have an impact in our results by compromising our comparison between WT and KO, and therefore masking potential differences in behavior.
The NOR test indicated significant differences between KO and WT during the light phase. Additionally, significant improvement in performance was found in WT from the light to the dark phase. To our knowledge, these are the first reported results displaying the effects of the LD cycle in WT performance in the NOR test. Additionally, limited studies have investigated Bmal1 KO performance in the NOR.
Importantly, a common observation throughout these tests is that WT animals seem to behave differently across the LD phase whereas KO seem to have a homogeneous behavior. This is in accordance with their disruption of the circadian rhythmicity via Bmal1 KO.
Although the social interaction test did not reflect a deficit in sociability in Bmal1 KO nor WT, a reduction of preference for social novelty was found in KO animals. This could be interpreted in two ways: KO mice do not distinguish between familiar and novel individuals or that animals do recognize the familiar intruder but show no preference in socialize with it compared to the novel mouse. The first seems to be the most plausible explanation due to mice’s innate preference for novelty (Winslow, 2003). Then, it can be considered that KO animals
show impaired social recognition. Our results are the first reported evidence of social memory deficits in Bmal1 KO mice. These impairments have been previously studied and associated to a number of neurobiological mechanisms. For instance, hippocampal CA2 lesions in the brain of mice can lead to this behavior alteration
(Stevenson & Caldwell, 2014). However, associating Bmal1 influence to a specific process is not possible due to lack of evidence. Further research will be required to identify the exact relationship between Bmal1 and social behavior. For example, a hippocampal CA2 KD model of Bmal1 could be useful to determine whether depletion of BMAL1 in this region is sufficient to cause the impairment or this process depends on interconnectivity across areas, which might be influenced by disruption of circadian rhythms.
Regarding the TST, no despair-like behavior was identified in KO mice. These are the first reported results regarding the effects of total Bmal1 KO on despair-like behavior. However, some studies used partial Bmal1 KD for particular brain regions and exposed the animals to the TST. For instance, adult silencing of Bmal1 in the whole brain leads to increased immobility time during the TST
(Akladious et al., 2018). This is also the case when only the SCN is targeted with shRNA
(Landgraf et al., 2016). Such findings suggest that innate KO mice are able to develop adaptative compensatory mechanisms that arise throughout brain development to counterbalance detrimental effects of BMAL1 depletion. These specific mechanisms remain unknown and might require further investigation.
The second aim of this study was to investigate the impact of Bmal1 ablation on cocaine reward and behavioral sensitization. On the first hand, our results showed no differences in preference for drug-paired environments between genotypes. This
implies that Bmal1 KO mice do not experience altered rewarding effects from administration of cocaine. To date, no studies have reported results regarding cocaine CPP in Bmal1 KO mice. However, some articles have explored the effects of other circadian clock genes in cocaine reward. For example, Cry or mPer1 deficient mice show reduced cocaine response
(Abarca et al., 2002; De Bundel et al., 2013). Alternatively, mPer2 mutant mice display a hypersensitized response to cocaine (Abarca et al., 2002). It is important to consider that the expression of all the above mentioned genes are regulated by BMAL1. Therefore attributing the behavior observed in Bmal1 KO animals to a specific mechanism or brain region might be complicated and requires further investigation. Additionally, in the future it would be valuable to assess Bmal1 KO animals’ anhedonic behavior utilizing alternative paradigms. A previously mentioned study using a SCN-Bmal1-KD found that these mice presented no significant differences in the sucrose preference test (Landgraf et al., 2016). However, this might not be extrapolated to our model of innate Bmal1 KO. In the future, exposing Bmal1 KO animals to the sucrose preference test might provide insight regarding the impact of Bmal1 on anhedonic behavior.
Regarding cocaine sensitization, Bmal1 KO mice displayed a lower sensitivity to cocaine effects than WT animals. Repeatedly, this has not been reported by previous literature. One study in drosophila suggested that mutations in the Cycle gene (homologous to Bmal1 in mammals) leads to impairment of behavioral sensitization to cocaine (Andretic et al., 1999). Importantly, they found that mutations of per and clock genes in drosophila also lead to this inability to sensitize. Unfortunately, no previous work has reported results from cocaine sensitization in Bmal1 KO mice.
This leads us to our third aim regarding how the absence of Bmal1 impacts the expression of target clock genes in the PFC. As expected, Bmal1 ablation did not influence the expression of CLOCK, since its transcription is no dependent from this gene. Surprisingly, the RT-qPCR revealed no changes in mRNA expression of mPer2. To our knowledge, this finding has not been described in the PFC of Bmal1 KO animals to date. Although, changes in its expression have been observed in different areas. A Bmal1 KO model showed that the hippocampal expression of clock genes are severely altered, with mPer2 being greatly down-regulated and mCry1 significantly up-regulated (Kondratova et al., 2010). This observation has also been identified in Bmal1 KO liver cells and is attributed to the role of CLOCK:BMAL1 dimer in the regulation of the transcription of other clock genes (Kondratov et al., 2006B). Our findings suggest that in our animals, alternative mechanisms leading to expression of mPer2 must be available in the PFC. Perhaps these are due to uncommon compensatory processes strengthened during developmental stages, which provide mice with the observed degree of functionality. For instance, its homologous gene Bmal2 has also been implicated in the dimerization with CLOCK and, therefore in transcription of clock genes like mPer2 (Sasaki et al., 2009). Although, it is also generally accepted that Bmal2 is not sufficient to maintain circadian rhythms in absence of Bmal1
(Bunger et al., 2000). Nonetheless, normal levels of mPer2 mRNA do comply with the unvarying changes of 2DRs in the PFC since it has been shown that in the striatum mPer2 is directly linked to 2DR availability (Shumay et al., 2012). On this basis, investigating clock gene expressions in the striatum of Bmal1 KO mice could be of great interest. It could be the case that alteration in levels of clock protein generated by CLOCK:BMAL1 vary greatly across areas. Additionally,
taking into account the results of the cocaine sensitization paradigm, it would be interesting to study the expression of PER2 and 2DRs in reward related regions. More specifically, with a special focus on the ventral tegmental area (VTA), since it is known to regulate cocaine sensitization
(Ortiz et al., 1995).
In summary, our research provided evidence of several behavioral alterations experienced by Bmal1 KO mice including: impaired habituation to environments and impairment of social recognition. Secondly, our results indicated that Bmal1 KO mice experience standard rewarding effects of cocaine and a lower behavioral sensitization to the drug. Lastly, we observed that Bmal1 deletion did not influence the expression of other clock related genes in the PFC. Taken together, the present article offers a novel and extensive characterization of Bmal1 KO animals as well as some first steps into their behavior regarding drug consumption. Based on this, it is important to continue investigating the specific underlying mechanisms that link Bmal1 function to cognitive and reward related processes. Specifically, at the time of identifying potential mediators by which Bmal1 controls cognitive functions. Future research is necessary in order to understand the powerful, widespread influence of individual molecular factors from the circadian clock in many aspects of cognition. This will provide valuable knowledge to our understanding of the consequences of circadian rhythm disruption in a world where sleep is continuously neglected.
Acknowledgments
I would like to express my very great appreciation to Prof. Olga Valverde for providing me with the opportunity to work in this project and for her constant support throughout these difficult times. I would also
like to thank my research project supervisor, future Dr. Adriana Castro-Zavala for her willingness to offer her time so generously and for her enthusiastic encouragement and patient guidance.
I would also extend my thanks to each member of the GReNeC lab for making me feel as part of the team since day one. As well as the editor of the “La Vanguardia” horoscopes for supplying us with an abundance of entertainment during coffee breaks.
Lastly, I would like to express my gratitude to Prof. Harm Krugers, who has continuously supported me and this project from the distance.
References
Abarca, C., Albrecht, U., & Spanagel, R. (2002). Cocaine sensitization and reward are under the influence of circadian genes and rhythm. Proceedings of the National Academy of Sciences, 99(13), 9026– 9030.
https://doi.org/10.1073/pnas.14203 9099
Akashi, M., & Takumi, T. (2005). The orphan nuclear receptor RORalpha regulates circadian transcription of the mammalian core-clock Bmal1. Nature Structural & Molecular Biology, 12(5), 441–448. https://doi.org/10.1038/nsmb925 Akladious, A., Azzam, S., Hu, Y., & Feng, P.
(2018). Bmal1 knockdown
suppresses wake and increases immobility without altering orexin A, corticotrophin‐releasing hormone, or glutamate decarboxylase. CNS Neuroscience & Therapeutics, 24(6),
549–563.
https://doi.org/10.1111/cns.12815 Andrade, M. M. M., Tomé, M. F., Santiago, E.
S., Lúcia-Santos, A., & de Andrade, T. G. C. S. (2003). Longitudinal study of daily variation of rats’ behavior in the elevated plus-maze. Physiology & Behavior, 78(1), 125–133. https://doi.org/10.1016/s0031-9384(02)00941-1
Andretic, R., Chaney, S., & Hirsh, J. (1999). Requirement of circadian genes for cocaine sensitization in Drosophila. Science (New York, N.Y.), 285(5430), 1066–1068.
https://doi.org/10.1126/science.285 .5430.1066
Baba, K., DeBruyne, J. P., & Tosini, G. (2017). Dopamine 2 Receptor Activation Entrains Circadian Clocks in Mouse Retinal Pigment Epithelium. Scientific Reports, 7(1), 5103. https://doi.org/10.1038/s41598-017-05394-x
Baird, T. J., & Gauvin, D. (2000). Characterization of cocaine
self-administration and
pharmacokinetics as a function of time of day in the rat. Pharmacology, Biochemistry, and Behavior, 65(2), 289–299.
https://doi.org/10.1016/s0091-3057(99)00207-5
Barion, A., & Zee, P. C. (2007). A Clinical Approach to Circadian Rhythm Sleep Disorders. Sleep Medicine, 8(6), 566– 577.
https://doi.org/10.1016/j.sleep.200 6.11.017
Brager, A. J., Stowie, A. C., Prosser, R. A., & Glass, J. D. (2013). The mPer2 clock
gene modulates cocaine actions in the mouse circadian system. Behavioural Brain Research, 243, 255–260.
https://doi.org/10.1016/j.bbr.2013. 01.014
Bunger, M. K., Wilsbacher, L. D., Moran, S. M., Clendenin, C., Radcliffe, L. A., Hogenesch, J. B., Simon, M. C., Takahashi, J. S., & Bradfield, C. A. (2000). Mop3 is an essential component of the master circadian pacemaker in mammals. Cell, 103(7), 1009–1017.
https://doi.org/10.1016/s0092-8674(00)00205-1
Bunger, Maureen K., Walisser, J. A., Sullivan, R., Manley, P. A., Moran, S. M., Kalscheur, V. L., Colman, R. J., & Bradfield, C. A. (2005). Progressive arthropathy in mice with a targeted disruption of the Mop3/Bmal-1 locus. Genesis (New York, N.Y.:
2000), 41(3), 122–132.
https://doi.org/10.1002/gene.20102 Busino, L., Bassermann, F., Maiolica, A., Lee, C., Nolan, P. M., Godinho, S. I. H., Draetta, G. F., & Pagano, M. (2007). SCFFbxl3 controls the oscillation of the circadian clock by directing the degradation of cryptochrome proteins. Science (New York, N.Y.),
316(5826), 900–904.
https://doi.org/10.1126/science.114 1194
Cain, N., & Gradisar, M. (2010). Electronic media use and sleep in school-aged children and adolescents: A review. Sleep Medicine, 11(8), 735–742. https://doi.org/10.1016/j.sleep.201 0.02.006
Cajochen, C., Frey, S., Anders, D., Späti, J., Bues, M., Pross, A., Mager, R., Wirz-Justice, A., & Stefani, O. (2011). Evening exposure to a light-emitting diodes (LED)-backlit computer screen affects circadian physiology and cognitive performance. Journal of Applied Physiology (Bethesda, Md.: 1985), 110(5), 1432–1438. https://doi.org/10.1152/japplphysio l.00165.2011
Cantacorps, L., Montagud-Romero, S., Luján, M. Á., & Valverde, O. (2020). Prenatal and postnatal alcohol exposure increases vulnerability to cocaine addiction in adult mice. British Journal of Pharmacology, 177(5), 1090–1105.
https://doi.org/10.1111/bph.14901 Cardenas-Perez, R. E., Fuentes-Mera, L., De
La Garza, A. L., Torre-Villalvazo, I., Reyes-Castro, L. A., Rodriguez-Rocha, H., Garcia-Garcia, A., Corona-Castillo, J. C., Tovar, A. R., Zambrano, E., Ortiz-Lopez, R., Saville, J., Fuller, M., & Camacho, A. (2018). Maternal overnutrition by hypercaloric diets
programs hypothalamic
mitochondrial fusion and metabolic dysfunction in rat male offspring. Nutrition and Metabolism, 15(1). https://doi.org/10.1186/s12986-018-0279-6
Castañeda, T. R., de Prado, B. M., Prieto, D., & Mora, F. (2004). Circadian rhythms of dopamine, glutamate and GABA in the striatum and nucleus accumbens of the awake rat: Modulation by light. Journal of Pineal Research,
36(3), 177–185.
https://doi.org/10.1046/j.1600-079x.2003.00114.x
Conroy, D. A., & Arnedt, J. T. (2014). Sleep and Substance Use Disorders: An Update. Current Psychiatry Reports,
16(10), 487.
https://doi.org/10.1007/s11920-014-0487-3
Daan, S., & Pittendrigh, C. S. (1976). A Functional analysis of circadian pacemakers in nocturnal rodents. Journal of Comparative Physiology,
106(3), 253–266.
https://doi.org/10.1007/BF0141785 7
Dalley, J. W., Fryer, T. D., Brichard, L., Robinson, E. S. J., Theobald, D. E. H., Lääne, K., Peña, Y., Murphy, E. R., Shah, Y., Probst, K., Abakumova, I., Aigbirhio, F. I., Richards, H. K., Hong, Y., Baron, J.-C., Everitt, B. J., & Robbins, T. W. (2007). Nucleus Accumbens D2/3 Receptors Predict Trait Impulsivity and Cocaine Reinforcement. Science, 315(5816), 1267–1270.
https://doi.org/10.1126/science.113 7073
De Bundel, D., Gangarossa, G., Biever, A., Bonnefont, X., & Valjent, E. (2013). Cognitive dysfunction, elevated anxiety, and reduced cocaine response in circadian clock-deficient cryptochrome knockout mice. Frontiers in Behavioral Neuroscience, 7.
https://doi.org/10.3389/fnbeh.2013 .00152
DePoy, L. M., McClung, C. A., & Logan, R. W. (2017). Neural Mechanisms of Circadian Regulation of Natural and
